CN114507730A - Application of reagent for detecting gene methylation in cervical cancer diagnosis and kit - Google Patents
Application of reagent for detecting gene methylation in cervical cancer diagnosis and kit Download PDFInfo
- Publication number
- CN114507730A CN114507730A CN202011277684.1A CN202011277684A CN114507730A CN 114507730 A CN114507730 A CN 114507730A CN 202011277684 A CN202011277684 A CN 202011277684A CN 114507730 A CN114507730 A CN 114507730A
- Authority
- CN
- China
- Prior art keywords
- seq
- methylation
- neto1
- gpr26
- dpp6
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Abstract
The invention discloses an application of a reagent for detecting gene methylation in cervical cancer diagnosis and a kit, and relates to the technical field of tumor diagnosis. The invention discloses the following genes as markers for cervical cancer or the relevant application in the diagnosis of precancerous lesions thereof: c12orf42, CNTNAP5, DPP6, FERD3L, FOXG1-AS1, GPR26, GRIA2, GRIA4, ITGA8, NETO1 and PABPC 5; the invention provides a new marker and a diagnosis strategy for the diagnosis of cervical cancer.
Description
Technical Field
The invention relates to the technical field of tumor diagnosis, in particular to application of a reagent for detecting gene methylation in cervical cancer diagnosis and a kit.
Background
Cervical cancer is one of the most common gynecological malignancies in the world. In female malignancies, it is second only to breast cancer. There are about 50 more than ten thousand new cases and 20 more than ten thousand deaths worldwide each year. Scientific studies have demonstrated that persistent infection with high-risk papillomaviruses (hrHPV) is a major cause of cervical cancer. The progression from initial viral infection to invasive cervical cancer takes decades. Only with regular physical examination can more than 90% of cervical cancers be detected and prevented. Therefore, the selection of an appropriate and effective diagnostic method is of great significance for the prevention and treatment of cervical cancer. Currently, the conventional screening methods for cervical cancer are cytological examination, HPV DNA detection and colposcopy. Colposcopy has high specificity but requires high quality operators, cytology has high specificity and low sensitivity, and HPV DNA detection has high sensitivity but low specificity. HPV infection is mostly transient, and a positive result in HPV DNA detection causes unnecessary panic to women and wastes medical resources. Only high risk women with true HPV persistent infection need to be followed up. Currently, scientists have made much effort to determine new biomarkers of cervical intraepithelial neoplasia 2+ (CIN2+) to distinguish benign infected women from women in need of intensive treatment to achieve post-screening shunts.
DNA methylation is an important epigenetic modification that plays an important role in regulating gene expression patterns and genomic stability without altering the DNA sequence. Most studies indicate that the methylation level of the relevant gene increases with the severity of cervical lesions and can be used as a biomarker for screening cervical cancer and precancerous lesions.
However, currently, the sensitivity and specificity of biomarkers for cervical cancer still need to be improved.
In view of this, the invention is particularly proposed.
Disclosure of Invention
The invention aims to provide an application of a reagent for detecting gene methylation in cervical cancer diagnosis and a kit. The present invention finds a novel methylated gene useful for the diagnosis of cervical cancer or precancerous lesions thereof: c12orf42, CNTNAP5, DPP6, FERD3L, FOXG1-AS1, GPR26, GRIA2, GRIA4, ITGA8, NETO1 and PABPC5, and methylation of these genes is detected to diagnose cervical cancer or precancerous lesions thereof, with higher specificity; in addition, the reagent for detecting the methylated genes also has new application, such as preparing a cervical cancer or precancerous lesion diagnostic kit thereof. The invention provides a new marker and a diagnosis strategy for diagnosing the cervical cancer and the precancerous lesions thereof.
Based on this, in a first aspect, the present invention provides the use of an agent for detecting methylation of a target gene selected from at least one of the following genes in the manufacture of a kit for diagnosing cervical cancer or a precancerous lesion thereof: c12orf42, CNTNAP5, DPP6, FERD3L, FOXG1-AS1, GPR26, GRIA2, GRIA4, ITGA8, NETO1 and PABPC 5.
