CN114457159A

CN114457159A - Method for detecting tumor cells or tumor cell fragments

Info

Publication number: CN114457159A
Application number: CN202210184310.8A
Authority: CN
Inventors: 唐东江; 王鹏飞; 杨钟林
Original assignee: Zhuhai Livzon Cynvenio Diagnostics Ltd
Current assignee: Zhuhai Livzon Cynvenio Diagnostics Ltd
Priority date: 2022-02-24
Filing date: 2022-02-24
Publication date: 2022-05-10
Anticipated expiration: 2042-02-24
Also published as: CN114457159B

Abstract

The present disclosure relates to a method of detecting tumor cells or tumor cell fragments comprising the use of a tissue non-specific alkaline phosphatase (TNAP) inhibitor. By adopting the method disclosed by the invention, the background value of the white blood cells can be reduced in multiples, the signal value of the tumor cells is unchanged or slightly reduced, the signal-to-noise ratio is obviously improved, and the detection sensitivity of the tumor cells is improved.

Description

Method for detecting tumor cells or tumor cell fragments

Technical Field

The present disclosure belongs to the field of biological detection, and particularly relates to a method for detecting tumor cells or tumor cell fragments, particularly a method for detecting tumor cells or tumor cell fragments by enhancing the detection signal-to-noise ratio.

Background

Circulating Tumor Cells (CTCs) refer to tumor cells that have been shed from solid tumors and enter the blood or lymphatic system, and are often dissociated in body fluids, including blood, saliva, urine, pleural and peritoneal fluid, etc. (fan refers to integrated medicine, world book publishing company, 2019, page 198). Circulating tumor cells in peripheral blood are rare, each milliliter of blood contains about 1-10 CTCs, CTCs are far lower than other types of cells in the blood, the detection of CTCs in the blood is very challenging due to the rare number of CTCs, and the detection difficulty is increased due to the complexity and heterogeneity of CTCs. Because of its rarity, most techniques require an enrichment step prior to detection of CTCs. This requires that the detection method be capable of detecting very few target cells from a large number of non-target cells with high efficiency and accuracy. CTC detection techniques include enrichment (isolation) of CTCs and analytical identification (detection) of CTCs.

The enrichment method of CTCs can be classified into a biochemical characteristic enrichment method (affinity enrichment method) and a physical characteristic enrichment method. Affinity enrichment methods are based primarily on the isolation of target cells by protein biomarkers specifically expressed on the cell surface, including positive enrichment methods for positive CTC capture and negative enrichment methods for negative depletion of leukocytes. However, the affinity enrichment method requires a large amount of antibody and is costly. The physical characteristic enrichment method is mainly used for screening the CTC according to the physical characteristics of the CTC such as size, density, mechanics, dielectric property and the like. Specifically, CTCs are less deformable than blood cells. These physical characteristic enrichment techniques are simple to operate and low in cost, do not depend on the expression of cell surface antigens, and have a large number of captured cells, but are difficult to enrich high-purity CTCs due to the heterogeneity of the physical characteristics of CTCs.

The detection method of CTC mainly adopts immunofluorescence, namely, fluorescent substance is used for marking antibody to perform antigen localization of tumor cells, and then different cells are marked by different fluorescent markers for counting, but CTC in blood samples of tumor patients is rare cells, the number of white blood cells is extremely large, the background is high, and the heterogeneity of tumor cells is added, so that the detection signal of CTC is weak, the efficiency is low, and the signal to noise ratio is low.

Pleural effusion and peritoneal effusion are common clinical manifestations of tumor patients, and the main components of the pleural effusion and peritoneal effusion are cell and protein components infiltrated from blood vessels and inorganic salt ions such as sodium, calcium and the like. Pleural effusion appears in the first diagnosis of a plurality of cancer patients, primary liver cancer is frequently complicated by malignant peritoneal effusion, cytological diagnosis and tumor marker determination are the most common diagnosis methods for malignant pleural effusion at present, but the clinical diagnosis needs cannot be met.

Alkaline phosphatase (ALP or AKP) is an enzyme widely distributed in human liver, bone, intestine, kidney, placenta and other tissues and excreted to the outside of the gallbladder through the liver, can directly participate in phosphorus metabolism, and plays an important role in the processes of calcium and phosphorus digestion, absorption, secretion and ossification. Alkaline phosphatase is not a single enzyme but a group of isoenzymes. Currently known human isoenzymes include: tissue non-specific alkaline phosphatase (TNAP), Intestinal Alkaline Phosphatase (IAP), placental alkaline phosphatase (PLAP) and placental-like alkaline phosphatase (GCAP). Alkaline phosphatase in normal human serum mainly comes from liver and bone, and alkaline phosphatase determination is mainly used for diagnosing diseases of liver, gall and bone systems and is an important index reflecting extrahepatic biliary obstruction, intrahepatic space occupying lesion and rickets.

The alkaline phosphatase heterodimer is highly expressed in tumor tissues of colorectal cancer, breast cancer, hepatocellular carcinoma, cervical cancer and the like. Free alkaline phosphatase heterodimers, exosomes containing alkaline phosphatase heterodimers, or circulating tumor cells can be released into the bloodstream from a primary tumor or metastatic focus. Thus, detection of free alkaline phosphatase heterodimers, exosomes or circulating tumor cells would be useful for early diagnosis and screening of tumors, monitoring recurrence and metastasis of postoperative patient tumors, assessing sensitivity to anti-tumor drugs and patient prognosis, and selecting strategies for individualized treatment.

For example, PCT international application WO2019149115a1 discloses a method of capturing and/or detecting whether a test sample contains alkaline phosphatase-expressing tumor cells (particularly CTCs) by detecting heterodimeric alkaline phosphatase using aptamer BG2 to determine whether the test sample contains alkaline phosphatase-expressing tumor cells. Using aptamer BG2 as a molecular probe, it was possible to detect the overexpression of PLAP-IAP heterodimer on the surface of many cancer cell lines, such as colon cancer, breast cancer, cervical cancer and liver cancer cells (Luyao Shen, et al. However, since this method does not exclude signal interference of leukocytes, the detection signal of CTCs is weak, thereby affecting the detection result.

Therefore, it is urgently needed to develop a new CTC detection method suitable for various body fluids to solve the problems of weak detection signal, low efficiency, low signal-to-noise ratio and the like of CTC in the detection process.

Disclosure of Invention

In order to solve the problems in the prior art, the present disclosure aims to provide a novel method for detecting tumor cells or tumor cell fragments, by which the background value of leukocytes can be reduced exponentially, the signal value of tumor cells is unchanged or slightly reduced, and the signal-to-noise ratio is significantly improved. The tissue non-specific alkaline phosphatase (TNAP) inhibitor can inhibit alkaline phosphatase expressed by leucocytes, reduce detection background noise caused by leucocytes, and improve the detection sensitivity of tumor cells.

In order to achieve the purpose, the following specific schemes are adopted in the disclosure:

in one aspect, the present disclosure provides the use of a tissue non-specific alkaline phosphatase (TNAP) inhibitor for the preparation of a detection reagent or a detection kit for tumor cells or tumor cell fragments in a sample to be tested, or for the preparation of a diagnostic reagent or a diagnostic kit for diagnosing tumors, or for the preparation of a reagent or a kit for increasing the signal-to-noise ratio for the detection of tumor cells or tumor cell fragments in a sample to be tested.

In another aspect, the present disclosure provides a method of detecting a circulating tumor cell, comprising:

(1) obtaining a test sample from a subject;

(2) mixing a tissue non-specific alkaline phosphatase (TNAP) inhibitor, a tumor cell alkaline phosphatase activity detection reagent and the sample to be detected obtained in the step (1) to obtain a mixture;

(3) detecting whether the mixture obtained in step (2) contains alkaline phosphatase activity of the tumor cells, thereby determining or identifying whether the sample to be tested contains tumor cells or tumor cell fragments expressing alkaline phosphatase.

In another aspect, the present disclosure provides a method of enhancing the signal-to-noise ratio of tumor cell or tumor cell fragment detection, the method comprising adding a tissue non-specific alkaline phosphatase (TNAP) inhibitor to a test sample.

In another aspect, the present disclosure provides a detection reagent or a detection kit for detecting tumor cells or tumor cell fragments in a test sample, which comprises a tissue non-specific alkaline phosphatase (TNAP) inhibitor and a reagent for detecting alkaline phosphatase activity of the tumor cells or tumor cell fragments.

Drawings

FIG. 1 shows alkaline phosphatase activity of cells of various tumor cell lines.

