CN114480402B

CN114480402B - Novel HER2DNA aptamer and preparation method and application thereof

Info

Publication number: CN114480402B
Application number: CN202111267773.2A
Authority: CN
Inventors: 段维; 向颂喜
Original assignee: Shanghai Wanheyuan Biotechnology Co ltd
Current assignee: Shanghai Wanheyuan Biotechnology Co ltd
Priority date: 2021-10-29
Filing date: 2021-10-29
Publication date: 2023-11-21
Anticipated expiration: 2041-10-29
Also published as: CN114480402A

Abstract

The invention relates to the field of C12N15/115, in particular to a novel HER2DNA aptamer, and a preparation method and application thereof. The HER2DNA aptamer is composed of DNA, has smaller volume than protein, can have sensitivity comparable to antigen-antibody reaction after SELEX screening enrichment, has extremely high sensitivity in a breast cancer liquid biopsy system, and can detect 1 HER2 positive exosome from 1000 HER2 negative exosome at the minimum.

Description

Novel HER2DNA aptamer and preparation method and application thereof

Technical Field

The invention relates to the field of C12N15/115, in particular to a novel HER2DNA aptamer, and a preparation method and application thereof.

Background

Tyrosine kinase receptor 2 (erbB-2), also known as HER2, is a member of the EGFR family of receptor tyrosine protein kinases. Typically, due to HER2 overexpression, the receptor heterodimers with other members of the EGFR family, resulting in autophosphorylation of tyrosine residues within the cytoplasmic domain of the heterodimer and initiating various signaling pathways, leading to cell proliferation and tumorigenesis.

HER2 targeted therapies are effective on breast cancer women carrying HER2 overexpression and/or amplification. Trastuzumab is the first anti-HER 2 monoclonal antibody developed in 1990, which can interfere with HER2 signaling. In 2001, researchers found that trastuzumab improves overall survival in HER 2-positive metastatic breast cancer women following chemotherapy, and subsequently in 2005 trastuzumab was used as an adjunctive treatment for early disease women with positive results. Thus, trastuzumab has been the standard treatment regimen for the treatment of metastatic and early stage HER2 positive breast cancer for over a decade.

Notably, the addition of trastuzumab to first-line chemotherapy can improve the overall survival of HER2 positive gastric cancer patients and is the standard treatment for this group of patients. However, assays involving pertuzumab, lapatinib, and T-DM1 fail to significantly improve prognosis for HER2 positive gastric cancer patients. HER2 targeting agents have also been tested for efficacy in other HER2 overexpressing, and/or HER2 mutating tumors, including biliary tract, colorectal, non-small cell lung and bladder cancers.

There is new evidence that the benefits obtained by some patients from these additional therapies are not sufficient to offset the associated toxicity and/or cost penalty. Inconsistencies in the results of conventional HER2 immunohistochemistry can prevent patient prognosis and improved efficacy. Current treatment strategies can help up to 99% of breast cancer patients reach five-year survival. But for those patients who have metastasized at diagnosis, their five-year survival rate is still less than 30%. Targeting drugs have achieved remarkable clinical success in recent years, but these new drugs cause various degrees of side effects and therapeutic resistance inevitably occurs. Thus, a new approach is needed to alter these limitations of current treatment regimens, bringing new promise to oncology patients.

One of the primary challenges is to develop a molecular approach to distinguish between those patients who may benefit from HER 2-targeted therapy and those who need chemotherapy or require additional therapy. Future precision medicine will adjust the treatment regimen based on the genetic, biological, and clinical characteristics of each patient's tumor. Biomarkers with prospective predictability can help clinicians identify those patients who may benefit from escalation or downgrade therapy, which is important for the designation of clinical protocols.

Extracellular vesicles (exosomes) are nanoscale (30-150 nm) disc-shaped vesicles in humans, and many types of cells secrete exosomes. There is growing evidence that Extracellular Vesicles (EVs) play a key role in the pathogenesis of some tumors, such as breast, lung, prostate and liver cancers, cell proliferation, angiogenesis, tumor metastasis and drug resistance. In HER2 positive tumors, exosomes secreted by tumor cells may trigger acquired resistance of HER2 targeted drugs. Clinical evidence shows that the exosome removal can reduce exosome interference and drug resistance, and can be used for improving the curative effect of conventional drugs.

Thus, HER2 positive tumor patients are in great need of a sensitive exosome-based liquid biopsy technique to facilitate clinical guidance of biomarkers for accurate treatment of individuals.

Disclosure of Invention

In a first aspect the invention provides a novel HER2 DNA aptamer having the nucleotide sequence:

sequence 1:5'-CGTTACGCCCTGCCACTTGAAGATTGACCATTAAGAGCTA-3'

Sequence 2:5'-AAAAGATCCCCACCCATCACCGTCACCTCCATTGGCTGCG-3'

Sequence 3:5'-CTACACTCCAGTGGGCAGGACGGTAATCACCCGATAGGGC-3'

Sequence 4:5'-GTTACTCCAGAACCTCCCGGGGTCGCACGAACAGAGCTTC-3'

Sequence 5:5'-ACAACTCACCATTTCCTCCTCGCCCGTGCACGTTCAGTTC-3'

Sequence 6:5'-TTTTTCGGTTGTCGGTAAAATAATAAACTGTTCGCGTTCC-3'

Sequence 7:5'-GGCACTGACCTCAACTTTCCTTTCCTTTACCCGAGCCCTC-3'

Sequence 8:5'-GTTATCTCCAGCCGTTGCGCACGAACCATAAGGTCTCCTA-3'

Sequence 9:5'-CTTTCCATCACCAGCATCCCAGCCCTAAGAAAAAGCGATC-3'

Sequence 10:5'-CTAACTCAGCCCAAAAGCTGCACCCTCTCTCTTACCGTTC-3'

Sequence 11:5'-TCCGGACTGCAGAGACCGGGAGGATCCCTACTATTTGTGA-3'

Sequence 12:5'-CAAATCCCCGTACCTCCGAGCTGTCCGTCCAAGGAATCAT-3'

Sequence 13:5'-GTACTTACGTCTTTTTGTCCCCGAACAGAAGTTCTCACCA-3'

Sequence 14:5'-GGCAACCGCATCCATCATCCACCTAAAACTCCCTCGTGTA-3'

Sequence 15:5'-CGGTTGCTCTCACCAGATTTCCTTTACTCCCTTTACCTTC-3'.

In a second aspect the invention provides a novel HER2 DNA aptamer having a nucleotide sequence that satisfies at least one of the following conditions:

(1) Homology to the nucleotide sequence of the aptamer provided in the first aspect of the invention is above 60%;

(2) A nucleotide sequence which hybridizes to a nucleotide sequence of an aptamer provided in the first aspect of the invention;

(3) The nucleotide sequence of the aptamer provided in the first aspect of the invention is transcribed into an RNA sequence.