The invention provides a new marker which can be used for diagnosing cervical cancer or precancerous lesions thereof, namely the genes which are methylated, and the research of the invention shows that the genes are methylated at different degrees in the cervical cancer or the precancerous lesions thereof, the methylation positive rate in the cervical cancer reaches more than 90 percent, and the invention has potential and prospect as the marker for diagnosing or screening the cervical cancer. Based on the above, the reagent for detecting the methylation of the genes has new application and is used for preparing a kit for diagnosing cervical cancer or precancerous lesions thereof.
In alternative embodiments, the target gene is selected from at least one of the following genes: DPP6, GPR26, NETO1 and PABPC 5.
The research of the invention finds that the diagnosis of cervical cancer or precancerous lesion is carried out by the methylation of DPP6, GPR26, NETO1 and PABPC5 genes, and the diagnosis is higher and more specific.
In alternative embodiments, the target gene is selected from any one of the following combinations of genes:
DPP6+ GPR26, DPP6+ NETO1, DPP6+ PABPC5, GPR26+ NETO1, GPR26+ PABPC5 and NETO1+ PABPC 5.
The diagnosis of the cervical cancer or precancerous lesion in the form of the gene methylation combination can obviously improve and specificity, and particularly, the cervical cancer can be diagnosed in a combined mode of DPP6+ NETO1, GPR26+ NETO1, GPR26+ PABPC5 and NETO1+ PABPC, the sensitivity of the cervical cancer can basically reach 100%, and the specificity is more than 90%.
In alternative embodiments, the reagent detects methylation of the target gene by: methylation-specific PCR, MethyLight, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution solubility curves, methylation-sensitive restriction endonuclease or flap endoluclease.
Detection means for achieving gene methylation are well known to those skilled in the art, and include, but are not limited to, methylation-specific PCR, MethyLight, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific hplc, digital PCR, methylation-specific high-resolution melting curve, methylation-sensitive restriction endonuclease, and flap endonulase, and the like, and methylation detection of a target gene can be achieved by these methods. Based on the above, the reagent suitable for the method can be prepared into a kit for diagnosing the cervical cancer or the precancerous lesion thereof.
In an alternative embodiment, the reagent comprises a primer and a probe as set forth in at least one of items (1) to (11) of the table:
the primers and probes shown in the table are used for detecting the methylation of the corresponding genes, and the primers and probes have higher specificity when judging the cervical cancer or the precancerous lesions thereof. However, in the methylation detection of the above genes by the methylation specificity method, the primers and probes used for each gene include, but are not limited to, the sequences of the primers and probes shown in the above table, and those skilled in the art can design or select other primers and probes based on the genes disclosed in the present invention, which are outside the ranges shown in the above table, and therefore, it is within the scope of the present invention to detect the methylation of the above genes by any primer and probe.
In alternative embodiments, the sample subjected to the gene methylation assay is a cervical cancer tissue sample or a cervical-derived cell sample.
In a second aspect, the present invention provides a kit for diagnosis of cervical cancer or precancerous lesions thereof, comprising: reagents for detecting methylation of a target gene;
the target gene is selected from at least one of the following genes: c12orf42, CNTNAP5, DPP6, FERD3L, FOXG1-AS1, GPR26, GRIA2, GRIA4, ITGA8, NETO1 and PABPC 5.
In alternative embodiments, the target gene is selected from at least one of the following genes: DPP6, GPR26, NETO1 and PABPC 5.
In alternative embodiments, the target gene is selected from any one of the following combinations of genes: DPP6+ GPR26, DPP6+ NETO1, DPP6+ PABPC5, GPR26+ NETO1, GPR26+ PABPC5 and NETO1+ PABPC 5.