FIG. 2 shows the TNAP inhibitor 1 (4-cyano-N- (4-toluene-1-sulfonyl) -L-phenylalanine (C)₁₇H₁₆N₂O₄S)) inhibition of Lovo tumor cells and leukocyte alkaline phosphatase.

FIG. 3 shows the TNAP inhibitor 2(5- ((5-chloro-2-methoxyphenyl) sulfonamide) nicotinamide (C)₁₃H₁₂ClN₃O₄S)) inhibition of Lovo tumor cells and leukocyte alkaline phosphatase.

FIG. 4 shows the inhibitory effect of TNAP inhibitor 3(H-HoArg-OH) on Lovo tumor cells and leukocyte alkaline phosphatase.

Figure 5 shows the use of TNAP inhibitors to increase the signal-to-noise ratio during the capture of tumor cells with aptamers.

Figure 6 shows the application of TNAP inhibitors to increase the signal-to-noise ratio during tumor cell enrichment.

Detailed Description

In the present disclosure, unless defined otherwise, scientific and technical terms used herein have the meanings that are commonly understood by those of skill in the art. Also, protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology related terms, and laboratory procedures used herein are all terms and conventional procedures used extensively in the relevant art. Meanwhile, for better understanding of the present disclosure, definitions and explanations of related terms are provided below.

Herein, the term IC50(half inhibitory concentration) refers to the half inhibitory concentration of the antagonist being measured. It indicates that a drug or substance (inhibitor) is inhibiting half the amount of a biological process (or a substance, such as an enzyme, cellular receptor or microorganism, that is involved in the process).

As used herein, the term "enrichment" refers to the isolation of tumor cells or Circulating Tumor Cells (CTCs) from a test sample.

As used herein, the term "signal-to-noise ratio" is the ratio of the alkaline phosphatase activity of a tumor cell or circulating tumor cell and non-specifically bound leukocytes to the alkaline phosphatase activity of non-specifically bound leukocytes.

Herein, the term "TNAP inhibitor" is an inhibitor of tissue non-specific alkaline phosphatase (TNAP).

Herein, the term "streptavidin" may refer to a protein or peptide that can bind to biotin, and may include: natural egg white avidin (egg-white avidin), recombinant avidin, deglycosylated forms of avidin, bacterial streptavidin, recombinant streptavidin, truncated streptavidin, and/or any derivative thereof.

In one aspect, the present disclosure provides a use of a tissue non-specific alkaline phosphatase (TNAP) inhibitor for preparing a detection reagent or a detection kit for tumor cells or tumor cell fragments in a test sample or for preparing a reagent or a kit for increasing the signal-to-noise ratio of the detection of tumor cells or tumor cell fragments in a test sample.

In some embodiments of the present disclosure, the test sample is blood, saliva, urine, pleural effusion or peritoneal effusion.

In some preferred embodiments of the present disclosure, the sample to be tested is pleural effusion or peritoneal effusion.

In some embodiments of the present disclosure, the tumor cell is selected from one or more of an intestinal cancer cell, a breast cancer cell, a lung cancer cell, a stomach cancer cell, a liver cancer cell, a human placental villus cancer cell, a cervical cancer cell.

In some embodiments of the disclosure, the tumor cell is a human tumor cell.

In some embodiments of the present disclosure, the tumor cell is an alkaline phosphatase expressing tumor cell; preferably tumor cells highly expressing alkaline phosphatase.

In some embodiments of the disclosure, the alkaline phosphatase is an Intestinal Alkaline Phosphatase (IAP), a placental alkaline phosphatase (PLAP), a placental-like alkaline phosphatase (GCAP), or a heterodimer of any thereof.

In another aspect, the present disclosure provides a use of a tissue non-specific alkaline phosphatase (TNAP) inhibitor for the preparation of a diagnostic agent or a diagnostic kit for the diagnosis of tumors.

In some embodiments of the present disclosure, the tumor is selected from one or more of intestinal cancer, breast cancer, lung cancer, gastric cancer, liver cancer, human placental villous carcinoma, cervical cancer.

In some embodiments of the disclosure, the tumor is a human tumor.

In some embodiments of the present disclosure, the tumor is an alkaline phosphatase expressing tumor; preferably a tumor that is highly expressing alkaline phosphatase.

In another aspect, the present disclosure provides a method of detecting tumor cells or tumor cell fragments in vitro, comprising:

(1) obtaining a test sample from a subject;

In some embodiments of the present disclosure, after step (1) and before step (2), the method further comprises the step of (a) enriching the test sample to obtain a test sample with enriched tumor cells or tumor cell fragments.

In some embodiments of the present disclosure, the method of enrichment is selected from one or more of a negative enrichment method, a positive enrichment antibody capture method, a nucleic acid aptamer capture method.

In some embodiments of the present disclosure, the method for detecting alkaline phosphatase activity is selected from one or more of enzyme-linked immunosorbent assay, chemiluminescence assay and single-molecule immunoassay, and the sample to be tested is determined to have alkaline phosphatase activity by detecting absorbance or relative luminescence unit of the mixture, thereby determining or identifying whether the sample to be tested contains tumor cells or tumor cell fragments expressing alkaline phosphatase.

In another aspect, the present disclosure provides a detection reagent or a detection kit for detecting tumor cells or tumor cell fragments in a test sample, which comprises a tissue non-specific alkaline phosphatase (TNAP) inhibitor and a reagent for detecting alkaline phosphatase activity of the tumor cells or tumor cell fragments. In some embodiments of the disclosure, the agent for detecting alkaline phosphatase activity of a tumor cell or a fragment of a tumor cell comprises at least a substrate that reacts with alkaline phosphatase.

In some embodiments of the disclosure, the substrate is a chromogenic substrate.

In some embodiments of the disclosure, the substrate is a fluorogenic, chemiluminescent, or chromogenic substrate molecule, including AMPPD (3- (2 '-spiroadamantane) -4-methoxy-4- (3' -phosphoryloxy) benzene-1, 2-dioxetane), CDP-Star (3- (2-spiroadamantane) -4-methoxy-4- (3-phosphoryloxy) -phenyl-1, 2-dioxetane), APS-5 ((4-chlorobenzenethiol) (10-methyl-9, 10-dihydroacridinylidene) disodium phosphate), Lumi-Phos 530 (comprising 3- (2 '-spiroadamantane) -4-methoxy-4- (3' -phosphoryloxy) benzene-1, 2-dioxetane AMPPD and disodium salt), PNPP (p-nitrophenyl phosphate), BCIP (5-bromo-4-chloro-3-indole-phosphate) and NBT (nitrotetrazolium chloride).

In some embodiments of the disclosure, the detection reagent or detection kit further comprises a capture reagent for tumor cells or tumor cell fragments.

In some embodiments of the disclosure, the capture agent of tumor cells or tumor cell fragments is selected from one or more of the following agents:

(1) a negative capture agent of tumor cells or tumor cell fragments comprising at least one antibody against a leukocyte antigen;

(2) a tumor cell antibody capture reagent comprising at least one antibody directed against a tumor cell associated antigen;

(3) an aptamer capture reagent, which at least comprises the aptamer shown in SEQ ID NO.11 and a derivative thereof.

In some embodiments of the present disclosure, the capture reagent of tumor cells or tumor cell fragments further comprises one or more of a red blood cell lysate, a washing buffer, a binding buffer, a carrier.

In some embodiments of the disclosure, (1) the antibody to the leukocyte surface antigen comprised by the negative capture reagent is a modifier-modified antibody; more preferably, the modifier is biotin.

In some embodiments of the disclosure, the leukocyte surface antigen is one or more selected from the group consisting of CD45, CD11b, CD14, CD68, CD16, CD56, CD57, CD59, CD94, CD3, CD4, CD8, CD80, CD86, CD40, CD21, CD19, CD20, CD18, CD32, CD44, CD55, and CD66 b.

In some embodiments of the disclosure, the tumor cell or tumor cell fragment negative capture reagent further comprises one or more of a red blood cell lysate, a wash buffer, a binding buffer, and a carrier. Preferably, the vector is a vector for linking an antibody or a nucleic acid aptamer.

In some embodiments of the present disclosure, (2) the tumor cell-associated antigen comprised by the antibody capture reagent is a modifier-modified antibody; preferably, the modification is biotin.

In some embodiments of the disclosure, the tumor cell-associated antigen is one or more selected from the group consisting of EGFR, Epcam, HER2, PLAP, CEA, CA19-9, GPA33, Mesothelin (Mesothelin), MUC1, CD133, CD44, VIM, FR, Nectin-4, GPC3, PD-L1, MET, CA15-3, GD2, ROR1, FAP, CLDN18.2, and TROP 2.

