CN114486429A - Detection kit and detection method for activity of beta-glucan synthase and application - Google Patents

Abstract

The invention provides a detection kit, a detection method and application of activity of beta-glucan synthetase, belonging to the technical field of enzyme; the kit for determining the activity of the beta-glucan synthase mainly comprises an ectonucleoside triphosphate diphosphohydrolase (ENTDP) which hydrolyzes Uridine Diphosphate (UDP) to release phosphate and a reagent for determining the content of the released phosphate; the kit for determining the activity of the beta-glucan synthase can quickly and accurately determine the content of a byproduct Uridine Diphosphate (UDP) formed in the process of synthesizing the beta-glucan sugar chain by using the UDP-glucose as a substrate by the beta-glucan synthase, and the activity of the beta-glucan synthase can be accurately calculated according to the content; the kit and the method for measuring the activity of the beta-glucan synthase have the obvious advantages of low equipment requirement, safe and simple operation, high sensitivity, low cost and the like.

Description

Detection kit and detection method for activity of beta-glucan synthase and application

Technical Field

The invention belongs to the technical field of enzymes, and particularly relates to a detection kit for activity of beta-glucan synthase, a detection method and application.

Background

Glucans (Glucan) are a large group of macromolecular multimers of alpha/beta-1, 3, 1,4 or 1, 6-glycosidic linkages to glucose monomers, which serve as one of the important structural components of plant and fungal cell walls and play a key role in maintaining cell shape and integrity, protecting cells from internal swelling pressure and other external environmental influences, etc. In recent years, researches show that beta-1, 3, 1,4 or 1, 6-glucan derived from fungi has remarkable functions of enhancing immunity, regulating intestinal flora, reducing blood sugar and the like, and is one of main index components of edible and medicinal fungi products. The immunomodulatory activity of dextran varies widely due to its chemical composition, configuration and physical properties. The polysaccharide activity is most remarkable with beta-1, 3-as the main chain and beta-1, 6-as the branch chain.

It is generally believed that the beta-glucan synthesis process in fungi or plants may involve the following major steps: (1) glucose is transported into cells through carrier protein, is catalyzed into 6-phosphoglucose by glucokinase, and is catalyzed into 1-phosphoglucose by phosphoglucomutase; (2) the 1-glucose phosphate is catalyzed by UDP-glucose pyrophosphorylase to form UDP-glucose; (3) RHO 1-activated Glucan synthase (GLS, different fungi may have multiple GLS involved in Glucan synthesis) uses UDP-glucose as a substrate and links it to form β -glucans of different degrees of polymerization. The reaction process of synthesizing the beta-glucan sugar chain by catalyzing UDP-glucose by the beta-glucan synthetase comprises the following steps: [ beta- (1 → 3) -D-glucopyranosyl]_(n)+UDP-α-D-glucose＝[β-(1→3)-D-glucosyl]_(n+1)+H⁺+ UDP, therefore, β -glucan synthase has a crucial role in the synthesis of β -glucan, and accurate determination of the enzymatic activity of β -glucan synthase is a key step in understanding the β -glucan synthesis pathway and the synthesis products.

At present, the detection method of the activity of beta-glucan synthase is mainly based on the UDP-, [ 2 ] labeled with a radioisotope¹⁴C]Glucose as a substrate, UDP-, [ 2 ] was measured by using a liquid scintillation counter¹⁴C]Determining the activity of beta-glucan synthase based on the change in radioactivity of glucose and the estimation of the degree of polymerization of transferred glucan chains; however, this method requires an expensive substrate (isotopically labeled UDP-, [ 2 ]¹⁴C]Glucose), professional detection instruments (liquid scintillation counter), the experimental cost is extremely high; meanwhile, the radioactive substrate UDP-, [ 2 ]¹⁴C]Has certain danger, and increases the number of experimentersRadiation hazard. Esuter Shedletzky and the like establish a method for measuring the activity of beta-glucan synthetase, wherein UDP-glucose is used as a substrate for reaction, radioactive aniline blue is added as a fluorescent coloring agent to be combined with the synthesized beta-glucan sugar chain, and the activity of the beta-glucan synthetase is calculated by measuring the coloring result; the method does not require a radioactive substrate UDP-, [ 2 ]¹⁴C]Glucose, and a synthesized beta-glucan product does not need to be processed, so that the operation steps of measuring the activity of the beta-glucan synthase are simplified to a certain extent; but the detection sensitivity is not enough, and the radioactive aniline blue is used as a fluorescent stain, so that the experiment cost is still higher, and certain insecurity exists. Therefore, a detection method for detecting the activity of the beta-glucan synthase, which is safe to operate, low in cost, convenient and efficient, is urgently needed to be explored.

Disclosure of Invention

The invention aims to overcome some problems in the current beta-glucan synthase activity determination technology and provides a kit for determining the beta-glucan synthase activity, which has the advantages of low equipment requirement, safe and simple operation, high sensitivity and low cost, and application thereof.

Specifically, the invention aims to provide a kit for measuring the activity of beta-glucan synthase, which mainly comprises a beta-glucan synthase enzymolysis substrate, an Ectonucleoside triphosphate diphosphohydrolase (ENTDP) which can hydrolyze Uridine Diphosphate (UDP) as a reaction by-product in the process of catalyzing UDP-glucose to synthesize beta-glucan sugar chain by using beta-glucan synthase to release phosphate, and a reagent for measuring the content of phosphate released by UDP hydrolysis.

The ectonucleoside triphosphate diphosphohydrolase (ENTDP) has the capability of hydrolyzing a reaction byproduct UDP of beta-glucan sugar chain synthesized by beta-glucan synthetase catalytic UDP-glucose and releasing phosphate radical. ENTDP is derived from bacteria (Legionella donaldsonii Access: WP-115220965.1; Legionella feleii Access: WP-058443624.1; Pseudomonas syringae NCBI Access: WP-162234966.1, etc.), filamentous fungi (Aspergillus pseudoviral Access: XP-043156785.1; Aspergillus virescens Access: XP-043123177.1; Talaromyces marneffei Access: KFX52025.1, etc.) or yeast (Yarrowia lipolytica Access: CP061017.1, Saccharomyces cerevisiae Access: NP-010920, Pseudomonas hupensis testing: XP-012191981.1, etc.).

Further, the gene sequence of the ENTDP can be cloned from the genome of the above-mentioned bacterium, filamentous fungus or yeast, or can be obtained synthetically by commercial biotechnology companies.

The nucleotide sequence of the ENTDP includes, but is not limited to, the sequence shown in SEQ ID NO.1, SEQ ID NO.5 or SEQ ID NO.9, and the amino acid sequence thereof includes the sequence shown in SEQ ID NO.2SEQ ID NO.6 or SEQ ID NO. 10.

Wherein the beta-glucan synthetase enzymolysis substrate is UDP-glucose or oligosaccharides with different polymerization degrees; the reagent for determining the content of phosphate released by UDP hydrolysis comprises a detection reagent used by an ammonium molybdate-ascorbic acid spectrophotometry, a phosphomolybdic acid-malachite green spectrophotometry or an ion chromatography.

The invention also provides a recombinant expression vector which contains the nucleotide sequence of the codon-optimized ENTDP and is suitable for expression in escherichia coli, pichia pastoris and the like.

Furthermore, the invention also provides a genetic engineering bacterium containing the recombinant expression vector, and a host bacterium of the genetic engineering bacterium is escherichia coli BL21(DE3) or Pichia pastoris X-33.

Further, the method for cloning, expressing and purifying the ectonucleoside triphosphate diphosphohydrolase ENTDP comprises the following steps: cloning a nucleotide sequence for coding an ectonucleoside triphosphate diphospho hydrolase ENTDP into an expression vector, and then transferring into escherichia coli BL21(DE3) or Pichia pastoris X-33; finally culturing, extracting, affinity chromatography purifying and the like to obtain the recombinant ectonucleoside triphosphate diphospho hydrolase ENTDP.

The invention also provides the recombinant ectonucleoside triphosphate diphospho hydrolase ENTDP, which is characterized in that the temperature of the catalytic reaction is 25-50 ℃; the pH value of the catalytic reaction is 4.0-9.0, and the metal ions Zn²⁺0.1～2.0μmol/mL。

Further, the ectonucleoside triphosphate diphosphohydrolase ENTDP maintains at least 80% of catalytic activity even when stored for 180-540 days at-20-25 ℃, pH 5.0-9.0, and 20% (v/v) of glycerol.

The invention also provides application of the kit for determining the activity of the beta-glucan synthase in determination of the activity of the beta-glucan synthase or application in determination of the content of phosphate released by hydrolysis UDP of ENTDP.

The invention also provides a method for determining the activity of the beta-glucan synthase by adopting the kit, which comprises the following steps:

(1) establishing a phosphate radical concentration measurement standard curve;

taking a phosphate radical standard solution with the concentration of 0.1-10.0 mM, and establishing a standard curve (R) for measuring the concentration of phosphate radical by an ammonium molybdate-ascorbic acid spectrophotometry, a phosphomolybdic acid-malachite green spectrophotometry or an ion chromatography²>0.990)。

(2) Preparing recombinant ectonucleoside triphosphate diphospho hydrolase ENTDP;

(3) preparing beta-glucan synthetase;

the beta-glucan synthase can be derived from a fungus, a plant, or a bacterium; can be prepared from fungus, plant or bacteria by conventional membrane protein extraction method, or its coding gene sequence can be obtained by recombination heterologous expression and affinity chromatography.

(4) Reacting beta-glucan synthetase with a substrate to synthesize polysaccharide (oligosaccharide) sugar chains, measuring and calculating the content of phosphate radical released by UDP generated by hydrolyzing recombinant ectonucleoside triphosphate diphospho hydrolase ENTDP, and calculating the enzyme activity of the beta-glucan synthetase.