In alternative embodiments, the reagent detects methylation of the target gene by: methylation-specific PCR, MethyLight, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution solubility curves, methylation-sensitive restriction endonuclease or flap endoluclease.
In alternative embodiments, the reagents include primers and probes as set forth in at least one of items (1) - (11) of the table:
in a third aspect, the present invention provides a method for preparing a kit for diagnosing cervical cancer or precancerous lesions thereof, which comprises: using a reagent for detecting methylation of a target gene as a main raw material:
the target gene is selected from at least one of the following genes: c12orf42, CNTNAP5, DPP6, FERD3L, FOXG1-AS1, GPR26, GRIA2, GRIA4, ITGA8, NETO1 and PABPC 5.
In alternative embodiments, the target gene is selected from at least one of the following genes: DPP6, GPR26, NETO1 and PABPC 5.
In alternative embodiments, the target gene is selected from any one of the following combinations of genes: DPP6+ GPR26, DPP6+ NETO1, DPP6+ PABPC5, GPR26+ NETO1, GPR26+ PABPC5 and NETO1+ PABPC 5.
In alternative embodiments, the reagent detects methylation of the target gene by: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, MethyLight, pyrosequencing, methylation-specific HPLC, digital PCR, methylation-specific high-resolution solubility curves, methylation-sensitive restriction endonuclease or flap endoluclease.
In alternative embodiments, the reagents include primers and probes as set forth in at least one of items (1) - (11) of the table:
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
The features and properties of the present invention are described in further detail below with reference to examples.
Example 1
This example provides a method for diagnosing cervical cancer or a precancerous lesion thereof by detecting Methylation of one or both of the following genes in a sample by Methylation-specific PCR (MSP):
c12orf42, CNTNAP5, DPP6, FERD3L, FOXG1-AS1, GPR26, GRIA2, GRIA4, ITGA8, NETO1 and PABPC 5.
The method comprises the following specific steps:
(1) cell DNA extraction
Extracting DNA from cervical cell sample of patient to be tested. The cell DNA extraction Kit may be QIAamp DNA Mini Kit (Qiagen, cat # 51304), and the detailed experimental procedures are described in the manufacturer's instructions. The DNA concentration and OD260/OD280 were measured with a NanoDrop 2000 spectrophotometer, and the OD260/OD280 should be between 1.8 and 2.0.
(2) Sulfite conversion
The nucleic acid transformation Kit is EZ DNA Methylation-Gold (TM) Kit of ZYMO RESEARCH, and the specific experimental operation is described in the manufacturer's instruction. In this process, unmethylated cytosine (C) is converted to uracil (U), methylated cytosine is unchanged, uracil pairs with adenine (A) and cytosine pairs with guanine (G) in the subsequent PCR step, thereby achieving a distinction between methylated and unmethylated sequences.
(3)MSP
For each gene methylation marker, PCR was performed using specific Taqman primers and probes, the sequences of which are shown in Table 1 below;
TABLE 1
Beta-actin is used as an internal reference gene, wherein a forward primer of the beta-actin is as follows: CAAGATGAGATTGGCATGGCT, respectively; the beta-actin reverse primer is as follows: TGTGAACTTTGGGGGATGCTC, respectively; the beta-actin probe is as follows: CCAGTTTTTAAATCCTGAGTCAAGC are provided.
The sequence identifiers (SEQ ID No.) for the primers and probes corresponding to each gene are shown in table 2 below:
TABLE 2
(a) Singleplex PCR
The PCR reaction system is as follows:
wherein, the reporter group at the 5 'end of the marker probe is FAM, the quenching group at the 3' end is MGB, the reporter group at the 5 'end of the beta-actin probe is VIC, and the quenching group at the 3' end is BHQ 1.