In some embodiments of the present disclosure, the tumor cell or tumor cell fragment capturing agent further comprises one or more of an erythrocyte lysate, a washing buffer, a binding buffer, and a carrier for attaching an antibody.

In some embodiments of the present disclosure, (3) the aptamer capture reagent comprises aptamer BG2 shown in SEQ ID No. 11.

In some embodiments of the disclosure, the BG2 is a modifier-modified aptamer BG 2; preferably, the modification is biotin.

In some embodiments of the disclosure, the aptamer capture reagent further comprises one or more of an erythrocyte lysate, a wash buffer, a binding buffer, and a vector for attaching aptamer BG 2.

In some embodiments of the disclosure, the buffer is selected from PBS, BSA, and a mixture of PBS and BSA.

In some embodiments of the present disclosure, the carrier is one or more selected from the group consisting of magnetic beads, agarose beads, latex particles, and well plates.

In some embodiments of the present disclosure, the vector is a modifier-modified vector; preferably, the modification is streptavidin.

In some embodiments of the present disclosure, the magnetic beads are selected from streptavidin magnetic beads, carboxyl magnetic beads, amino magnetic beads, hydroxyl magnetic beads, and epoxy magnetic beads.

In some embodiments of the disclosure, the agarose beads are protein a/G agarose beads.

In some embodiments of the present disclosure, the tissue non-specific alkaline phosphatase (TNAP) inhibitor is selected from one or more of sulfonamide derivatives, amino acid derivatives, pyrazole amide derivatives, pyridooxazinone derivatives, and biaryl derivatives.

In some embodiments of the present disclosure, the sulfonamide derivative is selected from 4-cyano-N- (4-toluene-1-sulfonyl) -L-phenylalanine (C)₁₇H₁₆N₂O₄S), 5- ((5-chloro-2-methoxyphenyl) sulfonamide) nicotinamide (C)₁₃H₁₂ClN₃O₄S), 5-chloro-N- [ (8S, 9aR) -8-hydroxy-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f)]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]-2-methoxybenzenesulphonamide, 5-chloro-N- [ (8S, 9aR) -8-hydroxy-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f ]]Pyrrolo [2, 1-c ] s][1，4]Oxazepin-3-yl]-2- (trifluoromethoxy) benzenesulfonamide, 5-chloro-N- [ (8R, 9aR) -8-hydroxy-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f [ ] -]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]-2-methoxybenzenesulphonamide, 5-chloro-N- [ (9S, 9aS) -9-hydroxy-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f [ ]]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]-2-methoxybenzenesulphonamide, 5-chloro-N- [ (9S, 9aS) -9-hydroxy-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f ]]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]-2- (trifluoromethoxy) benzenesulfonamide, 5-chloro-N- [ (8S, 9aR) -8-fluoro-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f [ ] -]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]-2-methoxybenzenesulphonamide, 5-chloro-2-methoxy-N- [ (8S, 9aR) -8-methoxy-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f ]]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]Benzenesulfonamide, (8S, 9aR) -3- { [ (5-chloro-2-methoxyphenyl) sulfonyl]Amino } -5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f)]Pyrrolo [2, 1-c][1，4]Oxazan-8-ylmethyl carbamate and [ (8R, 9aR) -3- { [ (5-chloro-2-methoxyphenyl) sulfonyl]Amino } -5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 24 ]]Pyrrolo [2, 1-c][1，4]Oxa-8-yl]Methyl carbamate.

In some embodiments of the present disclosure, the amino acid derivative is selected from the group consisting of L-Homoarginine (L-homoarginin) and L-Homoarginine-d4 Dihydrochloride (L-homoarginin-d 4 Dihydrochloride).

In some embodiments of the present disclosure, the pyrazole amide derivative is selected from the group consisting of 3- (2, 4-dichlorophenyl) -N- (2-hydroxyethyl) -1H-pyrazole-5-carboxamide, 3- (2, 4-dichlorophenyl) -N-isopropyl-1H-pyrazole-5-carboxamide, 3- (2, 4-dichlorophenyl) -1H-pyrazol-5-yl) (4- (2-hydroxyethyl) piperazin-1-yl) methanone, 3- (2, 4-dichloro-5-fluorophenyl) N- (2-hydroxyethyl) -1H-pyrazole-5-carboxamide, 3- (2, 4-dichlorophenyl) N- (3-hydroxypropyl) -1H-pyrazole-5-carboxamide, and pharmaceutically acceptable salts thereof -formamide, 3- (2, 4-dichloro-5-fluorophenyl) N- (3-hydroxypropyl) -1H-pyrazole-5-carboxamide, 3- (2, 4, 5-trichlorophenyl) N- (2-hydroxyethyl) -1H-pyrazole-5-carboxamide and 3- (2, 4-difluorophenyl) N- (2-hydroxyethyl) -1H-pyrazole-5-carboxamide.

In some embodiments of the present disclosure, the pyridooxazinone derivative is selected from the group consisting of 5-chloro-2-methoxy N- (5-oxo-4-phenyl-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl) benzenesulfonamide 5-chloro-2-methoxy N- (5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl) benzenesulfonamide, 5-chloro-2-methoxy-N- [ (3S) -3-methyl-5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] benzenesulfonamide, 5-chloro-N- [ (3S) -3-ethyl-5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] -2-methoxybenzenesulfonamide, 5-chloro-N- [ (3S) -3- (hydroxymethyl) -5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] -2-methoxybenzenesulfonamide, 5-bromo-N- [ (3S) -3- (hydroxymethyl) -5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] -2-methoxybenzenesulfonamide, 5-chloro-N- [ (3S) -3- (hydroxymethyl) -5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] -2- (trifluoromethoxy) benzenesulfonamide, 5-chloro-N- [ (3S) -3- (2-hydroxyethyl) -5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] -2-methoxybenzenesulfonamide, 5-chloro-2-methoxy N- (5 '-oxo-4', 5 ' -dihydrospiro [ cyclopropane-1, 3 ' -pyrido [3, 2-f ] [1, 4] oxazepin ] -7 ' -yl) benzenesulfonamide, 5-chloro N- (5 ' -oxo-4 ', 5 ' -dihydrospiro [ cyclopropane-1, 3 ' -pyrido [3, 2-f ] [1, 4] oxazepin ] -7 ' -yl) -2- (trifluoromethoxy) benzenesulfonamide, 2-ethoxy-5-fluoro N- (5 ' -oxo-4 ', 5 ' -dihydrospiro [ cyclopropane-1, 3 ' -pyrido [3, 2-f ] [1, 4] oxazepin ] -7 ' -yl) benzenesulfonamide and 5-chloro-2-methoxy-N- [ 5-oxo-3- (pyridine-3- -yl) -2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] benzenesulfonamide.

In some embodiments of the disclosure, the biaryl derivative is selected from the group consisting of 2- ({5 ' -chloro-2 ' - [ (5-ethylpyridine-3-sulfonyl) amino ] -3 ' -fluoro [1, 1 ' -biphenyl ] -4-yl } oxy) -2-methylpropanoic acid, {5 ' -chloro-3 ' -fluoro-2 ' - [ (5-methylpyridine-3-sulfonyl) amino ] [1, 1 ' -biphenyl ] -4-yl } acetic acid, {5 ' -chloro-2 ' - [ (4, 5-dimethylpyridine-3-sulfonyl) amino ] -3 ' -fluoro [1, 1 ' -biphenyl ] -4-yl } acetic acid, ({3 ', 5 ' -dichloro-2 ' - [ (5-methylpyridine-3-sulfonyl) amino ] [1, 1 ' -biphenyl ] -4-yl } oxy) acetic acid, 3- {5 ' -chloro-2 ' - [ (5-ethylpyridine-3-sulfonyl) amino ] -3 ' -fluoro [1, 1 ' -biphenyl ] -4-yl } propanoic acid, and 2- {5 ' -chloro-3 ' -fluoro-2 ' - [ (5-methylpyridine-3-sulfonyl) amino ] [1, 1 ' -biphenyl ] -4-yl } propanoic acid.

In some embodiments of the disclosure, the tissue non-specific alkaline phosphatase (TNAP) inhibitor is selected from 4-cyano-N- (4-toluene-1-sulfonyl) -L-phenylalanine (C)₁₇H₁₆N₂O₄S), 5- ((5-chloro-2-methoxyphenyl) sulfonamide) nicotinamide (C)₁₃H₁₂ClN₃O₄S) and L-Homoarginine (L-homoarginin).