In a third aspect, the invention provides a method for preparing a novel HER2 DNA aptamer, comprising the steps of:

(1) Screening target HER2 DNA aptamer;

(2) Modification and optimization of HER2 DNA aptamer;

(3) Co-incubating the HER2 DNA aptamer with a cell naturally expressing HER 2;

(4) Constructing a HER2 gene knockout cell line;

(5) Verification of HER2 DNA aptamer specificity;

(6) In vitro analysis of HER2 DNA aptamer.

As a preferred embodiment, the method of screening in step (1) comprises SELEX technology.

Applicants enriched for HER2 aptamer sequences using commercially available cells overexpressing recombinant human HER2 protein as target material based on the cell-based SELEX technique. The major disadvantage of protein-based SELEX technology is that recombinant proteins may not have the conformation of the native protein. In view of this, applicants used recombinant HEK293T cells overexpressing HER2 as target cells, and utilized cell SELEX to facilitate further enrichment of HER2 aptamer sequences. These enriched DNA sequences are capable of binding to the extracellular structure of HER2 protein, which retains its native conformation. Thus, applicants determined that selected HER2 aptamers were able to successfully bind to the extracellular structure of native HER2 proteins expressed on the cell membrane or on the exosome membrane.

The different expression levels of HER2 obtained by flow cytometry analysis by applicant showed that the different HER2 expression patterns were all suitable for the preliminary HER2 aptamer screening in our SELEX. The first round of target aptamers against human HER2 screened by cell SELEX total 15.

As a preferred embodiment, the number of nucleotides of the HER2 DNA aptamer modified and optimized in step (2) is 6-12.

Preferably, the number of nucleotides of the HER2 DNA aptamer modified and optimized in step (2) is 12.

After the first round of aptamer screening in step (1), applicant modified and optimized the shorter 6 second generation HER2 aptamers therein. Through a large number of analysis and detection, HER2-OTD-2-1 series derived aptamer is combined with HER2 high-expression cells strongly. In the second transformation, point mutation, cutting and other molecular engineering transformation are carried out on the 2-level structure of the HER2-OTD-2-1 series derivative aptamer, and finally, 3 new varieties of HER2-OTD-2-1 series aptamers are obtained. Finally, a third round of molecular engineering was performed on the HER2-OTD-2B aptamer. These 6 derived aptamers of the engineered HER2-OTD-2-1 series are only 12 nucleotides, which is the shortest nucleic acid aptamer so far.

As a preferred embodiment, the HER2 DNA aptamer is pre-incubated in an aqueous solution of sodium azide for 0.5-1.5h at low temperature prior to the co-incubation in step (3).

Preferably, the HER2 DNA aptamer is pre-incubated in an aqueous sodium azide solution with a mass concentration of 0.2% for 1h at 0 ℃.

Applicants used human breast cancer cells (SKRB 3) known to express HER2 at high levels and human breast cancer cells (MDA-MD-231) known to express HER2 at medium and low levels. Applicants' test subjects also included human B lymphocyte-like cells (Raji) that expressed HER2 and human T cell leukemia cell lines (CEM) that did not express HER 2.

All of the above cells need to be incubated in 0 ℃ solution of 0.2% sodium azide for one hour to block nonspecific endocytosis before being mixed with the aptamer for incubation. Under such experimental conditions, the aptamer can only bind to the extracellular structure of HER 2. Since in flow cytometry at least 10000 cells are detected for detecting a positive fluorescent signal, the average fluorescence intensity detected per cell line should be proportional to the known expression levels of HER2 protein of these cell lines. In fact, both the aptamer HER2-OTD-2A and the aptamer HER2-OTD-2B bind specifically and quantitatively to these 4 human cell lines.

As a preferred embodiment, the construction of the gene knockout cell line in step (4) comprises CRISPR-Cas9 technology.

The specificity of many of the antibodies for research and therapy in the prior art has not been verified. The gold standard for verifying the relationship of affinity ligands to human proteins is to use cell lines encoding the target protein that are knocked out. Thus, the applicant selected the standard CRISPR genome editing technique to construct a HER2 knockout MDA-MD-231 cell line.

The MDA-MB-231KO cell line used in the experiments was constructed using the CRISPR-Cas9 technique. We designed two sgRNAs (No. 1, TTCCAGAAGATATGCCCCGG and No. 2, GAGAGGGGAAGCGGCCCTAA) to knock out targeting erb-B2 tyrosine kinase receptor 2 (HER 2) (ENSG: 00000141736).

HER2 sgRNA1 cleaves 3bp downstream of the ATG of transcript 204, 673bp upstream of the ATG of transcripts 218, 201, 203, 7441bp upstream of the ATG of transcripts 205, 219, 202.

HER2 sgRNA2 was cleaved 348bp downstream of the stop codon of HER2 transcripts 204, 219, 202, 201, 203 and 695bp downstream of the stop codon of HER2 transcript 218.

These sgRNAs were synthesized as gRNA double-stranded with tracrRNA, applicant used Lipofectamine CRISPRMAX to transfect MDA-MB-231 cells with Cas 9-GFP. GFPhigh cells were split into 96-well plates by FACS and cultured in DMEM medium containing 10% fetal bovine serum and 5U/ml penicillin-streptomycin. Viable single clones were screened by KO-specific and WT-specific PCR. Homologous KO clone cells positive for KO PCR and negative for WT PCR were amplified and further identified, and KO PCR products were sequenced to confirm the expected genomic DNA deletion. Sequencing of the HER 2-KOCCR product revealed the presence of a 28826-28827bp (28811 bp) deletion in the genome. RT-PCR using primers MG57RT-PCRup (5'-CGTGCTCATCGCTCACAACC-3') and MG57RT-PCR Down (5'-GCATCGCTCCGCTAGGTGTC-3') confirmed the absence of HER2 transcription, these primers encompassing HER2-cDNA starting from exon 3 and ending with exon 18.

In the experiments the present invention used MDA-MD-231HER2 knockout clone #161 to verify the specificity of the aptamer. Flow cytometric analysis demonstrated that no HER2 protein expression was found in clone #161, which was MDA-MD-231HER2 knock-out, while we used two positive controls to demonstrate the stability of the assay.

As a preferred embodiment, the MDA-MD-231 cell line constructed in step (4) is used in step (5) to verify the specificity of the HER2 DNA aptamer.

There are many studies in the prior art on aptamers to human HER2, however, the specificity of these HER2 aptamers has not been determined.

To address this problem, applicants used HER2 knockout cells to assess whether the prepared aptamer actually binds to the extracellular structure of human HER 2. Experiments prove that the incubation of the HER2-OTD-2A aptamer and the cells generates very high fluorescence intensity in SKRB3 cells, generates medium fluorescence intensity in wild MDA-MD-231 cells, and does not have fluorescence signals exceeding background noise in HER2 gene knockout cells. The data of the present invention have established that DNA aptamers to HER2 not only bind to the extracellular structure of HER2 with precise specificity, but also quantitatively interact with HER 2.