(b) Duplex PCR
The PCR reaction system is as follows:
| components | Specification of | Volume (μ L) |
| Buffer solution | 5× | 5 |
| dNTPs | 2.5mM each | 2 |
| Label 1 forward primer | 10μM | 1 |
| Label 1 reverse primer | 10μM | 1 |
| Label 1 Probe | 10μM | 1 |
| Label 2 Forward primer | 10μM | 1 |
| Label 2 reverse primer | 10μM | 1 |
| Label 2 Probe | 10μM | 1 |
| Beta-actin forward primer | 10μM | 1 |
| Beta-actin reverse primer | 10μM | 1 |
| Beta-actin probe | 10μM | 1 |
| DNA enzyme | 5U/μL | 0.5 |
| DNA of sample to be tested | / | 5 |
| Purified water | / | Supply to 25 |
In the dual PCR system, the reporter group at the 5 'end of the probe 1 of the marker 1 is FAM, the quenching group at the 3' end is MGB, the reporter group at the 5 'end of the probe 2 of the marker 2 is ROX, the quenching group at the 3' end is MGB, the reporter group at the 5 'end of the beta-actin probe is VIC, and the quenching group at the 3' end is BHQ 1.
The skilled in the art can select two suitable genes to combine according to actual needs, and add the corresponding primer probes in table 1 into the dual-PCR system.
(c) The conditions for the single and double PCR reactions are as follows:
and (3) Ct value reading, namely adjusting the base line after the PCR is finished, setting the threshold value in the exponential amplification period of the amplification curve, and obtaining the Ct value of each gene of each sample.
And (3) quality control: the negative control and the positive control are synchronously detected during each detection, the negative control is purified water, the positive control is formed by mixing artificial synthetic plasmid containing the segment to be amplified in the beta-actin gene and artificial synthetic plasmid containing the segment to be amplified in the target gene, and the concentration of the artificial synthetic plasmids is 103Copy/microliter, negative control should not be amplified, positive control should have obvious exponential increase period, and the Ct value of reference gene and target gene in the positive control should be between 26-30. The Ct value of the reference gene beta-actin of the sample to be detected is less than 36, and the negative control, the positive control and the reference gene of the sample to be detected meet the requirements, so that the experiment is effective, and the next sample result can be judged. Otherwise, when the experiment is invalid, the detection is required to be carried out again.
And (4) analyzing results: in a single PCR system, if the Ct value of the marker is less than 38, the sample is methylation positive; in the duplex PCR system, if the Ct value of at least one marker is < 38, the sample is methylation positive.
If the methylation is positive, the possibility that the cervical cancer or precancerous lesion is high when the sample of the detected person is sampled is shown, and clinical diagnosis is recommended; if the detection result of the sample to be detected is negative, the possibility that the cervical cancer or precancerous lesion is generated when the detected object is sampled is low, and regular screening is recommended.
Calculation of sensitivity and specificity:
sensitivity (Sensitivity) is 100% of true positive population/(true positive population + false negative population);
specificity (Specificity) is 100% of true negative number/(true negative number + false positive number).
Experimental example 1
Cervical cell samples from 232 patients with tissue biopsy results were selected, 30 of which were cervical inflammation samples, 32 of which were from cervical intraepithelial neoplasia 2(CIN2), 35 of which were from cervical intraepithelial neoplasia 3(CIN3), 62 of which were from cervical cancer samples, 34 of which were cervical squamous carcinoma samples, 23 cervical adenocarcinoma samples, 5 of which were other types of cervical cancer samples.
(1) The results of the detection of methylation positive numbers, calculation sensitivities and specificities of the above gene markers in 30 cases of cervicitis samples, 32 cases of CIN2 samples, 35 cases of CIN3 samples and 62 cases of cervical cancer samples by the method of example 1 under the condition of single PCR are shown in Table 3 below.
TABLE 3
From the above results, the methylation positive rate of 11 methylation gene markers in the cervical inflammation sample is not more than 15%, that is, the detection specificity of the 11 methylation gene markers is not less than 85%, and the specificity of 10 other genes except for the FOXG-AS1 is not less than 90%. Furthermore, none of these markers has a methylation sensitivity in cervical cancer samples of less than 90%.