The reaction of the beta-glucan synthase and the substrate synthesizes polysaccharide (oligosaccharide) sugar chains, comprising the steps of:

taking 0.1-500 mM UDP-glucose and oligosaccharides with different polymerization degrees and the like as substrates, adding 0.1-300 mu g/mL beta-glucan synthetase, reacting for 30 min-48 h at the temperature of 25-40 ℃ and the pH of 4.0-9.0, and linking or transferring glucose residues on the UDP-glucose to oligosaccharide chains to form polysaccharide and oligosaccharide chains with the polymerization degrees of 2-5000; in this process, the same molar ratio of UDP is produced.

Further, reacting the recombinant ectonucleoside triphosphate diphospho hydrolase ENTDP with the generated UDP, mainly comprising the steps of adding 0.1-300 mug/mL of recombinant ENTDP at the same time when the reaction of the beta-glucan synthase and the substrate is started, and reacting for 30 min-48 h under the conditions of the temperature of 25-40 ℃ and the pH value of 4.0-9.0; the released inorganic phosphate is detected by ammonium molybdate-ascorbic acid spectrophotometry, phosphomolybdic acid-malachite green spectrophotometry or ion chromatography, and the amount of released inorganic phosphate, and the amount of consumed substrate UDP-glucose are calculated from a standard curve.

Or when the reaction of the beta-glucan synthetase and the substrate is finished, 0.1-300 mu g/mL of recombinant ENTDP is added, and the reaction is carried out for 10 min-48 h under the conditions of the temperature of 25-50 ℃ and the pH value of 4.0-9.0; the released inorganic phosphate is detected by ammonium molybdate-ascorbic acid spectrophotometry, phosphomolybdic acid-malachite green spectrophotometry or ion chromatography, and the amount of released inorganic phosphate, and the amount of consumed substrate UDP-glucose are calculated from a standard curve.

Further, ammonium molybdate spectrophotometry adopts phosphate under acidic condition to react with ammonium molybdate and antimony potassium tartrate to generate phosphomolybdic heteropoly acid, then the phosphomolybdic heteropoly acid is reduced by ascorbic acid, the absorbance of the phosphomolybdic heteropoly acid is measured at 700nm, and the content of released free phosphate ions is calculated according to an established standard curve.

Further, phosphomolybdic acid-malachite green spectrophotometry adopts phosphomolybdic acid and molybdate to form phosphomolybdic acid heteropoly acid association compound under acidic condition, weak bond chromogenic compound is formed with malachite green, the absorbance of the weak bond chromogenic compound is measured at 620nm, and the content of released free phosphate ions is calculated according to the established standard curve.

Further, the ion chromatography adopts an anion chromatographic column, adopts strong alkaline solution for elution, adopts a conductivity detector for detection, and quantitatively determines the content of released free phosphate ions according to the retention time and the external standard.

The enzyme activity unit of the beta-glucan synthetase determined by the invention is defined as: beta-glucan per microgramAmount of substrate 1nmol UDP-glucose consumed within unit time (min) of glycan synthase protein (. mu.g) (nmol h)^-1μg^-1) Or the amount of 1nmol phosphate released per microgram of beta-glucan synthase protein (. mu.g) per unit time (h) (nmol h)^-1μg^-1)。

The invention has the beneficial effects that:

the recombinant ectonucleoside triphosphate diphospho hydrolase ENTDP from bacteria, fungi or yeast is prepared, UDP generated in the process of catalyzing UDP-glucose by beta-glucan synthetase to form glucan (oligo) sugar is hydrolyzed to release free phosphate radical, and the content of the phosphate radical is determined by spectrophotometry or ion chromatography, so that the enzyme activity of the glucan synthetase is calculated. The method does not require the use of a radioactive substrate UDP-, [ solution ]¹⁴C]Glucose and a professional detection instrument do not need to analyze the refined structure of the synthesized product beta-glucan (oligo) sugar, so that the experimental cost is obviously reduced, the experimental operation steps are simplified, the insecurity of the experimental operation is thoroughly avoided, and the method is a low-cost, safe, efficient and convenient detection method for the activity of the beta-glucan synthetase.

Drawings

FIG. 1 shows the pET-30a (+) -ldentdp expression plasmid map (A) and agarose gel electrophoresis (B), in which M: DNA marker; lane 1: pET-30a (+) -ldentdp; lane 2: pET-30a (+) -ldentdp was verified by NdeI and HindIII double digestion.

FIG. 2 shows PCR verification of colonies after transformation of the recombinant expression vector pET-30a (+) -ldentdp into E.coli BL21(DE 3); in the figure, M: DNA marker; lane 1: the transformation fails; lane 2-3: the transformation was successful.

FIG. 3 is a diagram showing verification of heterologous expression of a LDENTDP recombinant protein; wherein A is SDS-PAGE protein electrophoresis picture; b is a Western-blot image.

FIG. 4 is a diagram showing an absorption peak of AKTA purified LDENTDP recombinant protein and a SDS-PAGE electrophoresis of a collected target protein; in the figure, peak I represents the hetero protein, and peak II represents the target protein LDENTDP eluted by imidazole.

FIG. 5 is a standard curve of inorganic phosphorus measurement by malachite green method.

FIG. 6 shows the results of enzymatic property measurements of LDENTDP using UDP as a substrate, in which A is an enzyme kinetic parameter; b is the optimum temperature of LDENTDP, and C is the thermal stability of LDENTDP; d is the optimum pH of LDENTDP, E is the pH stability of LDENTDP, and F is the influence of metal ions on the activity of LDENTDP enzyme.

Detailed Description

The following embodiments of the present invention are described in detail to better understand the technical solutions of the present invention for those skilled in the art, but the following embodiments do not limit the scope of the present invention. In the present invention, the type of expression vector is not particularly limited, and various expression vectors commonly used in the art, such as plasmids, which can express ENTDP in escherichia coli, pichia pastoris, or other expression vectors, may be used. It will be understood by those skilled in the art that various methods commonly used in the art can be used to construct the expression vector, and will not be described herein.

In the following examples, Escherichia coli strain BL21(DE3) or Pichia pastoris X-33 used for the expression of ENTDP gene derived from bacteria, fungi or yeast of the present invention are commercially available.

The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1 detection of the Activity of the Maitake Mushroom glucan synthase GFGLS Using recombinant LDENTDP derived from the bacterium Leginonella donaldsonii

LDENTDP sequence and its coding nucleotide sequence:

heterologous expression of ENTDP from the bacterium Legionella donaldsonii (designated LDENTDP): the codon in Escherichia coli is optimized by taking an ectonucleoside triphosphate diphospho hydrolase ENTDP gene sequence (Genbank access: WP-115220965.1) of Legionella donaldsonii as a template, the optimized nucleotide sequence is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2. The gene sequence of ldentdp was synthesized by a commercial company, and the addition of a 6 × His tag was made.

SEQ.ID.NO.1：

ATGGTTAGCAGCACCGGCCTGAGCAGCGAGACCATTAGCATCACCCTGTGCCTGAACGGCAAAGGTCCGCTGACCTGCCAAAACTACAACGTGGCGAGCCTGAACCTGAGCATCACCACCACCGTGCCGAACCGTGTTTACCCGAGCGTGGGCATTAAGGTTAACCGTCCGGGCTACTATCCGCTGCTGGGTTGCACCCCGATCGCGAACGGTTATTGCCTGTTCAGCGCGAACAACGTTAGCCCGGCGACCATTACCCCGGCGAACGCGCGTTACAACGTGGTTTTCGACGCGGGTAGCAGCGGCACCCGTATGTTTATCTATCAGACCATTGCGCCGCTGAACCCGCTGATCGTGACCCTGTTCACCGATAACAACAACATTCCGCTGGCGAGCTTTGCGAACAACCCGGCGGCGGCGGGTAACGCGATCCAGCCGCTGCTGACCGAGGCGACCAACGTTCTGCAGACCTACCAAATCATGCCGAGCCAAGCGATCGCGAGCGTGCTGGGTACCGCGGGTATGCGTGTTCTGACCGAGGCGCAGCAAGCGGCGATCTACCAGAGCGTGGCGAACACCATTGTTAGCAACAACTATGGTCTGGGCGAAACCAAGACCATCAGCGGTCAGCAAGAGGGCCTGTACCAATGGCTGGAAGTGAACTATCTGAACAGCAGCCTGGGCACCTACCTGACCCGTGGTATCATTGAAATTGGTGGCGCGAGCGCGCAGGTGGCGTTTGTTGCGAACACCCCGAGCAACCCGAACGTTATCAAACTGACCATTAACGGCGTGGTTTATGACCTGTTCAGCATCAGCTTTCTGGGTCTGGGCCAGGACCTGGCGCGTCAAAGCATGGATGCGGTGCAGCCGCCGCTGGACCCGGATAACTGCTACCCGGTTGGTTATAACCAAGGCCCGATTACCGGTAACTTCCTGTACAGCCGTTGCCTGGCGAACTATGGTGAAGTGCTGACCAACTTCAGCATGCTGAGCCAGCTGACCAGCGTTCCGGGCTTTGCGAGCCAAAGCTACTATGGTATCGCGGCGATTTACTTCAACGCGACCTTTCTGGGCATCAGCAACAACTTTAACCCGCTGAGCATTCGTAACGCGATCAGCAGCATTTGCAGCAACAGCTACGCGCAGCTGCAGCAACTGTATCCGGGTCTGCCGCAACTGTTCAACAAATGCGCGGACAGCACCTACGTGGATAGCTTTCTGTATAGCAGCCCGGGCCTGAACCTGGTGGGTATCCCGGTTGAACCGGTGGTTACCATCAGCGGCGTTCCGATTACCTGGACCGGTGGCTACATTTACCTGGTGAACAAAGTGCCGAGCATTCTGGGTTAA