In some embodiments of the disclosure, the tissue non-specific alkaline phosphatase (TNAP) inhibitor is 4-cyano N- (4-toluene-1-sulfonyl) -L-phenylalanine (C)₁₇H₁₆N₂O₄5)。

In a specific embodiment of the present disclosure, a negative enrichment method with negative depletion of leukocytes is used to enrich tumor cells, comprising the steps of:

(a) sample preparation: taking a proper amount of whole blood (sample to be tested), lysing (the sample to be tested does not need to be lysed when being hydrothorax or ascites) (for example, lysing for 10min according to a ratio of 1: 10 (whole blood volume: 1 x erythrocyte lysate volume)), centrifuging (for example, centrifuging for 5min at 500 g), removing supernatant, and resuspending cells (for example, resuspending cells with 0.5% BSA) to obtain cell suspension;

(b) antibody incubation: mixing the cell suspension obtained in step (a) with an antibody (e.g., biotin-modified CD45 antibody and biotin-modified CD66b antibody) against a leukocyte antigen modified with a modifier 1 (e.g., biotin), and incubating to obtain a sample of a modifier 1-antibody-cell complex; preferably, incubation is at 4 ℃; preferably, incubation is for 1 h; preferably, the modifier 1-antibody-cell complex sample is centrifuged (preferably 500g for 5min), the supernatant is removed to obtain a centrifuged modifier 1-antibody-cell complex sample, the centrifuged modifier 1-antibody-cell complex sample is washed (for example, 1 time) with a washing solution (for example, BSA-PBS), centrifuged (preferably 500g for 5min), the supernatant is removed, and a recentrifuged modifier 1-antibody-cell complex sample is obtained;

preferably, the biotin-modified CD45 antibody is added to a final concentration of 5. mu.g/ml; preferably, biotin-modified CD66b antibody is added to a final concentration of 10. mu.g/ml;

(c) and (4) magnetic bead incubation: mixing the modifier 1-antibody-cell complex sample obtained in the step (b) with the magnetic beads modified by the modifier 2 (such as streptavidin), and incubating to obtain a modifier 1-antibody-modifier 2-magnetic beads-cell complex sample; preferably, incubation at 4 ℃, preferably rotary incubation; preferably, incubation is for 1 h;

(d) magnetic frame separation: placing the modifier 1-antibody-modifier 2-magnetic bead-cell compound sample obtained in the step (c) on a magnetic frame, carrying out magnetic separation to obtain a supernatant and a purified tumor cell sample, centrifuging the purified tumor cell sample, and collecting cell precipitates.

In a specific embodiment of the present disclosure, a positive enrichment method of capturing tumor cells with a positive antibody is used to enrich tumor cells, which comprises the following steps:

(a) magnetic bead coupling: taking an antibody (such as an EGFR antibody) modified by a modifier 1 (such as biotin) and a magnetic bead modified by a modifier 2 (such as streptavidin), adding the magnetic beads into a buffer (such as 0.5% BSA-PBS buffer), incubating (such as rotating and incubating at room temperature for 4h), and carrying out magnetic separation (such as separation for 3min) to obtain the magnetic bead (namely, a modifier 1-antibody-modifier 2-magnetic bead complex) coupled with the antibody (such as the EGFR); preferably, the separated magnetic beads coupled with the antibody (e.g., EGFR) are washed with 0.5% BSA-PBS buffer;

(b) sample preparation: obtaining a test sample from a subject;

(c) and (4) magnetic bead incubation: mixing and incubating the magnetic beads of the coupled antibody obtained in the step (a) and the sample to be detected obtained in the step (b) to obtain a modifier 1-antibody-modifier 2-magnetic bead-cell compound sample; preferably, incubation at 4 ℃, preferably rotary incubation; preferably, incubation is for 1 h;

(d) magnetic frame separation: and (c) placing the modifier 1-antibody-modifier 2-magnetic bead-cell compound sample obtained in the step (c) on a magnetic frame, carrying out magnetic separation, and removing the supernatant to obtain a tumor cell sample.

In a specific embodiment of the present disclosure, the forward antibody capture is a single antibody capture or a multiple antibody capture.

In a specific embodiment of the present disclosure, a method of capturing tumor cells using a nucleic acid aptamer to enrich circulating tumor cells comprises the steps of:

(a) magnetic bead coupling; connecting the magnetic beads with the alkaline phosphatase aptamer to obtain magnetic beads coupled with the alkaline phosphatase aptamer (such as BG 2); preferably, the nucleotide sequence of the alkaline phosphatase aptamer is shown as SEQ ID NO. 11;

(b) sample preparation: taking whole blood to obtain a sample to be detected;

(c) and (4) incubation of magnetic beads: mixing and incubating the magnetic beads coupled with the alkaline phosphatase aptamer obtained in the step (a) and the sample to be detected obtained in the step (b) to obtain an alkaline phosphatase aptamer-magnetic bead-cell complex sample;

(d) magnetic frame separation: and (c) placing the alkaline phosphatase aptamer-magnetic bead-cell complex sample obtained in the step (c) on a magnetic frame, carrying out magnetic separation, and removing the supernatant to obtain a tumor cell sample.

It is understood that the methods described above for enriching tumor cells with negative enrichment by negative depletion of leukocytes using a negative capture reagent for tumor cells or tumor cell fragments, for enriching tumor cells with positive enrichment by positive capture of tumor cells using an antibody capture reagent for tumor cells, and for capturing with an aptamer capture reagent, that tumor cells comprise tumor cells and/or tumor cell fragments that are captured by the corresponding capture reagent due to the presence of a specific surface biomarker.

In a specific embodiment of the present disclosure, alkaline phosphatase activity is detected in the following manner:

(1) mixing a fluorescent luminescent substrate, a chemiluminescent substrate or a chromogenic substrate of alkaline phosphatase with a TNAP inhibitor (for example, TNAP inhibitor 1) to obtain a luminescent substrate solution or a chromogenic substrate solution of alkaline phosphatase containing the TNAP inhibitor;

(2) mixing the luminescent substrate solution or the chromogenic substrate solution of the alkaline phosphatase containing the TNAP inhibitor obtained in the step (1) with a tumor cell sample to obtain a mixture;

(3) and (3) detecting the mixture obtained in the step (2), and judging whether the sample to be detected contains alkaline phosphatase activity or not by detecting the absorbance or relative luminescence unit of the mixture, thereby determining or identifying whether the sample to be detected contains tumor cells or tumor cell fragments expressing alkaline phosphatase.

In a specific embodiment of the present disclosure, the tumor cell is a circulating tumor cell.

By adopting the method disclosed by the invention, the background value of the white blood cells can be reduced in a multiplied way, the signal value of the tumor cells is unchanged or slightly reduced, and the signal-to-noise ratio is obviously improved.

For purposes of clarity and brevity, features may be described herein as part of the same or separate embodiments, however, it is to be understood that the scope of the present disclosure may include some embodiments having combinations of all or some of the features described.

Hereinafter, the present disclosure is described in more detail with reference to specific examples, which, however, are for illustrative purposes only and do not have a limiting effect on the present disclosure.

Examples

The abbreviations in the following examples have the following meanings:

TNAP: tissue non-specific alkaline phosphatase

WBC: white blood cell

ALPL: tissue non-specific alkaline phosphatase gene, expression of TNAP (tissue non-specific alkaline phosphatase)

ALPP: placental alkaline phosphatase gene, expression PLAP (placental alkaline phosphatase)

ALPI: intestinal alkaline phosphatase gene, expression of IAP (intestinal alkaline phosphatase)

ALPG: placenta-like alkaline phosphatase gene expressing GCAP (placenta-like alkaline phosphatase)

BG2：CAAGGAATAGGGGTCGGTGTGGGTGGTTATGATTGGCTTCCTTG(SEQ ID NO.11)

BG2 biotin: biotin-modified BG2

BG2 PEG biotin: PEG (polyethylene glycol) -modified BG2 biotin

RLU: relative luminous intensity

Example 1: comparison of tumor cell to leukocyte (WBC) expression levels of ALPL, ALPP, ALPI, and ALPG genes

1.1 Experimental procedures

(1) Total RNA was extracted from White Blood Cells (WBC) and tumor cell lines Lovo, MCF-7, SW480, HCC827, H820, MKN7, 7721, Caco2, and Bewo (Table 1), and RNA samples were subjected to degDNA and reverse transcription to obtain cDNA.