As a preferred embodiment, the in vitro analysis in step (6) uses washed exosomes.

The exosomes used in the present invention were collected in DMEM plus 0.5wt% of bovine serum cell culture supernatant from which the exosomes were removed and isolated using standard ultracentrifugation methods.

Since the international gold standard for particle tracking analysis for determining the size and size distribution of exosomes actually detects particles rather than vesicles, the applicant performed detergent lysis to determine the true number of exosomes since exosomes are easily lysed by 0.5% triton x-100. Test data show that after the exosomes are treated with detergent, the total particle count is significantly reduced and the whole size distribution curve shifts to the left. Thus, exosomes prepared from three cell lines (SKRB 3, wild-type MDA-MD231 and HER2 knockout MDA-MD-231) all had the extracellular marker protein CD81. Importantly, the exosomes released by these three cell lines showed different levels of HER2 expression, matching the levels of HER2 protein in the cells from which they were derived.

A major technical resistance to the use of exosomes as a source of liquid biopsies is the large number of exosomes produced by normal cells and tissues in the systemic circulation. This results in the dilution of small amounts of exosomes from the tumor on the one hand by large amounts of exosomes produced by normal cells, and on the other hand small vesicles produced by these tumors can become intermixed in the background of other solid elements in the systemic circulation, such as blood cells, tumor cells, lipoproteins, and cell free proteins and nucleic acids. Thus, in order to isolate exosomes of a target lesion from other solid components in the blood, to detect exosome-based biomarkers, a great effort in sample processing is required.

Patients with increased numbers of exosomes in breast cancer are reported to be associated with treatment failure. Careful study in laboratories around the world using different methods and/or instruments over the past decade has shown that the total concentration of normal human exosomes is about 10 in the systemic circulation ⁹ -10 ¹⁰ Individual exosomes/ml. The half-life of exosomes in blood is reported to be about 10 minutes. Recently, clinical researchers from germany and brazil conducted a nationwide study of blood levels of breast cancer exosomes, and found that the exosomes concentrations of breast cancer patients were 40-fold higher than healthy females. In addition, another clinical study by italian and american clinicians on brain tumor patients found an approximately 3-fold increase in total exosomes in glioblastoma patient plasma compared to normal. Clearly, the increased number of exosomes observed in cancer patients is highly unlikely to be all derived from cancer cells.

Based on the dynamic results in the clinical studies described above regarding the number of exosomes in systemic circulation, and assuming that all observed increases in exosomes in the blood of cancer patients are due to enhanced exosome production by cancer cells. The present invention herein investigated whether HER2 aptamer was able to detect HER2 positive exosomes in a simulated clinical environment, total exosome concentration of 1X10 ¹⁰ Exosomes/ml, ratio of cancer marker positive exosomes to cancer marker negative exosomes is 1:3, since the total number of exosomes in the circulation is so high, our goal is to detect HER2 positive exosomes in the exosome mixture without prior isolation or isolation of the target cancer biomarker positive exosomes.

Applicants have a concentration of 2X 10 per milliliter ¹⁰ Exosome samples were prepared at a concentration such that total exosomes would be exempted by biotinylated monoclonal antibodies against CD81The epidemic was captured on streptomycin coated magnetic beads and CD81 was a universal exosome biomarker. The presence of cancer biomarker positive exosomes from SKRB3 will be detected by flow cytometry with a fluorescently labeled HER2 inducer.

To prepare an analyte (extracellular vesicle sample) that mimics a cancer patient's plasma exosome sample, applicants performed continuous titration of HER2 positive SKRB3 extracellular vesicles with HER2 negative HER 2-knockout extracellular vesicles, pooling the two extracellular vesicles at a prescribed ratio of 1:500 to 1:5000. Prior to detection of HER2 exosomes using the HER2 aptamer we newly developed by the applicant, the applicant confirmed capture of exosomes by staining the exosome-CD 81 antibody-magnetic bead pairing with PE-labeled CD9 antibody, which is another widely used exosome biomarker.

The biotin-CD 81-streptavidin-bead complex is able to capture 98% of exosomes, as determined by anti-CD 9 antibodies, which is one of the key biomarkers of exosomes.

Next, FITC-labeled HER2-OTD-2A aptamer was used as detection ligand to determine the sensitivity and specificity of detecting HER2 positive extracellular vesicles. As a negative control for the potential non-specific interaction of fluorescein itself or FITC-labeled single-stranded DNA with antibodies or magnetic beads, 23-nucleotide ssDNA of FITC-labeled random sequence was used to define the background noise of our system. Due to its high detection sensitivity, flow cytometry analysis was used to detect HER2 positive SKRB3 extracellular vesicles, the background of which is an increasing number of HER2 negative extracellular vesicles (MDA-MD-231 cells from HER2 knockout). In this experiment, we used the percentage of FITC positive beads instead of the median of fluorescence intensity as readout data. As shown in FIGS. 39-40, non-specific interactions of FITC-labeled random DNA aptamers with exosome-bead complexes were minimized. FITC-labeled HER2-OTD-2A aptamer was able to detect samples of a mixture of 1 HER2 positive exosome with 200 HER2 negative exosomes and a 1:500 mixture well with FITC positive cells read out at 3.75% and 2.74%, respectively. For a mixture of 1000 HER2 negative exosomes and 1 HER2 positive exosome, the FITC-labeled HER2-OTD-2A aptamer is capable of labeling at least 0.94% of HER2 positive exosomes in the exosome mixture. Our HER2-OTD-2A aptamer was able to detect large numbers of FITC-positive exosomes-beads at levels well above the systematic noise defined using random DNA aptamers, even at dilutions of 1:1200, 1:1500 or 1:2000. Thus, our breast cancer liquid biopsy system using HER2 aptamer has a sensitivity or lower detection limit of 1 HER2 positive exosomes out of 1000 HER2 negative exosomes.

In a fourth aspect, the invention provides the use of a novel HER2 DNA aptamer in the diagnosis and treatment of breast cancer.

Compared with the prior art, the invention has the following beneficial effects:

1. the HER2 DNA aptamer is composed of DNA, has smaller volume than protein, can have sensitivity comparable to antigen-antibody reaction after SELEX screening enrichment, has extremely high sensitivity in a breast cancer liquid biopsy system, and can detect 1 HER2 positive exosome from 1000 HER2 negative exosome at the minimum.

2. Compared with antigen-antibody reaction, the HER2 DNA aptamer disclosed by the invention is easier to synthesize, better in stability, less susceptible to denaturation caused by environmental factors such as pH, temperature and the like, and relatively low in synthesis price.

3. The HER2 DNA aptamer can be combined with an extracellular structure of HER2, has precise specificity, can perform quantitative interaction with HER2, is a novel high-sensitivity and high-flux nucleic acid aptamer molecular probe detection technology, can be a novel method for searching and finding a molecular marker of malignant tumor, and establishes an effective early-stage tumor early-warning, early-stage diagnosis and target monitoring technology platform.