SEQ.ID.NO.2：

MVSSTGLSSETISITLCLNGKGPLTCQNYNVASLNLSITTTVPNRVYPSVGIKVNRPGYYPLLGCTPIANGYCLFSANNVSPATITPANARYNVVFDAGSSGTRMFIYQTIAPLNPLIVTLFTDNNNPLASFANNPAAAGNAIQPLLTEATNVLQTYQIMPSQAIASVLGTAGMRVLTEAQQAAIYQSVANTIVSNNYGLGETKTISGQQEGLYQWLEVNYLNSSLGTYLTRGIIEIGGASAQVAFVANTPSNPVIKLTINGVVYDLFSISFLGLGQDLARQSMDAVQPPLDPDNCYPVGYNQGPITGNFLYSRCLANYGEVLTNFSMLSQLTSVPGFASQSYYGIAAIYFNATFLGISNNFNPLSIRNAISSICSNSYAQQQLYPGLPQLFNKCADSTYVDSFLYSSPGLNLVGIPVEPVVTISGVPITWTGGYIYLVNKVPSILG

Heterologous expression and preparation of LDENTDP protein:

designing a specific primer of a polyclonal enzyme cutting site with an expression vector pET-30a (+), wherein the sequence of the primer is as follows:

upstream primer ldentdp-F (SEQ ID NO. 3): GGAGATATAC ATATGGTTAG CAGCACCGGC CT

Downstream primer ldentdp-R (SEQ ID NO. 4): GGCCGCAAGC TTTTAATGAT GATGATGATG ATG

The ldentdp gene synthesized by commercial company uses the primer sequences shown in SEQ ID NO.3 and SEQ ID NO.4 to carry out PCR amplification, after purification, the target fragment is recovered, the expression vector pET-30a (+) is double-enzyme-cut by restriction enzymes NdeI and HindIII, and the enzyme-cut product is recovered by a glue recovery kit. By using a Hieff

The cloned ldentdp is recombined into a pET-30a (+) vector by the Plus One Step Cloning Kit, transformed into escherichia coli TOP10 competence, positive clones are screened by a kanamycin resistant plate, plasmids are extracted, and a correct recombinant expression vector pET-30a (+) -ldentdp is obtained by double enzyme digestion verification (figure 1B) (a plasmid map is shown in figure 1A).

Coli BL21(DE3) was cultured to prepare competent cells, and plasmid pET-30a (+) -ldentdp was transformed into the strain by electric shock, positive clones were selected using kanamycin-resistant plates, and single colonies were picked for colony PCR verification (fig. 2); the positive colonies successfully verified were picked and inoculated into 100mLLB (Kan +) liquid medium (tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L), cultured at 37 ℃ and 180rpm to OD_600nm0.6 to 0.8. Isopropyl thiogalactoside (IPTG) was added to a final concentration of 0.5mM, and the cells were collected after induction at 37 ℃ for 4 h. Centrifuging to collect thallus, performing ultrasonic disruption, collecting cell lysate, separating and purifying by using a Ni-NTA pre-assembled chromatographic column His-Tag affinity label to obtain recombinant LDENTDP, and verifying the obtained protein and molecular weight thereof by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot, wherein FIG. 3 is a heterologous expression verification diagram of LDENTDP recombinant protein; wherein FIG. 3A is an SDS-PAGE protein electrophoresis; 3B is a Western-blot graph, and the molecular weight of the recombinant LDENTDP is about 48 kDa.

Enzymatic properties of recombinant LDENTDP:

taking out a certain amount of KH₂PO₄Dissolving in deionized water to prepare 0.1-10.0 mM phosphate radical standard solution; adding 50 μ L of 0.2mM malachite green reagent into the phosphate radical standard solution at each concentration, dissolving completely, incubating at room temperature for 20min, and measuring OD_620nmAt the absorbance OD_620nmPlotting the abscissa and the ordinate of the phosphate concentration, a standard curve for the determination of the phosphate concentration (shown in FIG. 5) Y (phosphate amount pmol) ═ 3468.8X +27.95 (R)²＝0.9985)。

Taking 200 mu L of 5mM UDP, adding 100 mu g/mL of recombinant LDENTDP protein, setting the reaction temperature at 15 ℃, 25 ℃, 35 ℃, 45 ℃, 55 ℃, 65 ℃, 75 ℃ and 85 ℃ for reaction for 2h under the condition of pH7.0, detecting the released inorganic phosphate by phosphomolybdic acid-malachite green spectrophotometry, calculating the amount of the released inorganic phosphate by a standard curve, and determining the optimal catalytic temperature according to the amount. As shown in fig. 6B and C, the optimum catalytic temperature was 35 ℃.

200 mu L of 5mM UDP was added with 100. mu.g/mL of recombinant LDENTDP protein, and the mixture was reacted at 35 ℃ for 2 hours while setting pH values of 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 and 11.0, and the optimum catalytic pH was determined based on the amount of inorganic phosphate released. As shown in fig. 6D and E, the optimum catalytic pH was 7.0.

Adding 100 mu g/mL of recombinant LDENTDP protein into 200 mu L of 5mM UDP, respectively adding sodium chloride, magnesium chloride, ferrous chloride, copper chloride, zinc chloride, ferric sulfate, manganese sulfate, ammonium chloride and the like into a reaction system to ensure that the final concentrations are 0.5 mu mol/mL respectively, reacting for 2 hours at the temperature of 35 ℃ and the pH value of 7.0, and determining the influence of each metal ion on the catalytic activity according to the amount of released inorganic phosphate. As shown in fig. 6F, the metal ion Zn²⁺(0.5. mu. mol/mL) can increase the catalytic activity by 20%.

In this example, a preservation method of the recombinant LDENTDP protein was also examined, and the specific steps were as follows: the recombinant LDENTDP protein was stored in a Tris buffer (pH7.020mM), and glycerol was added to the buffer to give a final concentration of 20% (v/v) and ZnCl was added to the buffer in an amount of 0.5. mu. mol/mL₂After 12 months of storage at-4 ℃ the enzyme activity was determined, compared to freshly prepared LDENTDP proteinAt least, the catalytic activity is kept more than 90%.

In conclusion, the temperature of the optimal catalytic reaction of the recombinant LDENTDP protein is 35 ℃; the pH of the catalytic reaction is 7.0, and the metal ion Zn²⁺The concentration of (2) was 0.5. mu. mol/mL.

The activity of the beta-1, 3-glucan synthase GFGLS of the grifola frondosa is determined as follows:

selecting edible fungus Grifola frondosa derived beta-1, 3-glucan synthetase (GFGLS) as assay object.

Grifola frondosa (purchased from American type culture Collection,

60301^TM) Fermenting mycelium, adding into 10mmol/L Tris-HCl buffer solution (containing 1% Triton X-114 and 150mmol/L NaCl) with pH of 7.4 (precooled to 4 deg.C) at a ratio of 1:4(W: v), performing ultrasonic treatment for 20min under the condition of 300W (ultrasonic treatment for 8s and interval of 4s), and centrifuging at 40000r/min at 4 deg.C for 30min to obtain supernatant, i.e. crude enzyme solution of membrane-bound Grifola frondosa beta-glucan synthetase. The crude enzyme solution was applied to a Hydroxypatite Fast Flow column (5mL pre-packed column) and treated with 10mmol/L, 50mmol/L, 100mmol/L and 150mmol/L of MgCl at pH 6.0 of 5mmol/L₂And 1% Triton X-100 potassium phosphate buffer solution is eluted in stages at the flow rate of 2mL/min, and the grifola frondosa membrane-bound beta-1, 3-glucan synthase GFGLS with the relative molecular mass of 217kDa is collected. The results of matrix-assisted laser desorption ionization time-of-flight mass spectrometry prove that the purified protein is membrane-bound GFGLS, and the relative molecular mass is about 220 kDa.

The total volume of the system was 50. mu.L, including 50mM UDP-glucose, 100. mu.g/mL Grifola frondosa beta-glucan synthase GFGLS protein, 100. mu.g/mL recombinant LDENTDP, and OD was measured after 2 hours of reaction at 35 ℃ and pH7.0_620nm1.125; standard curve Y (OD) established by phosphomolybdic acid-malachite green spectrophotometry_620nm)＝3468.8X+27.95(pmol)(R²0.9985), calculated to release 507nmol of inorganic phosphate, 5.07nmol of UDP-glucose needs to be consumed; so the enzyme activity of the prepared grifola frondosa beta-glucan synthetase is 169.12pmol h^-1μg^-1。

Example 2 detection of the Activity of Grifola frondosa glucan synthase GFGLS Using recombinant APENTDP derived from the fungus Aspergillus pseudovirginiana

ASENTDP sequence and its coding nucleotide sequence:

the nucleotide sequence of the APENTDP hydrolase gene is obtained by searching in the genome of Aspergillus pseudolongidanutans (GenBank: AP024468.1), and the CDS sequence and the amino acid sequence coded by CDS are shown in SEQ ID NO.5 and SEQ ID NO. 6.