The methylation positive differences of the 11 methylation gene markers in CIN2 and CIN3 are obvious, and the four methylation gene markers, namely DPP6, GPR26, NETO1 and PABPC5, are best shown in combination, and the sensitivities in CIN2 and CIN3 are respectively 21.88% and 71.43%, 21.88% and 68.57%, 15.63% and 65.71%, and 18.75% and 71.43%.
(2) The methylation positive numbers, calculation sensitivities and specificities of the combinations of four markers, DPP6, GPR26, NETO1 and PABPC5, in pairs were determined in 30 samples of cervicitis, 32 samples of CIN2, 35 samples of CIN3 and 62 samples of cervical cancer under duplex PCR conditions using the method of example 1, and the results are shown in Table 4.
TABLE 4
From the above results, when the four methylation gene markers are combined into two groups, the methylation positive rates of CIN2, CIN3 and cervical cancer samples are obviously improved, the sensitivity of CIN2 is more than 20%, the sensitivity of CIN3 is more than 70%, and the sensitivity of four groups of methylation genes (DPP6+ NETO1, GPR26+ NETO1, GPR26+ PABPC5 and NETO1+ PABPC) in the cervical cancer samples reaches 100%. It is worth noting that the positive rate of the six groups of gene combination markers in the cervical cancer inflammation sample is still less than 10%, which indicates that the specificity is not less than 90%.
In conclusion, the methylation gene markers or the combination thereof can well distinguish the cervical cancer inflammation sample from the lesion sample, and can be used for preparing a kit for diagnosing the cervical cancer and the precancerous lesion.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Wuhan Amisen Life technologies Ltd
Application of reagent for detecting gene methylation in cervical cancer diagnosis and kit
<160> 33
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial sequence
<400> 1
agtttcgggg agtagtagag agt 23
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
aaacgcttaa aaccacgcta 20
<210> 3
<211> 25
<212> DNA
<213> Artificial sequence
<400> 3
ttgcgtttat ttggagttgt agggt 25
<210> 4
<211> 22
<212> DNA
<213> Artificial sequence
<400> 4
gagtagttgc ggggtttgta ag 22
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence
<400> 5
aactaacgaa acgcgttccc 20
<210> 6
<211> 22
<212> DNA
<213> Artificial sequence
<400> 6
tgggaacgag cgtaggggaa at 22
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<400> 7
tgttattcgc gttggtagtc 20
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence
<400> 8
tcgcgtctcc ataattacac 20
<210> 9
<211> 22
<212> DNA
<213> Artificial sequence
<400> 9
aattgtcgcg gcggcggatg ta 22
<210> 10
<211> 25
<212> DNA
<213> Artificial sequence
<400> 10
tcggttatga aggagatata gacga 25
<210> 11
<211> 23
<212> DNA
<213> Artificial sequence
<400> 11
acgaaacctt taaccaacta cga 23
<210> 12
<211> 20
<212> DNA
<213> Artificial sequence
<400> 12
ttaggcggag ggtttcgatt 20
<210> 13
<211> 24
<212> DNA
<213> Artificial sequence
<400> 13
aattcggatt agaagttgag gttg 24
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence
<400> 14
acgcctctaa taaccttccg a 21
<210> 15
<211> 24
<212> DNA
<213> Artificial sequence
<400> 15
atatcgagtt atttcgcgcg tgag 24
<210> 16
<211> 22
<212> DNA
<213> Artificial sequence
<400> 16
agagcgggag gaagtagagg ta 22
<210> 17
<211> 22
<212> DNA
<213> Artificial sequence
<400> 17