4. The HER2 DNA aptamer has the advantages of short detection period, good reproducibility, simple and rapid operation and important significance for clinical research of breast cancer.

Drawings

Figure 1 is a western blot analysis of control and HER2 transfected HEK293T cell lines.

FIGS. 2-4 are graphs showing antibody binding activity assays performed using flow cytometer detection techniques.

Fig. 5-6 are histogram graphs of flow cytometer analyses.

Figures 7-10 are representative graphs of the binding signals of HER2-OTD-2B2 aptamer obtained after a third round of experiment.

FIGS. 11-12 are FACS histograms of specific quantitative binding of the aptamer HER2-OTD-2A &2B to cell lines of different HER2 protein expression levels.

FIG. 13 is a bar graph showing the specific quantitative binding of HER2-OTD-2A &2B aptamer to Raji, CEM, HEK293T, MDA-MB-231 and SKBR3 cells.

Figures 14-15 are detailed encoding of HER2 receptor structure and ECD exons.

FIG. 16 is a primer PCR map of exons 3 to 18 of HER2 cDNA.

Fig. 17-20 are representative FACS histograms for detection of antibody binding using a flow cytometer.

FIGS. 21-23 are FACS histograms of HER2-OTD-2A inducer specificity.

Figures 24-32 are feature maps of exosomes for HER2 aptamer function studies.

FIGS. 33-34 are schematic diagrams of affinity capture exosomes on magnetic beads.

FIGS. 35-38 are graphs of analysis of successful exosome capture by CD81 functionalized magnetic beads.

Figures 39-44 are density maps of HER2 positive exosomes.

Detailed Description

Example 1

The first aspect of the present embodiment provides a novel HER2 DNA aptamer, the nucleotide sequence of the aptamer being:

sequence 1:5'-CGTTACGCCCTGCCACTTGAAGATTGACCATTAAGAGCTA-3'

Sequence 2:5'-AAAAGATCCCCACCCATCACCGTCACCTCCATTGGCTGCG-3'

Sequence 3:5'-CTACACTCCAGTGGGCAGGACGGTAATCACCCGATAGGGC-3'

Sequence 4:5'-GTTACTCCAGAACCTCCCGGGGTCGCACGAACAGAGCTTC-3'

Sequence 5:5'-ACAACTCACCATTTCCTCCTCGCCCGTGCACGTTCAGTTC-3'

Sequence 6:5'-TTTTTCGGTTGTCGGTAAAATAATAAACTGTTCGCGTTCC-3'

Sequence 7:5'-GGCACTGACCTCAACTTTCCTTTCCTTTACCCGAGCCCTC-3'

Sequence 8:5'-GTTATCTCCAGCCGTTGCGCACGAACCATAAGGTCTCCTA-3'

Sequence 9:5'-CTTTCCATCACCAGCATCCCAGCCCTAAGAAAAAGCGATC-3'

Sequence 10:5'-CTAACTCAGCCCAAAAGCTGCACCCTCTCTCTTACCGTTC-3'

Sequence 11:5'-TCCGGACTGCAGAGACCGGGAGGATCCCTACTATTTGTGA-3'

Sequence 12:5'-CAAATCCCCGTACCTCCGAGCTGTCCGTCCAAGGAATCAT-3'

Sequence 13:5'-GTACTTACGTCTTTTTGTCCCCGAACAGAAGTTCTCACCA-3'

Sequence 14:5'-GGCAACCGCATCCATCATCCACCTAAAACTCCCTCGTGTA-3'

Sequence 15:5'-CGGTTGCTCTCACCAGATTTCCTTTACTCCCTTTACCTTC-3'.

In a second aspect of this embodiment, a novel HER2 DNA aptamer having a nucleotide sequence that satisfies the following conditions: the nucleotide sequence homology to any of the aptamers provided in the first aspect of the present example is 60% or more.

The third aspect of the present embodiment provides a method for preparing a novel HER2 DNA aptamer, comprising the steps of:

1. screening target HER2 DNA aptamer;

HEK293T cells that overexpress HER2 protein were used as target cells (FIG. 1), and cell SELEX was used to facilitate further enrichment of HER2 aptamer sequences.

The detailed operation steps of the SELEX technique are as follows:

1. buffer and solution

(1) Binding buffer: pH 7.4PBS containing 2.5mM MgCl2+ salmon sperm ssDNA,0.02% Tween 20 and 1mM heparin. Salmon sperm ssDNA was 75 micrograms (corresponding to 3 nmoles of 80nt ssDNA) for the first round, 5 micrograms (corresponding to 0.2 nmoles of 80nt ssDNA) for the second through fourth rounds, and 20 micrograms for each round thereafter.

(2) Washing buffer: pH 7.4PBS contained 2.5mM MgCl2,0.02% Tween 20.

2. First round selection

(1) Initial ssDNA library preparation: mu.L of 100. Mu.M ssDNA library (3 nmol) was added to 600. Mu.L of binding buffer. Mix and heat at 95 ℃ for 10 minutes, then cool denatured ssDNA on ice for 10 minutes.

(2) Preparation of bead/protein complexes: the number of beads required for the first round was calculated. According to the specifications of HER2-Tag Isolation and Pulldown beads used in this protocol, 4. Mu.L (160. Mu.g based on 40 mg/mL) of beads were subjected to the first round of SELEX in combination with 0.1nmol of protein. 500. Mu.L of binding buffer was added to the beads in a 1.5mL Eppendorf tube, the tube was placed on a magnet for 2 minutes and the supernatant was discarded. mu.L of cell lysate containing the overexpressed HER2 marker protein target was prepared with an equal volume of 2 Xbinding buffer and then thoroughly mixed with the beads. The mixture was placed on a roller and incubated for 5 minutes at RT (if the protein is not stable at RT, it may be cooler). The tube was placed on a magnet for 2 minutes and then the supernatant was discarded. The wash was repeated 4 times with 300. Mu.L of wash buffer each.

(3) Incubation of protein baits with random DNA libraries: the bead/protein complexes were resuspended in 600. Mu.L of binding buffer, including 3nmol of random ssDNA library and 1mM heparin in a 1.5mL Eppendorf tube. The mixture was left at RT for 1 hour to achieve good bead suspension. After incubation, the tube was placed on a magnet for 2 minutes and then the supernatant was discarded. The beads were washed 5 times with 500. Mu.L of wash buffer for 5 minutes each. The beads were thoroughly resuspended between each washing step. After the last wash, the bead/protein/ssDNA complexes were resuspended in 100. Mu.L TE buffer for preparation of the PCR assay.

(4) Preparation of PCR1: this step is to determine the optimal number of cycles of PCR required. This step must be performed for each round throughout the SELEX process. PCR1 included a standard PCR reaction, 50. Mu.L/tube, 6 individual tubes (8, 10, 12, 14, 16, 18 cycles each) and one additional negative control (no DNA template).