SEQ ID NO.5：

ATGGGCAAATGGCATTATGGCATCGTCCTAGATGCGGGATCATCTGGGACTCGAGTGCACGTCTATCGGTGGTTGGACCCCGCTATCGCTCGCAAGCACGCAAAAGGTGATGAGCTGAAAACATTACCGGAGATCAAAACTAAGTCGGAATGGACGAAAAAGATACACCCTGGCGTGTCATCGTTCGCCGACAGGCCGGAAGCAGTAGGCCCCGATCATCTTGCGGAACTTCTCAATCATGCTCGCAAGATCATCCCTGCCGATCAGATAAAGGATACTCCCATATTTCTACTGGCCACTGCTGGGATGCGACTCTTACCCAATCGTGATCGCGAGCTTCTATTGCAACAGATCTGCTCCTACGCCAGCGAGAATTATGACTTTTTGCTTCCCGATTGCGGCGTGCACATTCAGGTCATCCCAGGAGTCACAGAGGCCCTCTACGGATGGATCGCGACCAATTATTTGCTGGGCAGCTTCGATGAACCGAAAGGGCATGATCATGGAAAGGGCCATCATACTTATGGGTTCTTGGATATGGGTGGTGCATCCGCACAGATTGCCTTTGCGCCCAATATAACTGAGACCGAGAAACACGCGAATGACCTGACTTTACTTCGGCTGCGAAACATCGACGGCTCCACCCAGGAGCATCGGGTTTTCGTGACATCTTGGCTCGAATTTGGCGTGCGCGAAGCTCGGAGACGTTATCTGGAGGCCCTACAAACCGCAGCTGGAACCGCGAAGGAACTTCCCGACCCTTGTCTCCCCAATGGATTTCGAACCACAGTTGACGGCAAACCTCTCCGGACCAACGACATCGCGGAGTTGACTCTGCTGGGAACTGGGCGATTCGATGAATGCTTGCGACAAACATACCCGCTTTTGGACAAGGATGCGCCCTGTTCGGATGAACCTTGCCTTCTTCACGGAGTGCATGTCCCTGCTATTGACTTTGATGTAAATCATTTTATCGGTATTAGCGAGTACTGGCATACGACGCATGAGATCTTTGAAATGGGACACAAGGACAAAGCTTACGACTTCAACACTTATCAACAGCGGGTACAACAGTTCTGTTCACAAGATTGGGAAGCCATCGAACAAGGTATACAAAAACAGTCATGGGGAAAGAAGGTCGACCGGGAATCGGCTGCCGAGGTTTGCTTCAAGGCTTCATGGATCATTAATATGCTGCACGACGGCATCGGTATCCCACGGGTGGGTCTCGAGGATACTACTGGTTCAGGTCACAATGGAACCAAGGAAGTTCTCGCCCATGGCGAGGAGAAAGGATTCCTTGATCCTTTTCAAGCGGTTCACAAGATCCACTCCACCGAAGTTAGCTGGACCCTGGGTAAAATGGTGCTCTATGCAAGCTCTGAGGTTCCAGTGGAAGTTCAAGAAGCTCAAGAAATGCTCCCGGTTGGCTTTGGCAGCAATGTTCCAGGCGTACCCAATGACTTCCAGTATCCTAGCGTCGAATTGTTTCCCAACAATGAGTCGCTTCACGTTGCGAATTGGCACGATGCGCTCTTTGATGGTGATTCCTCGCGCAGGGTTCCGGGATTCCTACTTTTCTTAATTATTATTGCAATGGCTGCATTCTT

CCTCTGCGGTCGGAGTCGTCGACTGAGGGTTTACCACATGTTCAAAAGTCTCTTCAAGCGTGGAGGCCCGCCTCATCCGAGCTACCCCAGGAAGCGAAGAACCTTTCCTGGCAAACTACCATTCTTTGGCCGCAGATCACACTCATACGAGCGCGTTCTTGAAGACGGTGCCCATGAATTTGACCTGGGTGTGGTAGGCTCCGGTCGTGGCTCTCTGGACAGAAGACACTCCTCCGATACAGATTCGAGTAGCTTTATGCCTCCGAAGCGAACAACGACCTGGAGCGGTCCAACCACACCTAGTTTCAAATTCGGATTGGACAATTCGTCCACATCGACCATCGGGTTGGGAATCACCGCCGATTCTGGCGTCAATGCCATGGATCGGGCCGGGTTGGTCGTGAGGACAGAGAGTAGGGACCATCTGGCTCCAGTAGCGCTAGGCCCGACCACAAACGGCCGTCGCTCTAGGACAGGCAGTCCGACGAGATCTCACAGATCACCCAATATGACTCCCCTTGATCAAGACTAA

SEQ ID NO.6：

MGKWHYGIVLDAGSSGTRVHVYRWLDPAIARKHAKGDELKTLPEIKTKSEWTKKIHPGVSSFADRPEAVGPDHLAELLNHARKIIPADQIKDTPIFLLATAGMRLLPNRDRELLLQQICSYASENYDFLLPDCGVHIQVIPGVTEALYGWIATNYLLGSFDEPKGHDHGKGHHTYGFLDMGGASAQIAFAPNITETEKHANDLTLLRLRNIDGSTQEHRVFVTSWLEFGVREARRRYLEALQTAAGTAKELPDPCLPNGFRTTVDGKPLRTNDIAELTLLGTGRFDECLRQTYPLLDKDAPCSDEPCLLHGVHVPAIDFDVNHFIGISEYWHTTHEIFEMGHKDKAYDFNTYQQRVQQFCSQDWEAIEQGIQKQSWGKKVDRESAAEVCFKASWIINMLHDGIGIPRVGLEDTTGSGHNGTKEVLAHGEEKGFLDPFQAVHKIHSTEVSWTLGKMVLYASSEVPVEVQEAQEMLPVGFGSNVPGVPNDFQYPSVELFPNNESLHVANWHDALFDGDSSRRVPGFLLFLIIIAMAAFFLCGRSRRLRVYHMFKSLFKRGGPPHPSYPRKRRTFPGKLPFFGRRSHSYERVLEDGAHEFDLGVVGSGRGSLDRRHSSDTDSSSFMPPKRTTTWSGPTTPSFKFGLDNSSTSTIGLGITADSGVNAMDRAGLVVRTESRDHLAPVALGPTTNGRRSRTGSPTRSHRSPNMTPLDQD

Heterologous expression and preparation of ASENTDP protein:

aspergillus pseudolongidinutants (obtained from American Agricultural Research Culture Collection, NRRL:62904) mycelia were collected by centrifugation, ground into a fine powder by adding liquid nitrogen rapidly, and Total RNA was extracted by the Fungal Total RNA Isolation Kit (Sangon Biotech). Using Prime Script^TMThe RT reagent Kit with gDNAeraser (Takara) reagent instructions for cDNA synthesis.

Designing a primer for amplification, and designing an upstream primer apentdp-F (SEQ ID NO.7) ATGGGCAAATGGCATTATGG and a downstream primer apentdp-R (SEQ ID NO.8) by using the cDNA of the reverse transcription product as a template: CCATAATGCCATTTGCCCAT are provided.

And (3) PCR amplification: the PCR amplification procedure is as follows: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 30s and annealing at 95 ℃ for 30s, extension at 72 ℃ for 1.5min at 55 ℃ and reaction for 34 cycles to obtain the full length of the apentdp sequence. The PCR product was ligated to pMD18-T plasmid, digested with BamH I/Not I, and ligated to yeast expression vector YEpFLAG-1 to obtain YEpFLAG-1-apentdp expression plasmid. The expression plasmid is electrically transformed into pichia pastoris X-33 by an electroporation transformation method, and a recombinant strain which over-expresses ectonucleoside triphosphate diphospho hydrolase ENTDP truncated protein is constructed. Inoculating the constructed recombinant strain into a yeast basal (SC) culture medium to culture OD_600nmThe cells were induced to culture at 30 ℃ to 0.80 ℃.

Adding Tris and EDTA lysis buffer solution, crushing thallus under high pressure, centrifuging to obtain supernatant, Ni-NTA affinity chromatography for separation and purification, SDS-PAGE and Western blot to verify that the molecular weight of the obtained recombinant ASENTDP is about 80 kDa.

Enzymatic properties of recombinant ASENTDP:

determination of phosphate concentration by ammonium molybdate-ascorbic acid spectrophotometry: taking a certain amount of KH₂PO₄Dissolving in deionized water to prepare 0.1-10.0 mM phosphate radical standard solution; taking standard solutions under various concentrations, respectively adding 4mL of 50g/L potassium persulfate solution for digestion for 30min, adding 2mL of nitric acid, heating to boil, adding 3mL of perchloric acid after a cold area, and cooling to a constant volume of 25 mL; removing the hydrolyzed solution, adding 1mL of 100g/L ascorbic acid solution, mixing, adding 2mL of 24g/L molybdate solution, mixing, reacting for 15min, and measuring OD_700nmThe values are plotted on the phosphate concentration abscissa and the absorbance on the ordinate, and a standard curve Y of the phosphate concentration determination is established, 8815.9X +28.3(pmol) (R)²＝0.997)。

Adding 150 mu g/mL recombinant ASENTDP protein into 200 mu L of 5mM UDP, setting the reaction temperature to be 20 ℃, 30 ℃, 40 ℃, 50 ℃, 60 ℃, 70 ℃ and 80 ℃ for reaction for 3h under the condition of pH7.0, detecting inorganic phosphate released under each reaction module by an ammonium molybdate-ascorbic acid spectrophotometry, calculating the amount of the released inorganic phosphate through a standard curve, and determining the optimal catalysis temperature to be 40 ℃.

200. mu.L of 5mM UDP was added to 150. mu.g/mL of the recombinant ASENTDP protein, and the mixture was reacted at 40 ℃ for 3 hours while setting pH values of 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 and 11.0, and the optimum catalytic pH was determined to be 8.0 ℃ based on the amount of inorganic phosphate released.

Adding 150 mu g/mL recombinant ASENTDP protein into 200 mu L5 mM UDP, adding magnesium chloride, copper chloride, calcium chloride, zinc chloride, ferric sulfate and manganese sulfate into a reaction system respectively to make the final concentrations of the two to be 1.0 mu mol/mL respectively, reacting for 3h at 40 ℃ and pH 8.0, and determining metal ion Ca according to the amount of released inorganic phosphate²⁺(1.0. mu. mol/mL) can increase the catalytic activity by 30%.

The recombinant LDENTDP protein was stored in a Tris buffer solution of pH 7.020mM, and glycerol was added to the buffer solution at a final concentration of 20% (v/v) and 1.0. mu. mol/mL of CaCl₂After being stored for 12 months at-4 ℃, the enzyme activity is measured, and compared with the LDENTDP protein which is freshly prepared, the catalytic activity is at least kept more than 95 percent.

Determining the activity of cordyceps militaris beta-1, 3-glucan synthase CMGLS:

selecting medicinal fungus Cordyceps militaris beta-1, 3-glucan synthetase (CMGLS) as a determination object.