accaacgact aaacgtacga ta 22
<210> 18
<211> 25
<212> DNA
<213> Artificial sequence
<400> 18
gagtaggggc gtaggtgttt gtaat 25
<210> 19
<211> 22
<212> DNA
<213> Artificial sequence
<400> 19
gtagtcgggt tgttggataa at 22
<210> 20
<211> 22
<212> DNA
<213> Artificial sequence
<400> 20
acgaacgaaa acgacaacta ct 22
<210> 21
<211> 25
<212> DNA
<213> Artificial sequence
<400> 21
agggattgtc ggagtttagt ggttt 25
<210> 22
<211> 21
<212> DNA
<213> Artificial sequence
<400> 22
ttcggtgagt atttaggggg t 21
<210> 23
<211> 20
<212> DNA
<213> Artificial sequence
<400> 23
aactcgcatc aaccgacatc 20
<210> 24
<211> 21
<212> DNA
<213> Artificial sequence
<400> 24
ttcgaggagg ggacgttagg a 21
<210> 25
<211> 22
<212> DNA
<213> Artificial sequence
<400> 25
atgtggaagt ttacggcgta gt 22
<210> 26
<211> 21
<212> DNA
<213> Artificial sequence
<400> 26
tcgactcgcg ctcctaaata a 21
<210> 27
<211> 25
<212> DNA
<213> Artificial sequence
<400> 27
tttggggtcg ttgtatattg tgagt 25
<210> 28
<211> 19
<212> DNA
<213> Artificial sequence
<400> 28
ttacgtcggt ttcgattcg 19
<210> 29
<211> 23
<212> DNA
<213> Artificial sequence
<400> 29
acccgaaacc tctaatataa cgc 23
<210> 30
<211> 20
<212> DNA
<213> Artificial sequence
<400> 30
agggttggtt tcgggagcgt 20
<210> 31
<211> 23
<212> DNA
<213> Artificial sequence
<400> 31
aagttattta gtacggtttc ggg 23
<210> 32
<211> 22
<212> DNA
<213> Artificial sequence
<400> 32
ccaacgcaaa ccgataaact aa 22
<210> 33
<211> 22
<212> DNA
<213> Artificial sequence
<400> 33
ttcgttggat tgttttgcgg ag 22
Claims (10)
1. The application of the reagent for detecting the methylation of the target gene in preparing the kit for diagnosing the cervical cancer or the precancerous lesions thereof is characterized in that the target gene is selected from at least one of the following genes: c12orf42, CNTNAP5, DPP6, FERD3L, FOXG1-AS1, GPR26, GRIA2, GRIA4, ITGA8, NETO1 and PABPC 5.
2. The use according to claim 1, wherein the target gene is selected from at least one of the following genes: DPP6, GPR26, NETO1 and PABPC 5.
3. The use according to claim 1 or 2, wherein the target gene is selected from any one of the following gene combinations:
DPP6+ GPR26, DPP6+ NETO1, DPP6+ PABPC5, GPR26+ NETO1, GPR26+ PABPC5 and NETO1+ PABPC 5.
4. The use of claim 1, wherein the reagent is used for methylation detection of the target gene by: methylation-specific PCR, MethyLight, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution solubility curves, methylation-sensitive restriction endonuclease or flap endoluclease.
5. The use according to claim 4, wherein the reagent is used for methylation detection of the target gene by methylation-specific PCR, and the reagent comprises primers and probes represented by at least one of items (1) to (11) of the table:
。
6. A kit for diagnosing cervical cancer or a precancerous lesion thereof, comprising: reagents for detecting methylation of a target gene;
the target gene is selected from at least one of the following genes: c12orf42, CNTNAP5, DPP6, FERD3L, FOXG1-AS1, GPR26, GRIA2, GRIA4, ITGA8, NETO1 and PABPC 5.
7. The kit according to claim 6, wherein the target gene is selected from at least one of the following genes: DPP6, GPR26, NETO1 and PABPC 5;
preferably, the target gene is selected from any one of the following gene combinations: DPP6+ GPR26, DPP6+ NETO1, DPP6+ PABPC5, GPR26+ NETO1, GPR26+ PABPC5 and NETO1+ PABPC 5.