(5) PCR2 was the next round of SELEX amplified DNA pool: after the optimal number of cycles is determined, amplification PCR will be performed using the same PCR procedure as PCR 1.

(6) ssDNA was isolated by denaturing PAGE gel electrophoresis. The DNA products of PCR2 and PCR1 were pooled together and the volume was reduced to 100. Mu.L at 3000 Xg, 56℃using a Speedvac dryer to facilitate preparation of ssDNA based on denaturing PAGE gels. Next, the concentrated DNA product was mixed with 2 Xformamide-loaded buffer and heated at 95℃for 10 minutes. The denatured samples were then loaded into a 12% 8M urea PAGE gel followed by electrophoresis at a constant power of 25 Watts (one minigel was sufficient to produce 0.2nmol ssDNA product). After size separation of the DNA, the gel was stained in GelStar (TM) solution (1:10,000 dilution) for 15 minutes. The isolated ssDNA stripes can be viewed under a biosafety blue light transmitter. The lower ssDNA inducing strand is then excised from the gel. Gels containing free primers, primer dimer, polyT-antisense strand and non-specific PCR products were discarded.

(7) ssDNA was recovered from the gel by electroelution. Gel sections containing the desired DNA fragments were transferred to 3mL 3.5kDa cut-off dialysis tubing. 3mL of water was poured into the tube, and the tube was then gently closed to avoid air bubbles. The dialysis tubing was run for 20 minutes using a constant voltage of 120V on a support plate in a horizontal electrophoresis tank containing 0.5×tbe buffer. The polarity of the current was reversed by exchanging the electrodes for 1 minute, and the release of the DNA molecules was checked under a blue light transmitter. The run time was adjusted if necessary until all DNA molecules were released from the gel. The dialysis tubing was washed twice with water and the eluate was collected in a 15 ml centrifuge tube. The collected eluate was then concentrated to 400 μl with a vacuum concentrator for high recovery in the next ethanol precipitation. After ethanol precipitation, ssDNA particles were resuspended in DNase-free H2O and quantified by uv absorbance at 260 nm.

The sequence after primary illumination and optimization of the first round of HER2 aptamer is:

sequence 2-1:5'-GGCACCTCCATTGGTGCC-3'

Sequence 5-1:5'-GGAGCCCGTGCTCC-3'

Sequence 6-1:5'-CCACGGTTGTCGTGGC-3'

Sequence 6-2:5'-GCCCCGGTTGTCGGGGC-3'

Sequence 9-1:5'-GCCAGCATCCCAGCTGGC-3'

Sequence 9-2:5'-GGGGGCATCCCAGCCCCC-3'

2. Modification and optimization of HER2 DNA aptamer;

after the first round of aptamer transformation, shorter 6 second generation HER2 aptamers are obtained for modification and optimization. Through a large number of analysis and detection, HER2-OTD-2-1 series derived aptamer is combined with HER2 high-expression cells strongly. In the second round of transformation, point mutation, cutting and equivalent molecular engineering are carried out on the 2-level structure of the HER2-OTD-2-1 series derivative aptamer, and finally, 3 new varieties of the HER2-OTD-2-1 series aptamer are obtained. Finally, a third round of molecular engineering was performed on the HER2-OTD-2B aptamer. These modified HER2-OTD-2-1 series of 6 derived aptamers were only 12 nucleotides, the shortest nucleic acid aptamer so far (FIGS. 7-10).

The specific operation is as follows:

(1) Second round selection

Preparation of ssDNA library: 0.2nmol of ssDNA was resuspended in 500. Mu.l of binding buffer and then denatured as described in (1) in the first round of selection.

Double negative selection: the bead/protein complexes were prepared following the same procedure as described in (2) in the first round of selection, except that cell lysates of the same cell line transfected with unrelated HER2 protein were used. Thereafter, 500 μl of re-annealed ssDNA was added to the negative control protein and incubated on a roller for 1 hour at RT. At the same time, baits of the second tube negative control protein were prepared. After incubation, the tube was placed on a magnet for 2 minutes, then the supernatant was transferred to a tube containing a second negative control protein bait (beads were washed with an additional 250 μl of binding buffer), and incubated for 1 hour at RT. After the second incubation, the ssDNA solution was transferred under a magnet to another tube containing the relevant protein for positive selection. The beads were again washed with 250 μl binding buffer and the supernatant was transferred to a positive selection tube.

Positive selection: the bead/protein complex was prepared following the same procedure as described in (2) in the first round of selection, but using 1. Mu.g of HER2-tag pull down beads (sufficient to bind 25pmol protein). Transfer 1000 μl ssDNA solution from the negative selection tube to the tube containing the protein bait/target and incubate for 1 hour at RT. After incubation, the tube was placed on a magnet for 2 minutes and the supernatant was discarded. The beads were washed 5 times with 500. Mu.L of wash buffer for 5 minutes each. Preparative PCR1 was then performed as shown in (4) in the first round of selection, but 1 μl ssDNA template (eluate) was used in 100 μl PCR reaction. After determining the optimal number of PCR cycles, a 1000. Mu.l PCR reaction was prepared according to step 5, and amplified PCR2 was performed. The gel separation, electroelution, ethanol precipitation and quantification procedure described in steps 6 to 7 were repeated and ssDNA was collected for the next round of SELEX.

The sequence after primary illumination and optimization of the aptamer of the second round of HER2 is as follows:

sequence 2-2:5'-CCTCCATTGG-3'

Sequence 2-3:5'-GCCTCCATTGGC-3'

Sequence 2-4:5'-GGCCTCCATTGGCC-3'

(2) Subsequent rounds of selection

Typically SELEX based on this scheme can be done around round 8 to 12. For the subsequent rounds of selection, the same procedure as shown for the second round was followed, but with the following modifications as the selection proceeded.

1. The amount of protein bait was gradually reduced from 0.1nmol to 0.01nmol.

2. The incubation time of ssDNA pools with targets was gradually reduced from 1 hour to 30 minutes.

3. The washing time and the amount of washing buffer are increased.

4. The number of random sperm ssDNA was gradually increased from an equivalent pool of ssDNA to more than 10-fold.

The sequence after primary modification and optimization of the aptamer of the third round of HER2 is as follows:

sequence 2-3-1:5'-ACCTCCATTGGT-3'

Sequence 2-3-2:5'-GACTCCATTGTC-3'

Sequence 2-3-3:5'-GCCGCCATTGGC-3'

Sequences 2-3-4:5'-GCCTCCGTTGGC-3'

Sequences 2-3-5:5'-GCCTCTATTGGC-3'

Sequences 2-3-6:5'-GCCTCCAGTGGC-3'

3. Co-incubating the HER2 DNA aptamer with a cell naturally expressing HER 2;

to demonstrate that Her2 aptamer specifically binds quantitatively to native Her2 extracellular structure. We used four known different levels of Her2 expressing cells, including high levels of human breast cancer cells (SKRB 3), medium low levels (MDA-MD-231), non-expressing human B-lymphocyte-like cells (Raji) and human T-cell leukemia cell lines (CEM). All cells were incubated with 0.2% sodium azide for one hour at 0 ℃ to block nonspecific endocytosis prior to co-incubation with the aptamer. Under such experimental conditions, the aptamer can only bind to Her2 extracellular structure. In flow cytometry, the fluorescence signal of one cell is measured for at least 10000 cells, so the average fluorescence intensity detected for each cell line should be proportional to the known expression levels of these cell surface Her2 proteins. In fact, as shown in FIGS. 5 and 6, the aptamer Her2-OTD-2A and the aptamer Her2-OTD-2B both bind specifically and quantitatively to these 4 human cell lines.