Taking cordyceps militaris (purchased from China Center for Industrial Culture Collection of microorganisms, CICC 14015) fermentation mycelium, adding the mycelium into 6mmol/L Tris-HCl buffer solution (containing 1% Triton X-114) with pH of 7.4 according to the ratio of 1:5(W: v), carrying out ultrasonic treatment for 30min under the condition of 200W (ultrasonic treatment for 8s and interval for 4s), and centrifuging at 35000r/min at 4 ℃ for 1h to obtain supernatant, namely the crude enzyme solution of the cordyceps militaris beta-1, 3-glucan synthetase. The crude enzyme solution was applied to a Hydroxypatite Fast Flow column (5mL pre-packed column) using 10mmol/L, 50mmol/L, 100mmol/L and 150mmol/L of a solution of pH 6.0 containing 5mmol/LMgCl₂And (3) carrying out step-by-step elution by using 1% Triton X-100 potassium phosphate buffer solution at the flow rate of 2mL/min, and collecting the cordyceps militaris membrane-bound beta-glucan synthetase with the relative molecular mass of 250kDaCMGLS. The matrix-assisted laser desorption ionization time-of-flight mass spectrometry results prove that the purified protein is actually membrane-bound CMGLS, and the molecular mass is 259 kDa.

The total volume of the system is 50 mu L, the system comprises 80mM UDP-glucose, 50 mu g/mL cordyceps militaris beta-glucan synthetase CMGLS protein and 80 mu g/mL recombinant ASENTDP, the OD is measured after the reaction is carried out for 3h under the conditions of 40 ℃ and pH 8.0_620nm0.953; standard curve Y-8815.9X +28.3(pmol) (R) established by ammonium molybdate-ascorbic acid spectrophotometry²0.997), calculated to release 5405.4 μmol of inorganic phosphate, 5405.4pmol of UDP-glucose was consumed; so the enzyme activity of the prepared cordyceps militaris beta-glucan synthetase is 280.05pmol h^-1μg^-1。

Example 3 detection of the Activity of the Volvariella beta-1, 3-glucan synthase VVGLS Using the Yarrowia lipolytica-derived recombinant YLENDP

YLENTD sequence and its coding nucleotide sequence:

the nucleotide sequence of the ectonucleoside triphosphate diphosphohydrolase PHENTDP (Accession: CP061017.1), the coding nucleotide sequence and the amino acid sequence of which are shown in SEQ ID NO.9 and SEQ ID NO.10, were obtained by searching in the Yarrowia lipolytica CLIB122 genome (GenBank: ASM252v 1).

SEQ ID NO.9：

CTAGTATCCAGCGGCATTCTGGAGGGCGACACCGAGTGCCCAGGAGACCTCGTTTCCTCCGTGGCTCTTTACCGTCTTCAGTGGTCTGTCTAAGGCAATACCATAGCCTGAGTGAAGAAGAGTGTACATGAACGACAGATCGAGACACCATTCTGGACGTCCCTGAAGCTCTTTGAAAGCCATTTCAGAAAGTCCAGAGATATCTGTCCATTGCCCATGGCACACCTTCTCCTGAAGCCTTTTCACATCTCTTAGAGAGAACTCGTTCTGGAGGCCCAGGTTTGAGGTACGATCATAGAAATACGAAATCAAATACAAGTCTCCATTGTAGGTGCCGATGGGAGGCTGGTAGACATTGTTGATTGAGCAGGACGAATGGGTGCAAGGCTCGGTGTGGAGAATCTTCTCCATGTAAGCGATACACTCCTGGTCGTTCAAAACGTCAGAAGTCAGTTCGTAGCCTGCTTCTGTCTTGCCGTTGATCACCTTGCTCATACCCTTACCGATGCAAGGGTTTATTCGACCATTGTTGAGCTCCAAAATCTTCTTTCGGGCCTCCATTAGCCCATAGCCGAGATGAGAGTACTGGTACAGATCGAACTTTCTCTCATCATCTCCCACGGCCATGGAAGAGCATCCACCCTTGTTTCGCTCAATCTCAAAGACGATCTGGGTTGATCCACCGCCCAGTTCTGCCACGGAAACGGTTCTATTGTGTTGGAGACGTCCAAGCAGATAGTTTAGCGTCATCCAGGCAAAGAAGCCTTCCTCCTCGCCGGTCAAAACGGCCACAGCCTCGGCACTCCTTTGGAAGGGATACTCTGTAAGCAGATTATCCACCGATGTCAGAATGCCGACCTGTTCTTCGGGGGTCAACATTCGAAGGCCTGCGGTGCACTTGACCCAGATGGGGGTCTCGGTTTGGTGTTTACTTGGGATCCAGTTTGTAGCTCGGTTAAGCATGCCTCGAAGAGTCTCAGCGCCCAGCTGGGGCTCAGTCGCGAATGACGATAGCCCCGGACGAGTGAACTCGAAGTACTTGTCTTCAAGAATAGGCAGAGACTGGTTTGTCTCATGTCTAAATTTGAAGACATGCACTCGTGAACCGGTGGAACCGGCGTCCACTACCACCGCATAGGAGGAGTTGGGGGTGTAGACGGGGCGCAGAATCCAAGTCAGCAGCAGTAAGATTATCGAAGGTACCCACAT

SEQ ID NO.10：

MWVPSIILLLLTWILRPVYTPNSSYAVVVDAGSTGSRVHVFKFRHETNQSLPILEDKYFEFTRPGLSSFATEPQLGAETLRGMLNRATNWIPSKHQTETPIWVKCTAGLRMLTPEEQVGILTSVDNLLTEYPFQRSAEAVAVLTGEEEGFFAWMTLNYLLGRLQHNRTVSVAELGGGSTQIVFEIERNKGGCSSMAVGDDERKFDLYQYSHLGYGLMEARKKILELNNGRINPCIGKGMSKVINGKTEAGYELTSDVLNDQECIAYMEKILHTEPCTHSSCSINNVYQPPIGTYNGDLYLISYFYDRTSNLGLQNEFSLRDVKRLQEKVCHGQWTDISGLSEMAFKELQGRPEWCLDLSFMYTLLHSGYGIALDRPLKTVKSHGGNEVSWALGVALQNAAGY

Heterologous expression and preparation of PHENTDP protein:

the sequence of ectonucleoside triphosphate diphospho hydrolase ENTDP gene (SEQ ID NO.9) of Yarrowia lipolytica is taken as a template, and 6 × His tag is added after codon optimization in escherichia coli, and a commercial company is entrusted to synthesize the ylentdp gene sequence.

Designing a specific primer of a polyclonal enzyme cutting site with an expression vector pET-30a (+), wherein the sequence of the primer is as follows: upstream primer ylentdp-F (SEQ ID NO. 11): CTAGTATCCAGCGGCATTCT, respectively; downstream primer ylentdp-R (SEQ ID NO. 12): AGAATGCCGCTGGATACTAG are provided.

The ylentdp gene synthesized by commercial company uses the primer sequences shown in SEQ ID NO.11 and SEQ ID NO.12 to carry out PCR amplification, after purification, the target fragment is recovered, the expression vector pET-30a (+) is double-enzyme-cut by restriction enzymes NdeI and HindIII, and the enzyme-cut product is recovered by a glue recovery kit. By using a Hieff

The rapid Cloning Kit of Plus One Step Cloning Kit recombines the cloned ylintdp intoAnd (3) transforming the vector pET-30a (+) into competent escherichia coli TOP10, screening positive clones on a kanamycin-resistant plate, extracting plasmids, and verifying by double enzyme digestion to obtain a correct recombinant expression vector pET-30a (+) -ylentdp. E.coli BL21(DE3) is cultured, competent cells are prepared, plasmids pET-30a (+) -ylentdp are transformed by electric shock, kanamycin resistant plates are used for screening positive clones, and single colonies are picked for colony PCR verification; the positive colonies successfully verified were picked and inoculated into 100mL LB (Kan +) liquid medium (tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L), cultured at 37 ℃ and 180rpm to OD_600nmIs 0.7. IPTG was added to a final concentration of 0.5mM, and the cells were collected after induction at 37 ℃ for 4 hours. And centrifuging to collect thalli, carrying out ultrasonic disruption, collecting cell lysate, separating and purifying by using a Ni-NTA pre-packed chromatographic column His-Tag affinity label to prepare recombinant YLENTDP, and verifying the obtained recombinant YLENTDP protein and the molecular weight thereof to be about 45kDa by SDS-PAGE and Western blot.

Enzymatic properties of recombinant YLENTDP:

determination of phosphate concentration by ion chromatography: taking out a certain amount of KH₂PO₄Dissolving in deionized water to prepare 0.1-10.0 mM phosphate radical standard solution; a TH-980C ion chromatograph is adopted, and the chromatographic conditions are as follows: NJ-SA-4A anion separation column (250 mm. times.4.6 mm, column temperature 33 ℃); the mobile phase is 0.35mmol/L Na₂CO₃+0.05mmol/L NaHCO₃(flow rate 1.5mL/min), anion suppressor type LKX-A1, conductivity detector (cell temperature 40 ℃). Establishing a standard curve for measuring the concentration of the phosphate radical by using the concentration of the phosphate radical and the peak area of phosphate response, wherein the concentration of the phosphate radical is in a good linear relation with the peak area value within the range of 0.1-10.0 mM, and the linear regression equation is that C is 2.5 multiplied by 10^-4Δ S-0.132, correlation coefficient 0.9980.

Taking 50 mu L of 5mM UDP, adding 50 mu g/mL of recombinant ASENTDP protein, setting the reaction temperature at 20 ℃, 30 ℃, 40 ℃, 50 ℃, 60 ℃, 70 ℃ and 80 ℃ for reaction for 1h under the condition of pH7.0, measuring the phosphate concentration by ion chromatography, detecting the inorganic phosphate released by each reaction group, calculating the amount of the released inorganic phosphate by a standard curve, and determining the optimal catalysis temperature to be 30 ℃.

50 μ L of 5mM UDP was added to 50 μ g/mL of the recombinant ASENTDP protein, and the optimum catalytic pH was determined to be 6.5 ℃ based on the amount of inorganic phosphate released by setting pH values of 3.5, 4.5, 5.5, 6.5, 7.5, 8.5, 9.5 and 10.5 for reaction at 40 ℃ for 1 hour.