8. The kit according to claim 6 or 7, wherein the reagent detects methylation of the target gene by: methylation-specific PCR, MethyLight, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution solubility curves, methylation-sensitive restriction endonuclease or flap endoluclease;
preferably, the reagents include primers and probes as set forth in at least one of items (1) to (11) of the table:
。
9. A method for preparing a kit for diagnosing cervical cancer or precancerous lesions thereof, characterized by comprising: using a reagent for detecting methylation of a target gene as a main raw material:
the target gene is selected from at least one of the following genes: c12orf42, CNTNAP5, DPP6, FERD3L, FOXG1-AS1, GPR26, GRIA2, GRIA4, ITGA8, NETO1 and PABPC 5.
10. The method according to claim 9, wherein the target gene is at least one selected from the group consisting of: DPP6, GPR26, NETO1 and PABPC 5;
preferably, the target gene is selected from any one of the following gene combinations: DPP6+ GPR26, DPP6+ NETO1, DPP6+ PABPC5, GPR26+ NETO1, GPR26+ PABPC5 and NETO1+ PABPC 5;
preferably, the reagent detects methylation of the target gene by the following method: methylation-specific PCR, MethyLight, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution solubility curves, methylation-sensitive restriction endonuclease or flap endoluclease;
preferably, the reagents include primers and probes as set forth in at least one of items (1) to (11) of the table:
。
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011277684.1A CN114507730B (en) | 2020-11-16 | 2020-11-16 | Application of reagent for detecting gene methylation in cervical cancer diagnosis and kit |
| CN202310124561.1A CN115948562B (en) | 2020-11-16 | 2020-11-16 | Application of reagent for detecting gene methylation in cervical cancer diagnosis and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011277684.1A CN114507730B (en) | 2020-11-16 | 2020-11-16 | Application of reagent for detecting gene methylation in cervical cancer diagnosis and kit |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310124561.1A Division CN115948562B (en) | 2020-11-16 | 2020-11-16 | Application of reagent for detecting gene methylation in cervical cancer diagnosis and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114507730A true CN114507730A (en) | 2022-05-17 |
| CN114507730B CN114507730B (en) | 2023-01-20 |
Family
ID=81546657
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310124561.1A Active CN115948562B (en) | 2020-11-16 | 2020-11-16 | Application of reagent for detecting gene methylation in cervical cancer diagnosis and kit |
| CN202011277684.1A Active CN114507730B (en) | 2020-11-16 | 2020-11-16 | Application of reagent for detecting gene methylation in cervical cancer diagnosis and kit |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310124561.1A Active CN115948562B (en) | 2020-11-16 | 2020-11-16 | Application of reagent for detecting gene methylation in cervical cancer diagnosis and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN115948562B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012115885A1 (en) * | 2011-02-22 | 2012-08-30 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Circulating biomarkers |
| CN105177164A (en) * | 2015-10-21 | 2015-12-23 | 山东大学齐鲁医院 | Molecular marker for early screening cervical cancer and detecting primers |
| CN109468381A (en) * | 2018-11-19 | 2019-03-15 | 兰州市第人民医院 | Methylation sites and its detection primer for cervical carcinoma screening |
| GB202009225D0 (en) * | 2020-06-17 | 2020-07-29 | Ucl Business Ltd | Methods for detecting and predicting grade 3 cervical epithelial neoplasia (cin3) and/or cancer |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016168526A1 (en) * | 2015-04-14 | 2016-10-20 | University Of Utah Research Foundation | Advanced tensor decompositions for computational assessment and prediction from data |
| CN110499364A (en) * | 2019-07-30 | 2019-11-26 | 北京凯昂医学诊断技术有限公司 | A kind of probe groups and its kit and application for detecting the full exon of extended pattern hereditary disease |