After labeling the aptamer with highest affinity with FITC fluorescent groups, the aptamer is respectively incubated with human breast cancer cells (SKRB 3) with high Her2 expression level, human B lymphocyte-like cells (Raji) with low Her2 expression level and human T cell leukemia cell line (CEM) cells without Her2 expression level, the binding capacity of the aptamer to the cells is monitored by a flow cytometer, and the binding specificity of the aptamer to target cells is analyzed.

The specific experimental process is as follows:

cells were harvested by trypsinization at 80% growth, and resuspended in Dulbecco's PBS (DPBS) containing 5mM MgCl 2. After centrifugation (1000 g for 5 min), the pellet was resuspended in detection buffer (DPBS with 5mM MgCl2, 0.1mg/mL salmon sperm DNA, 0.2% [ w/v ] sodium azide and 5% FCS) and diluted to 1X106/mL. All cells were incubated for one hour at 0℃in the presence of 0.2% sodium azide to block nonspecific endocytosis prior to incubation with the aptamer. Binding of the aptamer was performed at 37 degrees celsius for 30 minutes or at 4 degrees celsius for 1 hour with a final concentration of magnesium chloride of 2.5mM in the binding experiment.

To confirm the binding of the aptamer to the target protein, several rounds of DNA were repeated with FITC at the 3' end. Briefly, DNA was oxidized by sodium periodate. Oxidation was stopped by adding 10mM ethylene glycol and then precipitated with ethanol. FITC was then added in 30 molar excess and the reaction was completed overnight at 4 ℃. Fluorescein isothiocyanate-labeled DNA (1. Mu.M) was incubated with pancreatin SKRB3, MDA-MD-231, raji and CEM cells in 100. Mu.l binding buffer (DPBS containing 5mM MgCl2 and 0.1mg/mL salmon sperm DNA) for 1 hour on ice, then washed three times and resuspended in 300. Mu.l detection buffer. Fluorescence intensity was measured with a flow cytometer, counting 10000 events per sample. FITC-labeled DNA from Her2 knocked-out MDA-MD-231 cells was used to determine non-specific binding.

The binding intensity was calculated for each round after subtracting the average fluorescence intensity of the zero-round DNA binding to the target cells and the average fluorescence intensity of the negative control cells. Dead cells were gated and excluded from analysis by staining with 2.5 μg/mL propidium iodide and 0.5mg/mL DNase A in PBS. The results show that: incubation of Her2-OTD-2A aptamer with cells produced very high fluorescence intensity in SKRB3 cells, medium fluorescence intensity in wild-type MDA-MD-231 cells, but no fluorescence signal exceeding background noise in Her2 knockout cells, the average fluorescence intensity detected per cell line should be proportional to the known expression level of Her2 protein on the surface of these cell lines.

(1) Constructing a HER2 gene knockout cell line;

two sgRNAs (No. 1, TTCxxxxx and No. 2 gagxxxx) were pre-designed to knock out targeting erb-B2 tyrosine kinase receptor 2 (HER 2) (ENSG 00000141736): HER2 sgRNA1 cleaves 3bp downstream of the ATG of transcript 204, 673bp upstream of the ATG of transcripts 218, 201, 203, 7441bp upstream of the ATG of transcripts 205, 219, 202. HER2 sgRNA2 was cleaved 348bp downstream of the stop codon of HER2 transcripts 204, 219, 202, 201, 203 and 695bp downstream of the stop codon of HER2 transcript 218. sgRNAs were synthesized as a gRNA duplex with tracrRNA (purchased from Integrated DNA technologies).

MDA-MB-231 cells (purchased from Invitrogen, cat#CMAX105) were plated with Lipofectamine CRISPRMAX (purchased from InvitrogenHTB-26 ^TM ) Transfected with Cas9-GFP (purchased from Integrated DNA technologies). GFP high cells were split into 96-well plates by FACS and cultured in DMEM medium (purchased from GIBCO, cat # 10569044) containing 10% fetal bovine serum and 5U/ml penicillin-streptomycin.

4. Verification of HER2 DNA aptamer specificity;

the invention uses Her2 gene knockout cells to verify the specificity of Her2 aptamer. In the literature, there are at least 19 published aptamers against human Her2 (PMID: 27213406, 22817844, 29499944, 27213406, 31137893, 28224267, 24379664, PMID:23630281, 31044282, 25365825, 31134823, 31213813, 30229394, 28122449, 31914433,Sensors and Actuators B186 (2013) 446-450). However, the specificity of these Her2 aptamers has not been confirmed. Because none of these published Her2 aptamers used Her2 knockout cells to verify their specificity. Here we used the final gold standard, her2 knockout cells, to assess whether our aptamers were truly able to bind to the extracellular structure of human Her 2. As shown in FIGS. 21-23, the Her2-OTD-2A aptamer, when incubated with cells, produced very high fluorescence intensity in SKRB3 cells, medium fluorescence intensity in wild-type MDA-MD-231 cells, but no fluorescent signal exceeding background noise was found in Her2 knockout cells. Taken together, the data presented in FIGS. 11-23 have clarified that Her2 DNA aptamers of our invention not only bind specifically to the extracellular structure of Her2, but also have a quantitative effect.

Her2 aptamer specificity was verified using Her2 knockout cells. In the literature, there are at least 19 published aptamers against human Her2 (PMID: 27213406, 22817844, 29499944, 27213406, 31137893, 28224267, 24379664, PMID:23630281, 31044282, 25365825, 31134823, 31213813, 30229394, 28122449, 31914433, sensor and actuator B186 (2013) 446-450). However, the specificity of these Her2 aptamers has not been determined, as none of these published Her2 aptamers uses Her2 knockout cells to verify their specificity. Here we used the final gold standard, her2 knockout cells, to assess whether our aptamers actually bound to the human Her2 extracellular structure. The procedure is as above, and incubation of Her2-OTD-2A aptamer with cells produced very high fluorescence intensity in SKRB3 cells, moderate fluorescence intensity in wild-type MDA-MD-231 cells, but no fluorescent signal exceeding background noise in Her2 knockout cells. Taken together, the data presented in FIGS. 11-23 have clarified that our DNA aptamer to Her2 not only binds to the extracellular structure of Her2 with precise specificity, but also quantitatively interacts with Her 2.