Adding 50 mu L of 5mM UDP into 50 mu g/mL of recombinant ASENTDP protein, respectively adding magnesium chloride, copper chloride, calcium chloride, zinc chloride, ferric sulfate and manganese sulfate into a reaction system to make the final concentrations respectively be 0.7 mu mol/mL, reacting for 1h at 30 ℃ and pH 6.5, and determining metal ion Zn according to the amount of released inorganic phosphate²⁺(0.7. mu. mol/mL) can increase the catalytic activity by 40%.

The recombinant LDENTDP protein was stored in pH7.020mM Tris buffer, and glycerol was added to the buffer to a final concentration of 20% (v/v) and ZnCl was added to the buffer at 0.7. mu. mol/mL₂After being stored for 12 months at-4 ℃, the enzyme activity is measured, and compared with the LDENTDP protein which is freshly prepared, the catalytic activity is at least kept more than 90 percent.

And (3) determining the activity of straw mushroom beta-1, 3-glucan synthetase VVGLS:

edible mushroom (commercially available) beta-1, 3-glucan synthase (VVGLS) is selected as a measurement object. Adding freshly picked Volvariella volvacea fruiting bodies in the button stage into 6mmol/L Tris-HCl buffer solution (containing 1% Triton X-114) with the pH value of 7.4 according to the ratio of 1:10(W: v), carrying out ultrasonic treatment for 20min under the condition of 350W (ultrasonic treatment for 8s and interval of 4s), and centrifuging for 40min at the temperature of 4 ℃ at 42000r/min, wherein the obtained supernatant is crude enzyme solution of Volvariella volvacea beta-1, 3-glucan synthetase. The crude enzyme solution was applied to a Hydroxyapatite Fast Flow column (5mL pre-packed column) and treated with 10mmol/L, 50mmol/L, 100mmol/L and 150mmol/L solutions containing 5mmol/LMgCl at a pH of 6.0₂And (3) periodically eluting with 1% Triton X-100 potassium phosphate buffer solution at the flow rate of 2mL/min, and collecting the volvariella volvacea membrane-bound beta-glucan synthase VVGLS with the relative molecular mass of about 190 kDa. The results of matrix-assisted laser desorption ionization time-of-flight mass spectrometry prove that the purified protein is actually membrane-bound VVGLS, and the molecular mass is 188 kDa.

The total volume of the system is 50 mu L, which comprises 60mM UDP-glucose, 80 mu g/mL straw mushroom beta-glucan synthetase VVGLS protein, 40 mu g/mL recombinant YLENDP, and the temperature is 30 ℃, and the pH value isReacting for 1h under the condition of 6.5, and measuring the peak area value to be 13019346 uV.S; using the standard curve established by the above ion chromatography, it was calculated that 3254.83pmol of inorganic phosphate was released and 3254.83pmol of UDP-glucose was consumed; so the enzyme activity of the prepared cordyceps militaris beta-glucan synthetase is 135.62pmol h^-1μg^-1。

The present invention is not limited to the above-described embodiments, and any obvious improvements, substitutions or modifications can be made by those skilled in the art without departing from the spirit of the present invention.

Sequence listing

<110> university of Jiangsu

<120> detection kit and detection method for activity of beta-glucan synthase and application

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1353

<212> DNA

<213> bacterium (Leginonella donaldsonii)

<400> 1

atggttagca gcaccggcct gagcagcgag accattagca tcaccctgtg cctgaacggc 60

aaaggtccgc tgacctgcca aaactacaac gtggcgagcc tgaacctgag catcaccacc 120

accgtgccga accgtgttta cccgagcgtg ggcattaagg ttaaccgtcc gggctactat 180

ccgctgctgg gttgcacccc gatcgcgaac ggttattgcc tgttcagcgc gaacaacgtt 240

agcccggcga ccattacccc ggcgaacgcg cgttacaacg tggttttcga cgcgggtagc 300

agcggcaccc gtatgtttat ctatcagacc attgcgccgc tgaacccgct gatcgtgacc 360

ctgttcaccg ataacaacaa cattccgctg gcgagctttg cgaacaaccc ggcggcggcg 420

ggtaacgcga tccagccgct gctgaccgag gcgaccaacg ttctgcagac ctaccaaatc 480

atgccgagcc aagcgatcgc gagcgtgctg ggtaccgcgg gtatgcgtgt tctgaccgag 540

gcgcagcaag cggcgatcta ccagagcgtg gcgaacacca ttgttagcaa caactatggt 600

ctgggcgaaa ccaagaccat cagcggtcag caagagggcc tgtaccaatg gctggaagtg 660

aactatctga acagcagcct gggcacctac ctgacccgtg gtatcattga aattggtggc 720

gcgagcgcgc aggtggcgtt tgttgcgaac accccgagca acccgaacgt tatcaaactg 780

accattaacg gcgtggttta tgacctgttc agcatcagct ttctgggtct gggccaggac 840

ctggcgcgtc aaagcatgga tgcggtgcag ccgccgctgg acccggataa ctgctacccg 900

gttggttata accaaggccc gattaccggt aacttcctgt acagccgttg cctggcgaac 960

tatggtgaag tgctgaccaa cttcagcatg ctgagccagc tgaccagcgt tccgggcttt 1020

gcgagccaaa gctactatgg tatcgcggcg atttacttca acgcgacctt tctgggcatc 1080

agcaacaact ttaacccgct gagcattcgt aacgcgatca gcagcatttg cagcaacagc 1140

tacgcgcagc tgcagcaact gtatccgggt ctgccgcaac tgttcaacaa atgcgcggac 1200

agcacctacg tggatagctt tctgtatagc agcccgggcc tgaacctggt gggtatcccg 1260

gttgaaccgg tggttaccat cagcggcgtt ccgattacct ggaccggtgg ctacatttac 1320

ctggtgaaca aagtgccgag cattctgggt taa 1353

<210> 2

<211> 447

<212> PRT

<213> bacterium (Leginonella donaldsonii)

<400> 2

Met Val Ser Ser Thr Gly Leu Ser Ser Glu Thr Ile Ser Ile Thr Leu

1 5 10 15

Cys Leu Asn Gly Lys Gly Pro Leu Thr Cys Gln Asn Tyr Asn Val Ala

20 25 30

Ser Leu Asn Leu Ser Ile Thr Thr Thr Val Pro Asn Arg Val Tyr Pro

35 40 45

Ser Val Gly Ile Lys Val Asn Arg Pro Gly Tyr Tyr Pro Leu Leu Gly

50 55 60

Cys Thr Pro Ile Ala Asn Gly Tyr Cys Leu Phe Ser Ala Asn Asn Val

65 70 75 80

Ser Pro Ala Thr Ile Thr Pro Ala Asn Ala Arg Tyr Asn Val Val Phe

85 90 95

Asp Ala Gly Ser Ser Gly Thr Arg Met Phe Ile Tyr Gln Thr Ile Ala

100 105 110

Pro Leu Asn Pro Leu Ile Val Thr Leu Phe Thr Asp Asn Asn Asn Pro

115 120 125

Leu Ala Ser Phe Ala Asn Asn Pro Ala Ala Ala Gly Asn Ala Ile Gln

130 135 140

Pro Leu Leu Thr Glu Ala Thr Asn Val Leu Gln Thr Tyr Gln Ile Met

145 150 155 160

Pro Ser Gln Ala Ile Ala Ser Val Leu Gly Thr Ala Gly Met Arg Val

165 170 175

Leu Thr Glu Ala Gln Gln Ala Ala Ile Tyr Gln Ser Val Ala Asn Thr

180 185 190

Ile Val Ser Asn Asn Tyr Gly Leu Gly Glu Thr Lys Thr Ile Ser Gly

195 200 205

Gln Gln Glu Gly Leu Tyr Gln Trp Leu Glu Val Asn Tyr Leu Asn Ser

210 215 220

Ser Leu Gly Thr Tyr Leu Thr Arg Gly Ile Ile Glu Ile Gly Gly Ala

225 230 235 240

Ser Ala Gln Val Ala Phe Val Ala Asn Thr Pro Ser Asn Pro Val Ile

245 250 255

Lys Leu Thr Ile Asn Gly Val Val Tyr Asp Leu Phe Ser Ile Ser Phe

260 265 270

Leu Gly Leu Gly Gln Asp Leu Ala Arg Gln Ser Met Asp Ala Val Gln

275 280 285

Pro Pro Leu Asp Pro Asp Asn Cys Tyr Pro Val Gly Tyr Asn Gln Gly

290 295 300

Pro Ile Thr Gly Asn Phe Leu Tyr Ser Arg Cys Leu Ala Asn Tyr Gly

305 310 315 320

Glu Val Leu Thr Asn Phe Ser Met Leu Ser Gln Leu Thr Ser Val Pro

325 330 335

Gly Phe Ala Ser Gln Ser Tyr Tyr Gly Ile Ala Ala Ile Tyr Phe Asn

340 345 350

Ala Thr Phe Leu Gly Ile Ser Asn Asn Phe Asn Pro Leu Ser Ile Arg

355 360 365

Asn Ala Ile Ser Ser Ile Cys Ser Asn Ser Tyr Ala Gln Gln Gln Leu

370 375 380

Tyr Pro Gly Leu Pro Gln Leu Phe Asn Lys Cys Ala Asp Ser Thr Tyr

385 390 395 400

Val Asp Ser Phe Leu Tyr Ser Ser Pro Gly Leu Asn Leu Val Gly Ile

405 410 415

Pro Val Glu Pro Val Val Thr Ile Ser Gly Val Pro Ile Thr Trp Thr

420 425 430

Gly Gly Tyr Ile Tyr Leu Val Asn Lys Val Pro Ser Ile Leu Gly

435 440 445

<210> 3

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggagatatac atatggttag cagcaccggc ct 32

<210> 4

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggccgcaagc ttttaatgat gatgatgatg atg 33

<210> 5

<211> 2142

<212> DNA

<213> fungus (Aspergillus pseudoviridinutanans)