TABLE 1 cell line names and tumor types corresponding thereto

Cell line name	Tumor type
		Lovo	Intestinal cancer
MCF-7	Breast cancer cell
		SW480	Intestinal cancer
HCC827	Lung cancer
		H820	Lung cancer
MKN7	Stomach cancer
		7721	Liver cancer
Caco2	Intestinal cancer
		Bewo	Human placental choriocarcinoma cells

(2) The cDNA obtained in step (1) was subjected to qPCR quantitative amplification according to the following systems (tables 2 and 3), and the mean CT values of WBC and tumor cells Lovo, MCF-7, SW480, HCC827, H820, MKN7, 7721, Caco2, and Bewo were measured, respectively, and the relative expression amounts of WBC and tumor cell lines MCF-7, SW480, HCC827, H820, MKN7, 7721, Caco2, Bewo with respect to Lovo cell ALPL, ALPP gene, ALPI gene, and ALPG gene were calculated from the obtained mean CT values by the 2- Δ CT (Livak) method. The primers used are shown in Table 2.

TABLE 2 primer information

The loading system is shown in Table 3.

TABLE 3 sample application System

Reagent	1 × volume (μ l)
		TB Green Premix Ex TaqII(Tli RNaseH Plus2×)	12.5
Forward primer 10. mu.M	1
		Reverse primer 10. mu.M	1
NF-water	8.5
		Form panel	2

1.2 results of the experiment

The average CT number results are shown in Table 4.

TABLE 4 mean CT values

Gene	ALPL	ALPP	ALPI	ALPG	GAPDH
						Lovo	29.71	16.855	17.88	23.47	16.745
MCF-7	33.285	36.005	Absence of expression	33.35	17.04
						WBC	20.355	Absence of expression	Absence of expression	36.36	17.915
SW480	Absence of expression	25.825	27.685	32.125	16.27
						HCC827	33.24	22.74	Absence of expression	25.01	15.27
H820	29.84	23.97	Absence of expression	28.05	17.09
						MKN7	30.48	15.24	31.74	23.93	16.78
7721	29.99	16.70	16.66	25.03	15.67
						Caco2	30.83	19.90	22.61	21.96	17.13
Bewo	25.22	24.56	32.08	22.71	15.35

Note: "No expression" means that the sample was not amplified

The relative expression amounts of WBC and tumor cell lines Lovo, MCF-7, SW480, HCC827, H820, MKN7, 7721, Caco2 and Bewo with respect to the ALPL gene, ALPP gene, ALPI gene and ALPG gene of Lovo cells were calculated according to the data of Table 4 and the 2- Δ Δ CT (Livak) method, and the results are shown in Table 5.

TABLE 5 relative expression amounts of genes

1.3 conclusion

As can be seen from Table 5, the relative expression level of ALPL gene in White Blood Cells (WBC) was significantly higher than that of tumor cell lines Lovo, MCF-7, SW480, HCC827, H820, MKN7, 7721, Caco2, Bewo; and the leukocyte does not express the ALPP gene, ALPI gene and ALPG gene, or expresses very little. Tumor cell lines Lovo, MCF-7, SW480, HCC827, H820, MKN7, 7721, Caco2 and Bewo all express one or more of ALPP gene, ALPI gene and ALPG; the tumor cell line does not express ALPL gene or has extremely low expression level.

Example 2: activity assay for tumor cell line alkaline phosphatase

2.1 Experimental procedures

(1) Cell preparation: tumor cell lines Lovo, Bewo, MKN-7, Caco-2, MCF-7, 7721 were digested with pancreatin 0.25% for 2min, the digestion was stopped with 1640 complete medium, the cells were washed with 1 XPBS, the supernatant was centrifuged off, the cells were resuspended in 1ml of 1 XPBS and counted on a hemocytometer, the resulting cell suspension was added to 1.5ml of EP tubes in an amount of 1000 tumor cell lines per tube, 1.5ml of EP tubes containing 1000Lovo cells (Lovo-1000) per tube, 1.5ml of EP tubes containing 1000 BeWo cells (BeWo-1000) per tube, 1.5ml of EP tubes containing 1000 MKN-7 cells (MKN-7-1000) per tube, 1.5ml of EP tubes containing 1000 Caco-2 cells (Caco-2-1000) per tube, and 1.5ml of EP tubes containing 1000 MCF-7 cells (MCF-7-1000) per tube, Each tube contained 1000 7721 cells (7721-1000) in 1.5ml EP tubes.

(2) And (3) chemiluminescence detection:

experimental groups:

adding 400 μ l of alkaline phosphatase chemiluminescent substrate solution (alkaline phosphatase substrate solution A04, purchased from Shenzhen Meykat science and technology Co., Ltd., product number 224179) into each 1.5ml of EP tube containing 1000 tumor cell line cells in the step (1), mixing uniformly for 5min, centrifuging at 12000rpm for 2min, and taking 200 μ l of supernatant to a microplate reader to detect chemiluminescent reading values.

Blank control experiment:

adding 400 μ l alkaline phosphatase chemiluminescent substrate solution (alkaline phosphatase substrate solution A04, from Shenzhen Meyketchup technology Co., Ltd., product number 224179) into 1.5ml EP tube, mixing uniformly for 5min, centrifuging at 12000rpm for 2min, and collecting 200 μ l supernatant to enzyme labeling instrument for detecting chemiluminescence reading value.

2.2 Experimental results and conclusions

As shown in fig. 1, compared with the blank control experiment, RLU values of Lovo (intestinal cancer), Bewo (human placental villus cancer cell), MKN-7 (gastric cancer), Caco2 (intestinal cancer), MCF7 (breast cancer) and 7721 (liver cancer) cell lines are significantly higher than those of the blank control group, and all the cell lines express alkaline phosphatase and contain alkaline phosphatase activity, so that tumor cell signals can be detected by detecting alkaline phosphatase activity.

Example 3: effect of TNAP inhibitor on improving chemiluminescence reading value ratio of tumor cell line and leukocyte

In this embodiment, a blood sample is used as a test sample for performing a related experiment.

3.1 Experimental procedures

(1) WBC cell preparation:

taking 2ml of blood, using 1 Xerythrocyte lysate 20ml to lyse for 10min, centrifuging for 5min at 500g, removing supernatant, then washing twice with 1 XPBS, centrifuging for 5min at 500g after the first washing, removing supernatant, then washing for the second time, centrifuging for 3min at 300g again, removing supernatant, resuspending BSA cells with 1ml of 0.5%, obtaining WBC cell suspension, and counting by a hemocytometer. The cell suspension was added to a 1.5ml EP tube in an amount of 40 ten thousand white blood cells (WBC-40W) per tube to obtain a 1.5ml EP tube containing 40 ten thousand white blood cells (WBC-40W) per tube.

(2) Preparation of Lovo cells:

the Lovo cells were digested with 0.25% trypsin, the digestion was stopped with 0.5% BSA-PBS, centrifuged at 600rpm for 3min, 2ml of 0.5% BSA-PBS was used to resuspend the cells, and Lovo cell suspension was obtained and counted on a hemocytometer. The cell suspension was added to a 1.5ml EP tube in an amount of 1000Lovo cells (LOVO-1000) per tube to obtain a 1.5ml EP tube containing 1000Lovo cells (LOVO-1000) per tube.

(3) And (3) chemiluminescence detection:

taking an alkaline phosphatase chemiluminescent substrate (alkaline phosphatase substrate solution A04, purchased from Shenzhen Meykat science and technology Co., Ltd., product number 224179), mixing with the TNAP inhibitor, and obtaining alkaline phosphatase chemiluminescent substrate solutions containing different TNAP inhibitors (TNAP inhibitor 1, TNAP inhibitor 2 and TNAP inhibitor 3) with different working concentrations, which are prepared according to the following tables 6, 7 and 8.

Taking 1.5ml EP tube containing 40 ten thousand white blood cells (WBC-40W) per tube prepared in the step (1) and 1.5ml EP tube containing 1000Lovo cells (LOVO-1000) per tube prepared in the step (2), adding 400 μ l of the prepared alkaline phosphatase chemiluminescence substrate solution into each 1.5ml EP tube, mixing uniformly, centrifuging at 12000rpm for 2min, taking 200 μ l of supernatant to an ELISA plate, and detecting the luminescence value of the supernatant by using an ELISA reader. 1 (4-cyano-N- (4-toluene-1-sulfonyl) -L-phenylalanine (C) as TNAP inhibitor₁₇H₁₆N₂O₄S)) was 29.0377mM, with an IC50 of 190nM, to design different concentration gradients to find the most suitable working concentration. Designed 7C₁₇H₁₆N₂O₄The gradient concentration of S is shown in Table 6.

TABLE 6C₁₇H₁₆N₂O₄Gradient concentration of S

IC50

0

1/2IC50

IC50

5IC50

10IC50

20IC50

40IC50

TNAP inhibitor 1 concentration

0

95nM

190nM

950nM

1900nM

3800nM

7600nM

Nicotinamide (C) based on the TNAP inhibitor 2(5- ((5-chloro-2-methoxyphenyl) sulfonamide)₁₃H₁₂ClN₃O₄S)) was 29.2594mM, with an IC50 of 16nM, to design several concentration gradients to find the most suitable working concentration. Designed 7C₁₃H₁₂ClN₃O₄The gradient concentration of S is shown in Table 7.

TABLE 7C₁₃H₁₂ClN₃O₄Gradient concentration of S

IC50	0	1/2IC50	IC50	5IC50	10IC50	20IC50	40IC50
								TNAP inhibitor
2 concentration	0	8nM	16nM	80nM	160nM	320nM	640nM

According to the reference (C W Lin, et al. L-homoarginin. An organic-specific, uncompetitive inhibitor of human liver and bone alkali phosphor. J Biol chem.1972May 25; 247 (10): 3082-7), 3 TNAP inhibitor 3 (L-Homoarginine (H-HoArg-OH, L-homoarginin)) concentrations were set, and the concentration settings are shown in Table 8.

TABLE 8 gradient concentrations of H-HoArg-OH

TNAP inhibitor 3 concentration

5×190nM

40×190nM

190μM

3.2 results of the experiment

As can be seen from FIG. 2, with TNAP inhibitor 1 (C)₁₇H₁₆N₂O₄S) concentration, the chemiluminescent readings of the Lovo tumor cell line and White Blood Cells (WBCs) gradually decreased, but the Lovo cells decreased more gradually and the White Blood Cells (WBCs) decreased more dramatically. Table 9 shows the ratios of Lovo tumor cell line to White Blood Cell (WBC) chemiluminescence readings, wherein when TNAP inhibitor 1 was not added (at a concentration of 0), the ratio of Lovo tumor cell line to White Blood Cell (WBC) chemiluminescence readings was 4, and the ratio of Lovo tumor cell line to White Blood Cell (WBC) chemiluminescence readings increased with increasing concentration of TNAP inhibitor 1 (table 9).

TABLE 9

C₁₇H₁₆N₂O₄Concentration of S	Ratio of chemiluminescence readings of Lovo tumor cell line and White Blood Cell (WBC)
		0	4
1/2IC50	11
		IC50	43
5IC50	151
		10IC50	235
20IC50	315
		40IC50	443

As can be seen in FIG. 3, with TNAP inhibitor 2 (C)₁₃H₁₂ClN₃O₄S) concentration, the chemiluminescent readings of the Lovo tumor cell line and White Blood Cells (WBCs) gradually decreased, but the Lovo cells decreased more gradually and the White Blood Cells (WBCs) decreased more dramatically. The ratio of the chemiluminescence readings of the Lovo tumor cell line to White Blood Cells (WBCs) was increased (table 10).

Watch 10

C₁₃H₁₂ClN₃O₄Concentration of S	Ratio of chemiluminescence readings of Lovo tumor cell line and White Blood Cell (WBC)
		0	3
1/2IC50	7
		IC50	7
5IC50	13
		10IC50	19
20IC50	30
		40IC50	48

As can be seen from fig. 4, as the concentration of TNAP inhibitor 3(H-HoArg-OH) increases, the chemiluminescence reading values of the Lovo tumor cell line and the White Blood Cells (WBCs) gradually decrease, but the Lovo cells decrease more gradually, and the chemiluminescence reading values of the White Blood Cells (WBCs) fluctuate more sharply, and the whole shows a decreasing trend. The ratio of the Lovo tumor cell line to the White Blood Cell (WBC) chemiluminescence readings increased slowly (table 11).

TABLE 11

H-HOARG-OH concentration	Chemical priming of Lovo tumor cell line with White Blood Cells (WBC)Ratio of optical readings
		0	2
5*190nM	2
		40*190nM	3
190uM	4

3.3 conclusion

The experimental results show that the tissue non-specific alkaline phosphatase on the surface of the leucocyte is obviously higher than that of tumor cell Lovo and TNAP inhibitor 1 (C)₁₇H₁₆N₂O₄S), TNAP inhibitor 2 (C)₁₃H₁₂ClN₃O₄S) and TNAP inhibitor 3(H-HoArg-OH) have obvious inhibition effect on tissue non-specific alkaline phosphatase on leucocytes, and have small influence on tumor cells Lovo. Therefore, the background of leukocyte-derived alkaline phosphatase can be reduced by inhibiting tissue-non-specific alkaline phosphatase on the leukocyte surface.

Example 4: application of TNAP inhibitor in tumor cell enrichment process to increase signal-to-noise ratio

This example uses aptamer capture to enrich tumor cells, and mixes leukocytes and Lovo cells to simulate blood samples (test samples) of tumor patients. This example is divided into 2 groups, namely: control group (WBC), experimental group (WBC +1000 Lovo).

4.1 Experimental procedure

(1) Magnetic bead coupling

And adding 25 mu L of streptavidin modified magnetic beads and 0.4 mu L of BG2 PEG biotin or BG2 biotin into 1mL of PBS + BSA (1mg/mL) buffer solution, incubating at room temperature for 30min, carrying out magnetic separation for 3min, washing for 2 times by using 1mL of PBS + BSA (1mg/mL) buffer solution, and carrying out magnetic separation for 3min to obtain BG2 PEG biotin or BG2 biotin coupled magnetic beads.

(2) WBC cell preparation:

taking 5mL of whole blood, cracking the whole blood by using 50mL of 1 x erythrocyte lysate for 10min, centrifuging 500g for 5min to remove supernatant, then washing twice by using PBS, centrifuging 500g for 5min after the first washing, removing supernatant, then washing for the second time, centrifuging 300g for 3min again, removing supernatant, resuspending cells by using 1mL of 0.5% BSA, obtaining WBC cell suspension, and counting by using a blood counting plate. The cell suspension was added to a 1.5ml EP tube as 100 million (100W) White Blood Cell (WBC) cells per tube.

(3) Preparation of Lovo cells:

lovo cells were digested with 0.25% pancreatin, digestion was stopped with 0.5% BSA-PBS, centrifuged at 600rpm for 3min, 2ml of 0.5% BSA-PBS was used to resuspend the cells to obtain a Lovo cell suspension, and the cells were counted on a hemocytometer. The cell suspension was added to a 1.5ml EP tube as 1000Lovo cells per tube.

(4) Cell mixing:

100W White Blood Cells (WBC) were mixed with 1000Lovo cells in a 1.5mL EP tube and supplemented with PBS + BSA (1md/mL) + salmon sperm DNA (0.1mg/mL) to 1 mL.

(5) And (4) magnetic bead incubation:

25 μ l of BG2 PEG biotin-conjugated magnetic beads or BG2 biotin-conjugated magnetic beads prepared in step (1) were added to the above samples, and the samples were incubated at 4 ℃ for 1 hour by rotation.

(6) Magnetic frame separation:

after the incubation was completed, the sample was placed on a magnetic rack for 20 minutes, the supernatant was removed, and then 1mL of PBS + BSA (1mg/mL) was added for washing, the sample tube was removed for washing, and then placed on a magnetic rack for 20 minutes, the supernatant was removed, and the washing was performed 2 times in total. And after the last washing, putting the sample tube on a small-sized centrifuge, throwing for 10 seconds, putting the sample tube on a magnetic frame for 5min, and sucking the supernatant to be dry.

(7) And (3) chemiluminescence detection:

TNAP inhibitor 1 (C) was added to a chemiluminescent substrate of alkaline phosphatase (alkaline phosphatase substrate solution A04, available from Shenzhen Meykat science and technology Co., Ltd., Cat # 224179)₁₇H₁₆N₂O₄S) to a final concentration of 5IC50(IC50 ═ 190nM), 5IC50 alkaline phosphatase chemiluminescent substrate solution was obtained. Adding 400 mul of alkaline phosphatase chemiluminescence substrate liquid into each sample, uniformly mixing for 5min, centrifuging at 12000rpm for 2min, and taking 200 mul of supernatant to a microplate reader for detecting chemiluminescence reading values.

4.2 results of the experiment

The effect of TNAP inhibitor on the signal-to-noise ratio of the test sample is shown in figure 5. As can be seen from fig. 5, the chemiluminescence values of the experimental group were significantly higher than those of the control group.

TABLE 12

The signal to noise ratio of table 12 is the ratio of WBC & Lovo chemiluminescence reading to WBC chemiluminescence reading. As can be seen from table 12, the signal-to-noise ratios of BG2 PEG biotin and BG2 biotin for capturing Lovo cells before the use of the inhibitor are 45 and 32, respectively, and the signal-to-noise ratios of BG2 PEG biotin and BG2 biotin after the use of the TNAP inhibitor are 188 and 96, respectively, it can be seen that the improvement of the signal-to-noise ratio is significant after the use of the TNAP inhibitor.

4.3 conclusion

TNAP inhibitor 1 (C)₁₇H₁₆N₂O₄S) can improve the detection signal-to-noise ratio in tumor cell addition experiments. After the TNAP inhibitor is added, the detection background noise caused by the white blood cells can be reduced, and the detection sensitivity of the tumor cells is improved.

Example 5: application of TNAP inhibitor in tumor cell enrichment process to increase signal-to-noise ratio

5.1 Experimental procedure

This example used multiple antibody capture to enrich for tumor cells. This example is divided into 2 groups, namely: the control group is non-cancerous pleural effusion (pleural effusion) and the cancer cell experimental group is non-cancerous pleural effusion +1000 Lovo.

(1) Magnetic bead coupling:

mu.L of streptavidin-modified magnetic beads and 2. mu.L of a mixture of biotin-labeled EGFR antibodies (EGFR-biotin, available from Thermo, cat # MA5-12872) and Epcam antibodies (Epcam-biotin, available from Abcam, cat # ab79079) were added to 1mL of 0.5% BSA-PBS buffer, incubated at room temperature for 4h with rotation, magnetically separated for 3min, washed 2 times with 0.5% BSA-PBS buffer, and magnetically separated to obtain EGFR-and Epcam antibody-coupled magnetic beads.

(2) Sample preparation:

the control group and the experimental group were each prepared by taking 0.5ml of non-cancerous pleural effusion, wherein 1000Lovo cells were added to the experimental group and PBS was supplemented to 1ml, and the control group sample and the experimental group sample were obtained, respectively.

(3) And (4) incubation of magnetic beads:

25. mu.l of the EGFR and Epcam antibody-conjugated magnetic beads prepared in step (1) were added to the above samples, and the samples were incubated at 4 ℃ for 1 hour with rotation.

(4) Magnetic frame separation:

after the incubation was completed, the sample was placed on a magnetic rack for 20 minutes, the supernatant was removed, and then 1ml of 0.5% BSA-PBS was added for washing, and then placed on a magnetic rack for 20 minutes, the supernatant was removed, and the washing was performed 3 times in total. And after the last washing, putting the sample tube on a small-sized centrifuge, throwing for 10 seconds, putting the sample tube on a magnetic frame for 5min, and sucking the supernatant to be dry.

(5) And (3) detection:

TNAP inhibitor 1 (C) was added to a chemiluminescent substrate of alkaline phosphatase (alkaline phosphatase substrate solution A04, available from Shenzhen Meykat science and technology Co., Ltd., Cat # 224179)₁₇H₁₆N₂O₄S) to a final concentration of 5IC50(IC50 ═ 190 nM). Adding more than 400 mul of prepared alkaline phosphatase chemiluminescence substrate liquid into each sample, uniformly mixing and reacting for 5min, centrifuging at 12000rpm for 2min, and taking 200 mul of supernatant to a microplate reader to detect chemiluminescence reading values.

5.2 results of the experiment

The effect of TNAP inhibitor on the signal-to-noise ratio of the test samples is shown in fig. 6, and from fig. 6, the chemiluminescence values of the experimental group are significantly higher than those of the control group.

Watch 13

The signal to noise ratio of table 13 is the ratio of the non-cancerous pleural effusion +1000lovo chemiluminescence reading to the non-cancerous pleural effusion chemiluminescence reading. As can be seen from table 13, the signal-to-noise ratios before the inhibitor was not used were 16 and 6, respectively, and the signal-to-noise ratios after the TNAP inhibitor was used were 109 and 112, respectively, and it can be seen that the improvement in the signal-to-noise ratio after the TNAP inhibitor was used was significant.

5.3 conclusion

TNAP inhibitor 1 (C)₁₇H₁₆N₂O₄S) can improve the detection signal-to-noise ratio in a pleural effusion-based tumor cell addition experiment. After the TNAP inhibitor is added, the detection background noise caused by the white blood cells can be reduced, and the detection sensitivity of the tumor cells is improved.

Sequence listing

<110> Zhuhaishengmei bio-diagnostic technology Co., Ltd

<120> a method for detecting tumor cells or tumor cell fragments

<130> MTI220071

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetic nucleic acid

<400> 1

actggtactc agacaacgag at 22

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetic nucleic acid

<400> 2

acgtcaatgt ccctgatgtt atg 23

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetic nucleic acid

<400> 3

tcagacgttc cataccccca 20

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetic nucleic acid

<400> 4

ctctcgacca gtgtcctgc 19

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetic nucleic acid

<400> 5

cgccacttcc agcgaacac 19

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetic nucleic acid

<400> 6

gggttgggag gaagaatcag a 21

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetic nucleic acid

<400> 7

tacctgggat ttccgcctcg 20

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetic nucleic acid

<400> 8

ggttctcctc ctcaactggg at 22

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetic nucleic acid

<400> 9

tcggagtcaa cggatttggt 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetic nucleic acid

<400> 10

tgaaggggtc attgatggca 20

<210> 11

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetic nucleic acid

<400> 11

caaggaatag gggtcggtgt gggtggttat gattggcttc cttg 44

Claims

1. Use of a tissue non-specific alkaline phosphatase (TNAP) inhibitor for the preparation of a detection reagent or a detection kit for tumor cells or tumor cell fragments in a sample to be tested, or for the preparation of a diagnostic reagent or a diagnostic kit for tumors, or for the preparation of a reagent or a kit for increasing the signal-to-noise ratio in the detection of tumor cells or tumor cell fragments in a sample to be tested.

2. The use of claim 1, wherein the sample to be tested is saliva, urine, pleural effusion or peritoneal effusion;

preferably, the tumor cells are selected from one or more of intestinal cancer cells, breast cancer cells, lung cancer cells, gastric cancer cells, liver cancer cells, human placental villus cancer cells and cervical cancer cells; the tumor cell is a human tumor cell;

preferably, the alkaline phosphatase is an intestinal alkaline phosphatase, a placental-like alkaline phosphatase or any heterodimer thereof.

3. The use of claim 1 or 2, the tissue non-specific alkaline phosphatase (TNAP) inhibitor for the in vitro detection of tumor cells or tumor cell fragments comprising the steps of:

(1) obtaining a test sample from a subject;

(3) detecting whether the mixture obtained in the step (2) contains alkaline phosphatase activity of the tumor cells, thereby determining or identifying whether the sample to be tested contains tumor cells or tumor cell fragments expressing alkaline phosphatase; preferably, after step (1) and before step (2), further comprising the steps of (a) enriching the test sample to obtain a test sample with enriched tumor cells or tumor cell fragments; preferably, the method for detecting alkaline phosphatase activity is selected from one or more of enzyme-linked immunosorbent assay, chemiluminescence assay and single-molecule immunoassay; preferably, the enrichment method is selected from one or more of a negative enrichment method, an antibody capture method, an aptamer capture method and an ultrafiltration method.

4. A method of enhancing the signal-to-noise ratio of a tumor cell or tumor cell fragment detection, said method comprising adding a tissue non-specific alkaline phosphatase (TNAP) inhibitor to a test sample.

5. A detection reagent or a detection kit for detecting tumor cells or tumor cell fragments in a test sample, which comprises a tissue non-specific alkaline phosphatase (TNAP) inhibitor and a reagent for detecting alkaline phosphatase activity of tumor cells or tumor cell fragments.

6. The detection reagent or detection kit of claim 5, wherein the detection reagent or detection kit further comprises a capture reagent for tumor cells or tumor cell fragments;

preferably, the capture agent of tumor cells or tumor cell fragments is selected from one or more of the following agents:

(1) a negative capture reagent of tumor cells or tumor cell fragments comprising at least one antibody directed against a leukocyte antigen;

(3) an aptamer capture reagent comprising at least aptamer BG2 or a derivative thereof;

preferably, the leukocyte antigen is selected from one or more of CD45, CD11b, CD14, CD68, CD16, CD56, CD57, CD59, CD94, CD3, CD4, CD8, CD80, CD86, CD40, CD21, CD19, CD20, CD18, CD32, CD44, CD55 and CD66 b; preferably, the tumour cell associated antigen is selected from one or more of EGFR, Epcam, HER2, PLAP, CEA, CA19-9, GPA33, Mesothelin (Mesothelin), MUC1, CD133, CD44, VIM, FR, Nectin-4, GPC3, PD-L1, MET, CA15-3, GD2, ROR1, FAP, CLDN18.2 and TROP 2;

preferably, the capture reagent for tumor cells or tumor cell fragments further comprises one or more of erythrocyte lysate, washing buffer, binding buffer and carrier.

7. The detection reagent or the detection kit according to claim 5 or 6, wherein the carrier is selected from one or more of magnetic beads, agarose beads, latex particles and a well plate.

8. The detection reagent or the detection kit according to any one of claims 5 to 7, wherein the reagent for detecting alkaline phosphatase activity of tumor cells or tumor cell debris comprises at least a substrate reacting with alkaline phosphatase.

9. The detection reagent or the detection kit according to claim 8, wherein the substrate is a fluorescent substrate molecule, a chemiluminescent substrate molecule or a chromogenic substrate molecule, and comprises AMPPD (3- (2 '-spiroadamantane) -4-methoxy-4- (3' -phosphoryloxy) benzene-1, 2-dioxetane), CDP-Star (3- (2-spiroadamantane) -4-methoxy-4- (3-phosphoryloxy) -phenyl-1, 2-dioxetane), APS-5 ((4-chlorobenzenethiol) (10-methyl-9, 10-dihydroacridinylidene) disodium phosphate), Lumi-Phos 530 (comprising 3- (2 '-spiroadamantane) -4-methoxy-4- (3' -phosphoryloxy) benzene -1, 2-dioxetane AMPPD and disodium salt), PNPP (p-nitrophenyl phosphate), BCIP (5-bromo-4-chloro-3-indole-phosphate) and NBT (nitrotetrazolium chloride).

10. The use of any one of claims 1 to 3, the method of claim 4, the detection reagent or the detection kit of any one of claims 5 to 9, wherein the tissue non-specific alkaline phosphatase (TNAP) inhibitor is selected from one or more of sulfonamide derivatives, amino acid derivatives, pyrazole amide derivatives, pyridooxazinone derivatives and biaryl derivatives;

the sulfonamide derivative is selected from 4-cyano-N- (4-methylbenzene-1-sulfonyl) -L-phenylalanine (C)₁₇H₁₆N₂O₄5) 5- ((5-chloro-2-methoxyphenyl) sulfonamide) nicotinamide (C)₁₃H₁₂ClN₃O₄S), 5-chloro-N- [ (8S, 9aR) -8-hydroxy-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f)]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]-2-methoxybenzenesulphonamide, 5-chloro-N- [ (8S, 9aR) -8-hydroxy-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f ]]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]-2- (trifluoromethoxy) benzenesulfonamide, 5-chloro-N- [ (8R, 9aR) -8-hydroxy-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f [ ] -]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]-2-methoxybenzenesulphonamide5-chloro-N- [ (9S, 9aS) -9-hydroxy-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f)]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]-2-methoxybenzenesulphonamide, 5-chloro-N- [ (9S, 9aS) -9-hydroxy-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f [ ]]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]-2- (trifluoromethoxy) benzenesulfonamide, 5-chloro-N- [ (8S, 9aR) -8-fluoro-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f [ ] -]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]-2-methoxybenzenesulphonamide, 5-chloro-2-methoxy-N- [ (8S, 9aR) -8-methoxy-5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f ]]Pyrrolo [2, 1-c][1，4]Oxazepin-3-yl]Benzenesulfonamide, (8S, 9aR) -3- { [ (5-chloro-2-methoxyphenyl) sulfonyl]Amino } -5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f)]Pyrrolo [2, 1-c][1，4]Oxazepin-8-ylmethyl carbamate and [ (8R, 9aR) -3- { [ (5-chloro-2-methoxyphenyl) sulfonyl]Amino } -5-oxo-8, 9, 9a, 10-tetrahydro-5H, 7H-pyrido [3, 2-f)]Pyrrolo [2, 1-c][1，4]Oxazepin-8-yl]Methyl carbamate;

the amino acid derivatives are selected from L-homoarginine and L-homoarginine-d4 dihydrochloride;

the pyrazole amide derivative is selected from 3- (2, 4-dichlorophenyl) -N- (2-hydroxyethyl) -1H-pyrazole-5-carboxamide, 3- (2, 4-dichlorophenyl) -N-isopropyl-1H-pyrazole-5-carboxamide, 3- (2, 4-dichlorophenyl) -1H-pyrazole-5-yl) (4- (2-hydroxyethyl) piperazin-1-yl) methanone, 3- (2, 4-dichloro-5-fluorophenyl) N- (2-hydroxyethyl) -1H-pyrazole-5-carboxamide, 3- (2, 4-dichlorophenyl) N- (3-hydroxypropyl) -1H-pyrazole-5-carboxamide, and pharmaceutically acceptable salts thereof, 3- (2, 4-dichloro-5-fluorophenyl) -N- (3-hydroxypropyl) -1H-pyrazole-5-carboxamide, 3- (2, 4, 5-trichlorophenyl) -N- (2-hydroxyethyl) -1H-pyrazole-5-carboxamide and 3- (2, 4-difluorophenyl) -N- (2-hydroxyethyl) -1H-pyrazole-5-carboxamide;

the pyridooxazinone derivative is selected from 5-chloro-2-methoxy N- (5-oxo-4-phenyl-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl) benzenesulfonamide 5-chloro-2-methoxy-N- (5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl) benzenesulfonamide, 5-chloro-2-methoxy-N- [ (3S) -3-methyl-5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] benzenesulfonamide, 5-chloro-N- [ (3S) -3-ethyl-5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] -2-methoxybenzenesulfonamide, 5-chloro-N- [ (3S) -3- (hydroxymethyl) -5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] -2-methoxybenzenesulfonamide, 5-bromo-N- [ (3S) -3- (hydroxymethyl) -5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] -2-methoxybenzenesulfonamide, 5-chloro-N- [ (3S) -3- (hydroxymethyl) -5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] -2- (trifluoromethoxy) benzenesulfonamide, 5-chloro-N- [ (3S) -3- (2-hydroxyethyl) -5-oxo-2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] -2-methoxybenzenesulfonamide, 5-chloro-2-methoxy N- (5 '-oxo-4', 5 ' -dihydrospiro [ cyclopropane-1, 3 ' -pyrido [3, 2-f ] [1, 4] oxazepin ] -7 ' -yl) benzenesulfonamide, 5-chloro N- (5 ' -oxo-4 ', 5 ' -dihydrospiro [ cyclopropane-1, 3 ' -pyrido [3, 2-f ] [1, 4] oxazepin ] -7 ' -yl) -2- (trifluoromethoxy) benzenesulfonamide, 2-ethoxy-5-fluoro N- (5 ' -oxo-4 ', 5 ' -dihydrospiro [ cyclopropane-1, 3 ' -pyrido [3, 2-f ] [1, 4] oxazepin ] -7 ' -yl) benzenesulfonamide and 5-chloro-2-methoxy-N- [ 5-oxo-3- (pyridine-3- Yl) -2, 3, 4, 5-tetrahydropyrido [3, 2-f ] [1, 4] oxazepin-7-yl ] benzenesulfonamide;

the biaryl derivative is selected from the group consisting of 2- ({5 '-chloro-2' - [ (5-ethylpyridine-3-sulfonyl) amino ] -3 '-fluoro [1, 1' -biphenyl ] -4-yl } oxy) -2-methylpropanoic acid, {5 '-chloro-3' -fluoro-2 '- [ (5-methylpyridine-3-sulfonyl) amino ] [1, 1' -biphenyl ] -4-yl } acetic acid, {5 '-chloro-2' - [ (4, 5-dimethylpyridine-3-sulfonyl) amino ] -3 '-fluoro [1, 1' -biphenyl ] -4-yl } acetic acid, ({3 ', 5' -dichloro-2 '- [ (5-methylpyridine-3-sulfonyl) amino ] [1, 1' -biphenyl ] -4-yl } acetic acid 1 ' -biphenyl ] -4-yl } oxy) acetic acid, 3- {5 ' -chloro-2 ' - [ (5-ethylpyridine-3-sulfonyl) amino ] -3 ' -fluoro [1, 1 ' -biphenyl ] -4-yl } propanoic acid and 2- {5 ' -chloro-3 ' -fluoro-2 ' - [ (5-methylpyridine-3-sulfonyl) amino ] [1, 1 ' -biphenyl ] -4-yl } propanoic acid.