5. In vitro analysis of HER2 DNA aptamer.

The present invention uses exosomes to study the binding of Her2 aptamers. The exosomes were collected from the cell conditioned medium of the indicated cells (DMEM plus 0.5% explant castrated bovine serum) and isolated using standard ultracentrifugation. Gold standards of national particle tracking analysis were used to determine the size and size distribution of these exosomes, but the standards actually detected particles rather than vesicles. We calculated after the exosomes were lysed with 0.5% Triton X-100 wash to determine the actual exosome numbers. As shown in fig. 24-32, after treatment of exosomes with detergent, the total particle count was significantly reduced and the overall size distribution pattern shifted to the left. Thus, vesicles prepared from three cell lines (SKRB 3, wild-type MDA-MD231 and Her2 knocked-out MDA-MD-231) all had the extracellular marker protein CD81. Importantly, the exosomes released by these three cell lines showed different levels of Her2 expression, consistent with the level of Her2 protein in the cells from which they were derived.

Extracellular vesicles were collected from the cell culture conditioned medium of the indicated cells and isolated using standard ultracentrifugation methods.

Cell culture: cell culture was prepared with extracellular vesicle-removed FBS (extracellular vesicle-removed FBS was prepared by centrifuging 100000g of FBS at 4 ℃ for 16 hours, then collecting supernatant and filtering through a 0.22 μm filter (Millipore, billerica, MA, USA)). Three cell lines (SKRB 3, wild-type MDA-MD231 and HER2 knocked-out MDA-MD-231) were used to prepare extracellular vesicles.

Extracellular vesicle isolation: to isolate extracellular vesicles, conditioned medium of cells was first collected, cultured with 10% extracellular vesicle-supplemented FBS medium for 48 hours, and then supernatant was continuously centrifuged at 4 ℃ for 300g for 10 minutes and 2000g for 10 minutes, and filtered through a 0.22 μm filter (Millipore). The filtrate was then ultracentrifuged at 4 degrees celsius for 90 minutes and the extracellular vesicle particles resuspended in PBS filtered with a double 0.22 μm membrane. Extracellular vesicle protein concentrations were determined using the Bradford protein assay (Bio-Rad, hercules, CA, USA).

Extracellular vesicle samples were prepared at a concentration of 2 x 1010 per milliliter, and total extracellular vesicles would be immunocaptured onto streptomycin coated magnetic beads by biotinylated monoclonal antibodies against CD81, a common extracellular vesicle biomarker. The presence of cancer biomarker positive extracellular vesicles from SKRB3 will be detected by flow cytometry with a fluorescently labeled HER2 aptamer. Extracellular vesicles prepared from three cell lines (SKRB 3, wild-type MDA-MD231 and HER2 knock-out MDA-MD-231) all had the extracellular marker protein CD81. Importantly, the extracellular vesicles released by these three cell lines showed different levels of HER2 expression, matching the level of HER2 protein in the cells from which they were derived.

To prepare an analyte mimicking a cancer patient plasma extracellular vesicle sample (extracellular vesicle sample), HER2 positive SKRB3 extracellular vesicles were titrated serially with HER2 negative HER 2-knockout extracellular vesicles, and the two extracellular vesicles were pooled at a ratio of 1:500 to 1:5000. The capture of extracellular vesicles was confirmed by staining the extracellular vesicle-CD 81 antibody-magnetic bead pairing with PE-labeled CD9 antibody, CD9 antibody being another widely used extracellular vesicle biomarker, before HER2 extracellular vesicles were detected using HER2 aptamer we newly developed. The biotin-CD 81-streptavidin-bead complex is able to capture-98% of extracellular vesicles, as determined by the anti-CD 9 antibody, which is one of the key biomarkers of extracellular vesicles.

Next, FITC-labeled HER2-OTD-2A aptamer was used as detection ligand to determine the sensitivity and specificity of detecting HER2 positive extracellular vesicles. As a negative control for the potential non-specific interaction of fluorescein itself or FITC-labeled single-stranded DNA with antibodies or magnetic beads, 23-nucleotide ssDNA of FITC-labeled random sequence was used to define the background noise of our system. Due to its high detection sensitivity, flow cytometry analysis was used to detect HER2 positive SKRB3 extracellular vesicles, the background of which is an increasing number of HER2 negative extracellular vesicles (MDA-MD-231 cells from HER2 knockout). In this experiment, we used the percentage of FITC positive beads instead of the median of fluorescence intensity as readout data.

In a fourth aspect, the present embodiment provides the use of a novel HER2 DNA aptamer in the diagnosis and treatment of breast cancer.

Performance testing

Western blot analysis of control and HER2 transfected HEK293T cell lines: cells were transfected with 4 μg HER2 plasmid and protein extracted by lysis with pre-chilled RIPA buffer after 24 hours. 10ug of protein was then loaded in each lane of a 10% SDS-PAGE gel and transferred to nitrocellulose membranes and detected with anti-HER 2 antibody (1:500,Sino biologicals,Cat No: 310185-T40, secondary antibody, goat anti-mouse, HRP-tag, thermo Fisher, cat No.: 31430). Beta-actin antibodies (1:5000, ABCAM, cat No.: ab 6276) were also used as reference. The results are shown in FIG. 1.

Antibody binding Activity assay: flow cytometry detection techniques were used, wherein a: FACS histograms describe the fluorescent signal generated upon binding of the antibody to HEK293T (Sino Biological, cat No.: HG 10004-NH) cells transfected with HER2 cDNA. B: FACS histogram describes the fluorescent signal generated after binding of the antibody to HEK293T (non-transfected) living cells (primary antibody, secondary antibody Brilliant Violet 510, as described above) ^TM Donkey anti-mouse IgG, biolegend, cat No.: 406419). C: FACS histograms describe the fluorescent signal generated after binding of the antibody to SKBR3 living cells that naturally overexpress HER 2. The red dashed line represents the baseline threshold, the true positive signal generated upon label binding. The X-axis of the histogram represents the intensity of the signal emitted upon binding, and the Y-axis represents the number of positive/negative cells obtained from the target cell population. The results are shown in FIGS. 2-4.

The flow cytometer was analyzed as a histogram to evaluate the degree of enrichment of the Round-10 HER2 ssDNA library. A: representing the binding signal of a living cell after mixing the wild HEK293T cells with the Round-10 HER2 ssDNA library; b: represents the viable cell binding signal of HEK293T cells over-expressed in HER2 mixed with the Round-10 HER2 ssDNA library. All data were collected by BD FACSCanto II. The red dotted line represents the baseline threshold and the right side of the dotted line represents the true positive signal generated after binding. The X-axis of the histogram represents the intensity of the signal emitted upon binding and the Y-axis represents the number of positive/negative cells from the target cell population. The final concentration of the aptamer for the binding activity assay was 800nM. The results are shown in FIGS. 5-6.

The HER2-OTD-2B2 aptamer and the mutant derivative obtained after the third experiment exhibited different binding affinities. A: the binding signals of HER2-OTD-2B and the mutant derivative HER2-OTD-2- (A-G) with HEK293T living cells, fluorescently labeled with Quasar 670, represent a graph. B: the binding signals of HER2-OTD-2B and the mutant derivative HER2-OTD-2- (A-G) labeled with the Quasar 670 fluorophore to SKBR3 living cells are representative. The dashed line represents the baseline threshold, the right side shows the true positive signal generated after binding. The X-axis of the histogram represents the intensity of the signal emitted upon binding, and the Y-axis represents the number of positive/negative cells obtained from the target cell population. The final concentration of the aptamer for the binding activity assay was 800nM. The results are shown in FIGS. 7-10.

The aptamer HER2-OTD-2A &2B binds specifically and quantitatively to cell lines with different HER2 protein expression levels. A: overlapping FACS histograms demonstrate the binding of HER2-2-a-R2 variation to cell membranes at different HER2 protein expression levels. B: overlapping FACS histograms demonstrate the binding of HER2-B-R2 variation to cell membranes at different HER2 protein expression levels. The dashed line represents the baseline threshold, the right side shows the true positive signal generated after binding. The X-axis of the histogram represents the intensity of the signal emitted upon binding, and the Y-axis represents the number of positive/negative cells obtained from the target cell population. The final concentration of the aptamer for binding activity assay was 800nM. The results are shown in FIGS. 11-12.

The bar graph shows the specific quantitative binding of HER2-OTD-2A &2B aptamer to Raji, CEM, HEK293T, MDA-MB-231 and SKBR3 cells. MFI refers to the median intensity of the fluorescent signal generated when each cell type is bound to an aptamer. The final concentration of the aptamer in all binding activity assay studies was 800nM. The results are shown in FIG. 13.

HER2 gene knockout was designed using CRISPR-Cas9 technology. A: HER2 receptor structure and ECD exons are encoded in detail for HER2 knockout. B: HER2 genotyping: the target sequence is part of exon 17. The results are shown in FIGS. 14-15.

PCR detection showed no HER2 expression in all 6 homologous KO clones. RT-PCR was performed using primers covering exons 3 to 18 of HER2 cDNA: one 1871bp band was present in the maternal WT cells and 2 negative control clones transfected with Cas9 alone and without sgRNAs, whereas none of the 6 KO clones. Lane 1: clone #6; lane 2: clone #39; lane 3: clone #81; lane 4: clone #158; lane 5: clone #161; lane 6: clone #245; lane 7, wt; lanes 8 and 9:2 negative control clones transfected with Cas9 alone, without sgrnas; lane 10: negative control without template. Cross-validated RT-PCR results showed no HER2 1871 in lanes 2-7, while positive and negative controls were added in lanes 8-10, respectively. The results are shown in FIG. 16.

a-C: representative FACS histograms of antibody binding were detected using a flow cytometer. The X-axis in the histogram represents the intensity of the signal emitted upon binding, and the Y-axis represents the number of positive/negative cells obtained from the target cell population. D. The net MFI signal generated upon HER2 antibody 2 binding in three different cells, HER2 knockout MDA-MD-231- #161, wild-type MDA-MB-231 cells, and SKBR3 with high levels of HER2 is shown by bar graphs. Alexa was used in this experiment 647 anti-human CD340 (erbB 2/HER-2) antibody (1. Mu.g/ml, biolegend, cat No. 324412). Data shown are mean ± s.d.; n=2, P < 0.05. The results are shown in FIGS. 17-20.

Direct analysis of HER2-OTD-2A inducer specificity based on flow cytometry. C. Representative FACS histograms are the signals when the aptamer HER2-OTD-2A (800 nM) binds to MDA-MB-231-HER 2-knockout- #161 and wild-type MDA-MB-231 and SKBR3 cells, respectively. The results are shown in FIGS. 21-23.

Exosome characterization for HER2 aptamer function studies. a-C: nanoparticle follow-up analysis profile of exosomes enriched by ultrafiltration. A: size and concentration profile of exosome particles from SKBR3 conditioned medium. B: size and concentration profile of exosome particles from MDA-MB-231 conditioned medium. C: size and concentration of exosome particles from HER2 knockout MDA-MD-231- #161 conditioned medium. D-F: nanoparticle follow-up profile of exosome fraction after 10 min treatment of exosome with 0.5% triton X-100 at 4 ℃. G-I: the expression of HER2 in the exosomes was analyzed by flow cytometry using an anti-human HER2 monoclonal antibody from Biolegend (Cat no: 324412). Exosomes were captured using 2×105 10 micron streptavidin coated magnetic Dynabeads (Simerfeier, cat no: 65801D) pre-coated with biotin-labeled CD81 antibody (MyBioSource, cat no: MBS 666563). The results are shown in FIGS. 24-32.

Exosomes were affinity captured on magnetic beads, then stained with antibody/synaptic probes and analyzed by flow cytometry. The results are shown in FIGS. 33-34.

Direct flow cytometry analysis demonstrated the expression of tetravalent protein CD9 to confirm successful capture of exosomes by CD81 functionalized magnetic beads. Exosomes (2×109/100 μl) were captured to 10 micrometer streptomycin-coated magnetic Dynabeads (Thermo Fisher, cat No.: 65801D) by biotin-conjugated CD81 antibody (MyBioSource, cat No.: MBS 666563); and stained with PE-labeled anti-human CD9 antibody (1. Mu.g/ml, bioLegend, cat: 312106). The results are shown in FIGS. 35-38.

Density map representing HER2 positive exosomes. An exosome population probed with FITC-labeled aptamer. The exosomes were immobilized on magnetic beads as shown in fig. 13.A: a pool of serially titrated exosomes was captured and detected with 800nM FITC-labeled negative control DNA aptamer random sequence (5'-AACCAACCAAACCAACAAA-3'). B-C: the density map shows the sensitivity of detection of HER2 biomarker with FITC-labeled HER2-OTD-2A aptamer. Exosome samples included HER2 positive exosomes from SKBR3 and HER2 negative exosomes from HER2 knocked out MDA-MD-231 cells at 1:200 to 1:5000 dilutions. The input exosomes were 2X109 vesicles in 100 microliters, and 800nM of inducer was used in all samples. The results are shown in FIGS. 39-44.

Claims

1. A HER2 DNA aptamer characterized in that the aptamer has the nucleotide sequence:

sequence 1: 5'-CCTCCATTGG-3'

Or (b)

Sequence 2: 5'-GCCTCCATTGGC-3'.