<400> 5

atgggcaaat ggcattatgg catcgtccta gatgcgggat catctgggac tcgagtgcac 60

gtctatcggt ggttggaccc cgctatcgct cgcaagcacg caaaaggtga tgagctgaaa 120

acattaccgg agatcaaaac taagtcggaa tggacgaaaa agatacaccc tggcgtgtca 180

tcgttcgccg acaggccgga agcagtaggc cccgatcatc ttgcggaact tctcaatcat 240

gctcgcaaga tcatccctgc cgatcagata aaggatactc ccatatttct actggccact 300

gctgggatgc gactcttacc caatcgtgat cgcgagcttc tattgcaaca gatctgctcc 360

tacgccagcg agaattatga ctttttgctt cccgattgcg gcgtgcacat tcaggtcatc 420

ccaggagtca cagaggccct ctacggatgg atcgcgacca attatttgct gggcagcttc 480

gatgaaccga aagggcatga tcatggaaag ggccatcata cttatgggtt cttggatatg 540

ggtggtgcat ccgcacagat tgcctttgcg cccaatataa ctgagaccga gaaacacgcg 600

aatgacctga ctttacttcg gctgcgaaac atcgacggct ccacccagga gcatcgggtt 660

ttcgtgacat cttggctcga atttggcgtg cgcgaagctc ggagacgtta tctggaggcc 720

ctacaaaccg cagctggaac cgcgaaggaa cttcccgacc cttgtctccc caatggattt 780

cgaaccacag ttgacggcaa acctctccgg accaacgaca tcgcggagtt gactctgctg 840

ggaactgggc gattcgatga atgcttgcga caaacatacc cgcttttgga caaggatgcg 900

ccctgttcgg atgaaccttg ccttcttcac ggagtgcatg tccctgctat tgactttgat 960

gtaaatcatt ttatcggtat tagcgagtac tggcatacga cgcatgagat ctttgaaatg 1020

ggacacaagg acaaagctta cgacttcaac acttatcaac agcgggtaca acagttctgt 1080

tcacaagatt gggaagccat cgaacaaggt atacaaaaac agtcatgggg aaagaaggtc 1140

gaccgggaat cggctgccga ggtttgcttc aaggcttcat ggatcattaa tatgctgcac 1200

gacggcatcg gtatcccacg ggtgggtctc gaggatacta ctggttcagg tcacaatgga 1260

accaaggaag ttctcgccca tggcgaggag aaaggattcc ttgatccttt tcaagcggtt 1320

cacaagatcc actccaccga agttagctgg accctgggta aaatggtgct ctatgcaagc 1380

tctgaggttc cagtggaagt tcaagaagct caagaaatgc tcccggttgg ctttggcagc 1440

aatgttccag gcgtacccaa tgacttccag tatcctagcg tcgaattgtt tcccaacaat 1500

gagtcgcttc acgttgcgaa ttggcacgat gcgctctttg atggtgattc ctcgcgcagg 1560

gttccgggat tcctactttt cttaattatt attgcaatgg ctgcattctt cctctgcggt 1620

cggagtcgtc gactgagggt ttaccacatg ttcaaaagtc tcttcaagcg tggaggcccg 1680

cctcatccga gctaccccag gaagcgaaga acctttcctg gcaaactacc attctttggc 1740

cgcagatcac actcatacga gcgcgttctt gaagacggtg cccatgaatt tgacctgggt 1800

gtggtaggct ccggtcgtgg ctctctggac agaagacact cctccgatac agattcgagt 1860

agctttatgc ctccgaagcg aacaacgacc tggagcggtc caaccacacc tagtttcaaa 1920

ttcggattgg acaattcgtc cacatcgacc atcgggttgg gaatcaccgc cgattctggc 1980

gtcaatgcca tggatcgggc cgggttggtc gtgaggacag agagtaggga ccatctggct 2040

ccagtagcgc taggcccgac cacaaacggc cgtcgctcta ggacaggcag tccgacgaga 2100

tctcacagat cacccaatat gactcccctt gatcaagact aa 2142

<210> 6

<211> 713

<212> PRT

<213> fungus (Aspergillus pseudoviridinutanans)

<400> 6

Met Gly Lys Trp His Tyr Gly Ile Val Leu Asp Ala Gly Ser Ser Gly

1 5 10 15

Thr Arg Val His Val Tyr Arg Trp Leu Asp Pro Ala Ile Ala Arg Lys

20 25 30

His Ala Lys Gly Asp Glu Leu Lys Thr Leu Pro Glu Ile Lys Thr Lys

35 40 45

Ser Glu Trp Thr Lys Lys Ile His Pro Gly Val Ser Ser Phe Ala Asp

50 55 60

Arg Pro Glu Ala Val Gly Pro Asp His Leu Ala Glu Leu Leu Asn His

65 70 75 80

Ala Arg Lys Ile Ile Pro Ala Asp Gln Ile Lys Asp Thr Pro Ile Phe

85 90 95

Leu Leu Ala Thr Ala Gly Met Arg Leu Leu Pro Asn Arg Asp Arg Glu

100 105 110

Leu Leu Leu Gln Gln Ile Cys Ser Tyr Ala Ser Glu Asn Tyr Asp Phe

115 120 125

Leu Leu Pro Asp Cys Gly Val His Ile Gln Val Ile Pro Gly Val Thr

130 135 140

Glu Ala Leu Tyr Gly Trp Ile Ala Thr Asn Tyr Leu Leu Gly Ser Phe

145 150 155 160

Asp Glu Pro Lys Gly His Asp His Gly Lys Gly His His Thr Tyr Gly

165 170 175

Phe Leu Asp Met Gly Gly Ala Ser Ala Gln Ile Ala Phe Ala Pro Asn

180 185 190

Ile Thr Glu Thr Glu Lys His Ala Asn Asp Leu Thr Leu Leu Arg Leu

195 200 205

Arg Asn Ile Asp Gly Ser Thr Gln Glu His Arg Val Phe Val Thr Ser

210 215 220

Trp Leu Glu Phe Gly Val Arg Glu Ala Arg Arg Arg Tyr Leu Glu Ala

225 230 235 240

Leu Gln Thr Ala Ala Gly Thr Ala Lys Glu Leu Pro Asp Pro Cys Leu

245 250 255

Pro Asn Gly Phe Arg Thr Thr Val Asp Gly Lys Pro Leu Arg Thr Asn

260 265 270

Asp Ile Ala Glu Leu Thr Leu Leu Gly Thr Gly Arg Phe Asp Glu Cys

275 280 285

Leu Arg Gln Thr Tyr Pro Leu Leu Asp Lys Asp Ala Pro Cys Ser Asp

290 295 300

Glu Pro Cys Leu Leu His Gly Val His Val Pro Ala Ile Asp Phe Asp

305 310 315 320

Val Asn His Phe Ile Gly Ile Ser Glu Tyr Trp His Thr Thr His Glu

325 330 335

Ile Phe Glu Met Gly His Lys Asp Lys Ala Tyr Asp Phe Asn Thr Tyr

340 345 350

Gln Gln Arg Val Gln Gln Phe Cys Ser Gln Asp Trp Glu Ala Ile Glu

355 360 365

Gln Gly Ile Gln Lys Gln Ser Trp Gly Lys Lys Val Asp Arg Glu Ser

370 375 380

Ala Ala Glu Val Cys Phe Lys Ala Ser Trp Ile Ile Asn Met Leu His

385 390 395 400

Asp Gly Ile Gly Ile Pro Arg Val Gly Leu Glu Asp Thr Thr Gly Ser

405 410 415

Gly His Asn Gly Thr Lys Glu Val Leu Ala His Gly Glu Glu Lys Gly

420 425 430

Phe Leu Asp Pro Phe Gln Ala Val His Lys Ile His Ser Thr Glu Val

435 440 445

Ser Trp Thr Leu Gly Lys Met Val Leu Tyr Ala Ser Ser Glu Val Pro

450 455 460

Val Glu Val Gln Glu Ala Gln Glu Met Leu Pro Val Gly Phe Gly Ser

465 470 475 480

Asn Val Pro Gly Val Pro Asn Asp Phe Gln Tyr Pro Ser Val Glu Leu

485 490 495

Phe Pro Asn Asn Glu Ser Leu His Val Ala Asn Trp His Asp Ala Leu

500 505 510

Phe Asp Gly Asp Ser Ser Arg Arg Val Pro Gly Phe Leu Leu Phe Leu

515 520 525

Ile Ile Ile Ala Met Ala Ala Phe Phe Leu Cys Gly Arg Ser Arg Arg

530 535 540

Leu Arg Val Tyr His Met Phe Lys Ser Leu Phe Lys Arg Gly Gly Pro

545 550 555 560

Pro His Pro Ser Tyr Pro Arg Lys Arg Arg Thr Phe Pro Gly Lys Leu

565 570 575

Pro Phe Phe Gly Arg Arg Ser His Ser Tyr Glu Arg Val Leu Glu Asp

580 585 590

Gly Ala His Glu Phe Asp Leu Gly Val Val Gly Ser Gly Arg Gly Ser

595 600 605

Leu Asp Arg Arg His Ser Ser Asp Thr Asp Ser Ser Ser Phe Met Pro

610 615 620

Pro Lys Arg Thr Thr Thr Trp Ser Gly Pro Thr Thr Pro Ser Phe Lys

625 630 635 640

Phe Gly Leu Asp Asn Ser Ser Thr Ser Thr Ile Gly Leu Gly Ile Thr

645 650 655

Ala Asp Ser Gly Val Asn Ala Met Asp Arg Ala Gly Leu Val Val Arg

660 665 670

Thr Glu Ser Arg Asp His Leu Ala Pro Val Ala Leu Gly Pro Thr Thr

675 680 685

Asn Gly Arg Arg Ser Arg Thr Gly Ser Pro Thr Arg Ser His Arg Ser

690 695 700

Pro Asn Met Thr Pro Leu Asp Gln Asp

705 710

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgggcaaat ggcattatgg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ccataatgcc atttgcccat 20

<210> 9

<211> 1209

<212> DNA

<213> Yarrowia lipolytica

<400> 9

ctagtatcca gcggcattct ggagggcgac accgagtgcc caggagacct cgtttcctcc 60

gtggctcttt accgtcttca gtggtctgtc taaggcaata ccatagcctg agtgaagaag 120

agtgtacatg aacgacagat cgagacacca ttctggacgt ccctgaagct ctttgaaagc 180

catttcagaa agtccagaga tatctgtcca ttgcccatgg cacaccttct cctgaagcct 240

tttcacatct cttagagaga actcgttctg gaggcccagg tttgaggtac gatcatagaa 300

atacgaaatc aaatacaagt ctccattgta ggtgccgatg ggaggctggt agacattgtt 360

gattgagcag gacgaatggg tgcaaggctc ggtgtggaga atcttctcca tgtaagcgat 420

acactcctgg tcgttcaaaa cgtcagaagt cagttcgtag cctgcttctg tcttgccgtt 480

gatcaccttg ctcataccct taccgatgca agggtttatt cgaccattgt tgagctccaa 540

aatcttcttt cgggcctcca ttagcccata gccgagatga gagtactggt acagatcgaa 600

ctttctctca tcatctccca cggccatgga agagcatcca cccttgtttc gctcaatctc 660

aaagacgatc tgggttgatc caccgcccag ttctgccacg gaaacggttc tattgtgttg 720

gagacgtcca agcagatagt ttagcgtcat ccaggcaaag aagccttcct cctcgccggt 780

caaaacggcc acagcctcgg cactcctttg gaagggatac tctgtaagca gattatccac 840

cgatgtcaga atgccgacct gttcttcggg ggtcaacatt cgaaggcctg cggtgcactt 900

gacccagatg ggggtctcgg tttggtgttt acttgggatc cagtttgtag ctcggttaag 960

catgcctcga agagtctcag cgcccagctg gggctcagtc gcgaatgacg atagccccgg 1020

acgagtgaac tcgaagtact tgtcttcaag aataggcaga gactggtttg tctcatgtct 1080

aaatttgaag acatgcactc gtgaaccggt ggaaccggcg tccactacca ccgcatagga 1140

ggagttgggg gtgtagacgg ggcgcagaat ccaagtcagc agcagtaaga ttatcgaagg 1200

tacccacat 1209

<210> 10

<211> 402

<212> PRT

<213> Yarrowia lipolytica

<400> 10

Met Trp Val Pro Ser Ile Ile Leu Leu Leu Leu Thr Trp Ile Leu Arg

1 5 10 15

Pro Val Tyr Thr Pro Asn Ser Ser Tyr Ala Val Val Val Asp Ala Gly

20 25 30

Ser Thr Gly Ser Arg Val His Val Phe Lys Phe Arg His Glu Thr Asn

35 40 45

Gln Ser Leu Pro Ile Leu Glu Asp Lys Tyr Phe Glu Phe Thr Arg Pro

50 55 60

Gly Leu Ser Ser Phe Ala Thr Glu Pro Gln Leu Gly Ala Glu Thr Leu

65 70 75 80

Arg Gly Met Leu Asn Arg Ala Thr Asn Trp Ile Pro Ser Lys His Gln

85 90 95

Thr Glu Thr Pro Ile Trp Val Lys Cys Thr Ala Gly Leu Arg Met Leu

100 105 110

Thr Pro Glu Glu Gln Val Gly Ile Leu Thr Ser Val Asp Asn Leu Leu

115 120 125

Thr Glu Tyr Pro Phe Gln Arg Ser Ala Glu Ala Val Ala Val Leu Thr

130 135 140

Gly Glu Glu Glu Gly Phe Phe Ala Trp Met Thr Leu Asn Tyr Leu Leu

145 150 155 160

Gly Arg Leu Gln His Asn Arg Thr Val Ser Val Ala Glu Leu Gly Gly

165 170 175

Gly Ser Thr Gln Ile Val Phe Glu Ile Glu Arg Asn Lys Gly Gly Cys

180 185 190

Ser Ser Met Ala Val Gly Asp Asp Glu Arg Lys Phe Asp Leu Tyr Gln

195 200 205

Tyr Ser His Leu Gly Tyr Gly Leu Met Glu Ala Arg Lys Lys Ile Leu

210 215 220

Glu Leu Asn Asn Gly Arg Ile Asn Pro Cys Ile Gly Lys Gly Met Ser

225 230 235 240

Lys Val Ile Asn Gly Lys Thr Glu Ala Gly Tyr Glu Leu Thr Ser Asp

245 250 255

Val Leu Asn Asp Gln Glu Cys Ile Ala Tyr Met Glu Lys Ile Leu His

260 265 270

Thr Glu Pro Cys Thr His Ser Ser Cys Ser Ile Asn Asn Val Tyr Gln

275 280 285

Pro Pro Ile Gly Thr Tyr Asn Gly Asp Leu Tyr Leu Ile Ser Tyr Phe

290 295 300

Tyr Asp Arg Thr Ser Asn Leu Gly Leu Gln Asn Glu Phe Ser Leu Arg

305 310 315 320

Asp Val Lys Arg Leu Gln Glu Lys Val Cys His Gly Gln Trp Thr Asp

325 330 335

Ile Ser Gly Leu Ser Glu Met Ala Phe Lys Glu Leu Gln Gly Arg Pro

340 345 350

Glu Trp Cys Leu Asp Leu Ser Phe Met Tyr Thr Leu Leu His Ser Gly

355 360 365

Tyr Gly Ile Ala Leu Asp Arg Pro Leu Lys Thr Val Lys Ser His Gly

370 375 380

Gly Asn Glu Val Ser Trp Ala Leu Gly Val Ala Leu Gln Asn Ala Ala

385 390 395 400

Gly Tyr

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctagtatcca gcggcattct 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

agaatgccgc tggatactag 20

Claims (13)

1. A kit for determining activity of beta-glucan synthase is characterized by comprising a beta-glucan synthase enzymolysis substrate, ectonucleoside triphosphate diphospho hydrolase ENTDP and a reagent for determining content of phosphate released by UDP hydrolysis.

2. The kit according to claim 1, characterized in that the ectonucleoside triphosphate diphosphohydrolase ENTDP is of bacterial, filamentous fungal or yeast origin.

3. The kit according to claim 2, wherein the nucleotide sequence of the ENTDP is as shown in SEQ ID No.1, SEQ ID No.5 or SEQ ID No.9, and the amino acid sequence thereof is as shown in SEQ ID No.2, SEQ ID No.6 or SEQ ID No. 10.

4. The kit of claim 1, wherein the β -glucan synthase enzymatic substrate is UDP-glucose.

5. The kit of claim 1, wherein the reagent for determining the phosphate release content of UDP hydrolysis comprises a detection reagent used in ammonium molybdate-ascorbic acid spectrophotometry, phosphomolybdic acid-malachite green spectrophotometry, or ion chromatography.

6. Use of a kit according to any one of claims 1 to 5 for determining the activity of a β -glucan synthase or for determining the amount of phosphate released by hydrolysis of UDP with ENTDP.

7. A method for determining the activity of β -glucan synthase using the kit of any one of claims 1 to 5, the method comprising:

(1) reacting beta-glucan synthetase to be detected with the enzymolysis substrate for 30 min-48 h at the temperature of 25-40 ℃ and the pH value of 4.0-9.0;

(2) adding ectonucleoside triphosphate diphospho hydrolase ENTDP into the reaction solution in the step (1), and reacting for 10 min-2 h under the conditions of temperature of 25-50 ℃, pH of 4.0-9.0 and metal ions of 0.1-2.0 mu mol/mL;

(3) and (3) measuring the content of phosphate released or the consumption of enzymolysis substrate by UDP hydrolysis.

8. The method according to claim 7, wherein in the step (2), the metal ion is added at 35 ℃ and pH7.0 when ENTDP having a nucleotide sequence represented by SEQ ID NO.1 is addedZn²⁺Reacting under the condition of 0.5 mu mol/mL;

adding metal ion Ca at 40 deg.C and pH 8.0 when ENTDP with nucleotide sequence shown in SEQ ID NO.5 is added^{2 +}Reacting under the condition of 1.0 mu mol/mL;

adding metal ion Zn at 30 deg.C and pH 6.0 when ENTDP with nucleotide sequence shown in SEQ ID NO.9 is added^{2 +}Reaction at 0.7. mu. mol/mL.

9. The method of claim 7, wherein the enzyme activity unit of the β -glucan synthase is defined as: the amount of substrate 1nmol UDP-glucose consumed per microgram of β -glucan synthase protein per unit time, or the amount of phosphate released per microgram of β -glucan synthase protein per unit time is 1 nmol.

10. The method according to claim 7, wherein the determination of the phosphate ion content is carried out by determining the content of free phosphate ions released by hydrolysis of UDP by ENTDP using ammonium molybdate-ascorbic acid spectrophotometry, phosphomolybdic acid-malachite green spectrophotometry or ion chromatography.

11. The method as claimed in claim 10, wherein the ammonium molybdate-ascorbic acid spectrophotometry is characterized in that phosphate reacts with ammonium molybdate and potassium antimony tartrate under acidic condition to generate phosphomolybdic heteropoly acid, the phosphomolybdic heteropoly acid is reduced by ascorbic acid, the absorbance of the phosphomolybdic heteropoly acid is measured at 700nm, and the content of released free phosphate ions is calculated according to an established standard curve.

12. The method as claimed in claim 10, wherein the phosphomolybdic acid-malachite green spectrophotometry is characterized in that phosphomolybdic acid heteropoly acid association compound is formed by phosphate and molybdate under acidic condition, weak bond chromogenic compound is formed by the phosphomolybdic acid association compound and malachite green, the absorbance is measured at 620nm, and the content of released free phosphate ions is calculated according to the established standard curve.

13. The method according to claim 10, wherein the ion chromatography is carried out using an anionic chromatography column, eluting with a strongly basic solution, detecting with a conductivity detector, and quantifying the amount of free phosphate ions released by external standards, qualitatively based on retention time.

Images