| CN111549135A (en) * | 2020-05-20 | 2020-08-18 | 深圳市新合生物医疗科技有限公司 | DNA methylation qPCR kit for cervical cancer detection, and use method and application thereof |
| CN111793690A (en) * | 2020-07-23 | 2020-10-20 | 深圳市新合生物医疗科技有限公司 | DNA methylation qPCR kit for cervical cancer detection and use method thereof |
-
2020
- 2020-11-16 CN CN202310124561.1A patent/CN115948562B/en active Active
- 2020-11-16 CN CN202011277684.1A patent/CN114507730B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012115885A1 (en) * | 2011-02-22 | 2012-08-30 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Circulating biomarkers |
| CN105177164A (en) * | 2015-10-21 | 2015-12-23 | 山东大学齐鲁医院 | Molecular marker for early screening cervical cancer and detecting primers |
| CN109468381A (en) * | 2018-11-19 | 2019-03-15 | 兰州市第人民医院 | Methylation sites and its detection primer for cervical carcinoma screening |
| GB202009225D0 (en) * | 2020-06-17 | 2020-07-29 | Ucl Business Ltd | Methods for detecting and predicting grade 3 cervical epithelial neoplasia (cin3) and/or cancer |
Non-Patent Citations (1)
| Title |
|---|
| 李桐等: "基因甲基化在宫颈癌中的研究进展", 《癌症进展》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114507730B (en) | 2023-01-20 |
| CN115948562B (en) | 2024-04-12 |
| CN115948562A (en) | 2023-04-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110229908B (en) | Primer, probe and kit for early detection of lung cancer gene methylation | |
| BoTezATu et al. | Quantitative analysis of the relationship between microRNA‑124a,-34b and-203 gene methylation and cervical oncogenesis | |
| CN110578001A (en) | Detection kit for detecting methylation of cervical cancer related genes and use method thereof | |
| CN113604563B (en) | Nucleic acid combination for liver cancer diagnosis or auxiliary diagnosis, detection kit and application thereof | |
| CA2883671A1 (en) | Method for screening cancer | |
| ES2431301T3 (en) | Procedure for early diagnosis of carcinomas of the cervix | |
| CN113249485B (en) | Primer probe combination and kit for methylation detection of cervical cancer related genes and application of primer probe combination and kit | |
| CN110564857A (en) | composition and kit for early cervical cancer detection | |
| EP2304057A2 (en) | Method for the detection of ovarian cancer | |
| CN113621704B (en) | Reagent and kit for detecting and diagnosing liver cancer | |
| CN108949923B (en) | Method for amplifying MSF1 gene, kit and application | |
| US20230076141A1 (en) | Markers, primers, probes and kit for early screening and diagnosis of endometrial cancer | |
| CN114507730B (en) | Application of reagent for detecting gene methylation in cervical cancer diagnosis and kit | |
| CN116144782A (en) | Combined marker for lung cancer detection and application thereof | |
| CN113430272B (en) | Reagent and kit for diagnosis or auxiliary diagnosis of esophageal cancer or precancerous lesion and application of reagent and kit | |
| CN105177163A (en) | Kit for early screening cervical cancer | |
| CN114214415A (en) | Primer probe combination for methylation detection of cervical cancer related genes and application thereof | |
| CN113943810B (en) | Reagent and kit for detecting endometrial cancer | |
| CN115948561B (en) | Reagent and detection kit for esophageal squamous carcinoma diagnosis or auxiliary diagnosis and application thereof | |
| CN115786502B (en) | Use of an agent for detecting the methylation level of a target region for the preparation of a diagnostic product for bladder cancer | |
| CN116083586A (en) | Nucleic acid product, kit and application for diagnosing esophageal cancer | |
| CN116694765A (en) | Kit for detecting endometrial cancer and application thereof | |
| CN115838799A (en) | Application of reagent for detecting gene methylation in preparation of product for diagnosing colorectal cancer | |
| CN116676384A (en) | Biomarker for gastric cancer, nucleic acid product and kit | |
| CN116814779A (en) | Biomarker for gastric cancer, nucleic acid product and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |