CN110408680A - For detection of alkaline phosphatase, based on ligase amplified reaction catalysis assembling single quantum dot nano-sensor and application - Google Patents
For detection of alkaline phosphatase, based on ligase amplified reaction catalysis assembling single quantum dot nano-sensor and application Download PDFInfo
- Publication number
- CN110408680A CN110408680A CN201910576733.2A CN201910576733A CN110408680A CN 110408680 A CN110408680 A CN 110408680A CN 201910576733 A CN201910576733 A CN 201910576733A CN 110408680 A CN110408680 A CN 110408680A
- Authority
- CN
- China
- Prior art keywords
- alkaline phosphatase
- detection
- probe
- ligase
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/42—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving phosphatase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6825—Nucleic acid detection involving sensors
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to for detection of alkaline phosphatase, based on ligase amplified reaction catalysis assembling single quantum dot nano-sensor and application.The activation signal of alkaline phosphatase is identified and amplified using connection reaction for the first time: in the presence of alkaline phosphatase, the 3 '-phosphate terminal dephosphorylations for being catalyzed detection probe generate 3 '-C-terminals, hereafter it is connected using heat-staple DNA ligase triggering Cy5 probe with the circulating repetition of biotinylated probes, generates multiple Cy5- biotin double labelling signal probes；Signal probe completes self assembly on the surface of 605 quantum dots by the interaction of Streptavidin-biotin specificity, it realizes the high-efficiency fluorescence Resonance energy transfer (FRET) from 605 quantum dots to Cy5, is finally detected using single molecule fluorescence detection.On the contrary, then can't detect fluorescence resonance energy transfer signal when alkaline phosphatase is not present.Only need a kind of thermostabilization ligase that the detection sensitivity of superelevation can be realized, detection is limited down to 5.63 × 10‑7Units per ml.
Description
Technical field
The invention belongs to enzyme activity detection fields, and in particular to the single quantum dot based on the catalysis assembling of ligase amplified reaction
Nano-sensor is used for detection of alkaline phosphatase.
Background technique
Disclosing the information of the background technology part, it is only intended to increase understanding of the overall background of the invention, without certainty
It is considered as recognizing or implying in any form that information composition has become existing skill well known to persons skilled in the art
Art.
Alkaline phosphatase (ALP) is a kind of hydrolase being widely present in prokaryotes and eucaryote, can be in alkali
The protein, nucleic acid, sugar and the phosphate group on other biological molecule of catalytic elimination phosphorylation under the conditions of property, cell division,
Key effect is played in the normal physiological functions such as ostosis；Meanwhile intracellular alkaline phosphatase levels are lacked of proper care and hypophosphatemia, axis
A variety of human diseases such as property rachitis, bone disease and cancer are closely related, this becomes the potential of clinically relevant medical diagnosis on disease
Biomarker.In addition, alkaline phosphatase be also EIA enzyme immunoassay, histochemical staining and DNA hybridization analysis etc. in bioanalysis most
One of common biology beacon, therefore, efficient alkaline phosphatase activities biosensor to relative biological study,
Clinical diagnosis and bioanalysis application have great importance.
Before this, have been set up it is various based on colorimetric detection, chemiluminescence detection, Surface enhanced Raman scattering detection and it is glimmering
The determination of alkaline phosphatase activity method of light detection.The above method is usually using non-nucleic acid substrate such as p-nitrophenylphosphate
(PNPP), atriphos (ATP), guanosine monophosphate (GMP) and the chloro- 3- indolyl phosphate of the bromo- 4- of 5- etc., although also having out
The performance of color, but because these non-nucleic acid substrates cannot be expanded as nucleic acid with amplified signal in the detection process, make
The sensitivity for analysis for obtaining these methods is difficult to be promoted again.Currently, only a few methods realize height using the strategy of nucleic acid amplification
The alkaline phosphatase of sensitivity detects.However, these methods require to introduce a variety of enzymes and could complete signal amplification procedure；Such as,
The signal amplification method that the T7 exonuclease of molecular beacon starting mediates needs to follow using KF polymerase and T7 exonuclease
Chain index amplification method needs the dual signal amplification side mediated using Vent polymerase and Nt.BstNBI nickase, responsive transcription
Method is needed using lambda exonuclease and T7 RNA polymerase and double-stranded specific nuclease, this not only will increase analysis cost,
Analytic process is also set to become complicated simultaneously.Further, since nonspecific exonuclease digestion and DNA background amplification, these
The detection accuracy of analysis method may also be damaged.
DNA ligase is catalyzed by forming phosphodiester bond between 5'- phosphate terminal arranged side by side and 3'-hydroxyl terminal
Connect two independent DNA chain.Due to high fidelity and joint efficiency, DNA ligase is widely used in bio-sensing
Field；In addition, repeating the circulation that chain link reaction is easily carried out signal by using single thermostabilization ligase
Amplification.Such as, Ligase detection reaction is able to achieve the Linear Amplifer of signal by the connection to 2 target-specific probes, and connects
It connects enzyme chain reaction and can achieve the effect of exponential signal amplification by repeating two pairs of probes of connection.These high specifics, Gao Ling
The connection reaction of sensitivity has in the detection of the biomolecule such as DNA, RNA, microRNA, protein and organized enzyme widely answers
With, but method of the connection reaction at present for alkaline phosphatase activities detection has not been reported.
Quantum dot (QDs) has high photostability, high quantum production rate, wide absorption spectrum, narrow dimension is tunable emission spectrum
The excellent photophysical property with big Stokes shift etc. is a kind of very attractive biosensor component.In addition, introducing
Single Molecule Detection building the nano-sensor based on single quantum dot have analysis time is short, signal-to-noise ratio is high, sample consumption is low,
The excellent analysis performance such as sensitivity superelevation.But there are still selections currently based on the alkaline phosphatase activities detection method of quantum dot
Property the low and not high problem of sensitivity.
Summary of the invention
In order to overcome the above problem, the present invention develops a kind of single quantum dot based on the catalysis assembling of ligase amplified reaction
Nano-sensor is, it can be achieved that simple, sensitive alkaline phosphatase activities are analyzed.This nano-sensor only needs a kind of thermostabilization to connect
It connects enzyme to amplify for target alkaline phosphatase activities signal, with highly selective and superelevation sensitivity, detection is limited down to 5.63
×10-7Units per ml can further apply enzyme activity dynamic analysis, endogenous alkaline phosphorus in inhibitor screening and tumour cell
Phytase activity detection.
To realize the above-mentioned technical purpose, The technical solution adopted by the invention is as follows:
A kind of single quantum dot nanosensor for detection of alkaline phosphatase, based on the catalysis assembling of ligase amplified reaction
Device, comprising: detection probe, differentiate probe, Cy5 probe, biotinylated probes and quantum dot.
The application is to the concrete composition of detection probe and is not particularly limited, as long as the activity of alkaline phosphatase can be identified
Signal is simultaneously translated into DNA signal.In some embodiments, the detection probe by 5 ' to 3 ' sequence are as follows:
ATCGAGTGCACCTGACTCCTG-P, wherein P is that phosphorylation modification can be catalyzed detection probe in the presence of alkaline phosphatase
3 '-phosphate terminals (3 '-P) dephosphorylation generates 3 '-C-terminals (3 '-OH).
In the application, second level template after being denaturalized, then with the biotinylated probes of 5 '-phosphate terminals and 3 '-C-terminals
Cy5 probe is annealed, and promotees it and connect under the action of ligase to form biotin-Cy5 double labelling signal probe.Therefore, In
In some embodiments, the Cy5 probe has the nucleotide sequence of SEQ ID No.1: Cy5-ACGGCAGACTTCTCC；In heat
Under Denaturing, the second level template of denaturation can further trigger being connected by circulation for biotinylated probes and Cy5 probe, generation it is big
Amount Cy5- biotin double labelling signal probe is self-assembled to 605 quantum by efficient Streptavidin-biotin interaction
The surface of point.
In some embodiments, the differentiate probe has the nucleotide sequence of SEQ ID No.1: P-
GGAGAAGTCTGCCGTATCGAG；
In some embodiments, the biotinylated probes by 5 ' to 3 ' sequence are as follows: P-CAGGAGTCAGGTGCA-
biotin；
Double labelling signal probe completes self assembly on the surface of 605 quantum dots, can induce and occurs from 605 quantum dots to Cy5
Effective fluorescence resonance energy transfer.Therefore, in some embodiments, 605 quantum dot are as follows: the quantum of Streptavidin modification
Point, maximum emission wavelength 605nm effectively improve the sensitivity of detection.
The present invention also provides a kind of single quantum dot nano-sensor detections based on the catalysis assembling of ligase amplified reaction
The method of alkaline phosphatase, comprising:
Alkaline phosphatase and detection probe are mixed in buffer I, are incubated for, dephosphorylation reaction product is formed；
By above-mentioned phosphorylation reaction product, differentiate probe, DNA profiling, biotinylated probes, Cy5 probe, buffer II, DNA
Ligase mixing carries out the connection reaction of thermal cycle, forms connection product；
By the mixing of connection product and 605 quantum dots in buffer III, 605 quantum dots/Cy5 nanotube component is formed；
Single molecule fluorescence detection is carried out to 605 quantum dots/Cy5 nanotube component, fluorescence resonance energy transfer is believed if detecting
Number, then there is alkaline phosphatase, and fluorescence resonance energy transfer signal strength determines content of alkaline phosphatase；If being not detected glimmering
Alkaline phosphatase is then not present in photoresonance energy transfer signal.
The advantage of the above method is: the present invention only needs a kind of heat-staple ligase that signal amplification can be completed, and simplifies
Analysis program；The false positive results generated by non-specific digestion and non-specific DNA cloning are avoided simultaneously, are improved
Detection sensitivity.The present invention can also further apply enzyme activity dynamic analysis, the screening of activity inhibitor and different cells
The active detection of endogenous alkaline phosphatase in system mentions for the relevant biomedical research of alkaline phosphatase and clinical application research
Strong technology platform is supplied.
In some embodiments, the actual conditions of the incubation are as follows: be incubated for 28~30 minutes under 37~38 degrees Celsius, In
4~5 minutes are incubated under 65~67 degrees Celsius to terminate reaction.
In some embodiments, the actual conditions of the connection reaction of the thermal cycle be according to 95 degrees Celsius 1 minute, 58 take the photograph
2 minutes programs of family name's degree carry out the connection reaction of 80 thermal cycles.
The present invention also provides any above-mentioned nano-sensors in Inhibitors of Alkaline Phosphatase screening experiment, alkaline phosphatase
In the actual sample of enzyme enzyme activity kinetic determination and complicated component in the high sensitivity, specific detection of alkaline phosphatase activities
Application.
The beneficial effects of the present invention are:
(1) easy to operate: the method for using nucleic acid amplification detection of alkaline phosphatase compared to other, the present invention are more without introducing
It plants enzyme and only needs a kind of ligase that signal amplification can be completed, this not only lowers analysis costs, while also simplifying and analyzing
Journey；Further, since the use of high-fidelity thermostabilization ligase, avoids nonspecific exonuclease digestion and non-specificity
DNA background amplification, therefore detection accuracy of the invention is also guaranteed.
(2) high-efficient, effect is good: the ligation amplification reaction in the present invention can reach preferable amplification in 80 circulations
The introducing of effect, monomolecular detection method has been greatly reduced data processing difficulty, improves the intuitive sum number of data presentation
According to treatment effeciency, the efficient simple measurement to alkaline phosphatase activities is realized.
(3) high sensitivity, application potential are huge: in the present invention, due to the connection enzymatic amplification of alkaline phosphatase enzyme induction generation
Useful signal caused by reacting amplifies, is caused by the way that multiple double labelling signal probes are assembled on single 605 quantum dot
High transferring efficiency of fluorescence resonance energy and the intrinsic high sensitivity of Single Molecule Detection itself, therefore detect limit down to 5.63 ×
10-7Units per ml, better than most existing alkaline phosphatase activities detection methods；In addition, the present invention is also able to achieve to alkalinity
The active quantitative detection of phosphatase catalytic, and the experiment about Inhibitors of Alkaline Phosphatase screening can be carried out well, also it can be used
In the interior alkaline phosphatase enzyme activity of the actual sample (cancer cell) of the dynamic (dynamical) related assays of alkaline phosphatase enzyme activity and complicated component
The sensitive determination of property, has wide range of applications, research potential is larger.
(4) specificity is good: since high-fidelity thermostabilization ligase used in the present invention is to alkaline phosphatase activities signal
Specific recognition and conversion so that present invention detection with higher is specific；In addition, the present invention is to every reaction condition
Careful optimization is done, therefore it is more outstanding to detect specificity.
Detailed description of the invention
The accompanying drawings constituting a part of this application is used to provide further understanding of the present application, and the application's shows
Meaning property embodiment and its explanation are not constituted an undue limitation on the present application for explaining the application.
Fig. 1: the single quantum dot nano-sensor based on the catalysis assembling of ligase amplified reaction in embodiment 1 is used for alkaline phosphorus
The schematic diagram of sour enzyme analysis.
Fig. 2: (A) lacks (control group) and there are connection products when alkaline phosphatase (1 units per ml) in embodiment 1
Gel electrophoresis analysis.(B) 605 quantum dots and Cy5 without (control group, black line) and have alkaline phosphatase (1 units per ml, it is red
Line) in the case where fluorescence emission spectrum.The fluorescence emission spectrum that illustration is enlarged and displayed from 650 nanometers to 700 nanometer.
Fig. 3: in embodiment 1 there is no (A-C) and in the case where there is (D-F) alkaline phosphatase (0.1 units per ml),
The single molecular fluorescence image of 605 quantum dots and Cy5.The mux --out signal exhibits of 605 quantum dots are green (A and D), the mux --out signal exhibits of Cy5
For red (B and E), the superposed signal of 605 quantum dots and Cy5 are shown as yellow (C and F).Scale bar length is 2 microns.
Fig. 4: in embodiment 1 in the concentration range of 0-2 units per ml, with the increase of alkaline phosphatase concentration, Cy5
The increase of monomolecular counting.Illustration shows the logarithm of Cy5 monomolecular counting and alkaline phosphatase concentration 1 × 10-6- 0.1 is single
Linear relationship in the every milliliter of range in position.The standard deviation of error bar expression three repeated experiments.
Fig. 5: in embodiment 1 in TDG (0.1 units per ml), HhaI (0.1 units per ml), (50 nanomoles are every by GOX
Rise), the Cy5 monomolecular counting that measures in the presence of BSA (50 every liter of nanomole) and alkaline phosphatase (0.1 units per ml).Accidentally
Poor stick indicates the standard deviation of three repeated experiments.
Fig. 6: inhibitory effect of the sodium vanadate of various concentration to alkaline phosphatase activity of enzyme reaction in embodiment 1.Alkaline phosphatase
The concentration of enzyme is 0.1 units per ml.The standard deviation of error bars expression three repeated experiments.
Specific embodiment
It is noted that following detailed description is all illustrative, it is intended to provide further instruction to the application.Unless another
It indicates, all technical and scientific terms used in this application have logical with the application person of an ordinary skill in the technical field
The identical meanings understood.
It should be noted that term used herein above is merely to describe specific embodiment, and be not intended to restricted root
According to the illustrative embodiments of the application.As used herein, unless the context clearly indicates otherwise, otherwise singular
Also it is intended to include plural form, additionally, it should be understood that, when in the present specification using term "comprising" and/or " packet
Include " when, indicate existing characteristics, step, operation, device, component and/or their combination.
It is low, clever for selectivity existing for current alkaline phosphatase activities detection method as background technique is introduced
The not high and complicated for operation problem of sensitivity.Therefore, present invention proposition constructs a kind of based on the catalysis assembling of ligase amplified reaction
Novel simple, the overdelicate alkaline phosphatase enzyme assay method of single quantum dot nano-sensor.
Accurate identification has been carried out to alkaline phosphatase activities signal using connection reaction for the first time, and has been translated into DNA
Nucleic acid signal can efficiently generate a large amount of Cy5- biotin double labelling signal probes by ligase amplified reaction.Then should
Double labelling signal probe completes self assembly on the surface of 605 quantum dots, and then induces and occur from 605 quantum dots to the effective of Cy5
Fluorescence resonance energy transfer.In conjunction with Single Molecule Detection, this nano-sensor has the sensitivity of superelevation, detection limit down to 5.63 ×
10-7Units per ml, compared with the alkaline phosphatase activities analysis method of a variety of enzymes auxiliary amplification, the present invention only needs a kind of heat steady
Signal amplification can be completed in fixed ligase, simplifies analysis program；It avoids simultaneously because of non-specific digestion and non-specificity
DNA cloning and the false positive results generated, improve detection sensitivity.The present invention can also further apply enzyme activity power credit
The active detection of endogenous alkaline phosphatase in analysis, the screening of activity inhibitor and different cell lines, is alkaline phosphatase phase
The biomedical research of pass and clinical application research provide strong technology platform.
Caused by the ligase amplified reaction that the nano-sensor that the present invention constructs occurs as alkaline phosphatase enzyme induction
Useful signal amplifies, by the way that multiple double labelling signal probes to be assembled into high fluorescence resonance caused on single 605 quantum dot
The intrinsic high sensitivity of energy transfer efficiency and Single Molecule Detection itself, therefore limit is detected down to 5.63 × 10-7The every milli of unit
It rises.The carbon quantum dot fluorescent method (1.4 × 10 of no signal amplification is compared in sensitivity-3Units per ml) 2222 times are improved, phase
Dual signal than being mediated based on responsive transcription amplifies Taqman fluorescence probe method (2 × 10-5Units per ml) improve 35 times.
The alkaline phosphatase activities analysis method reported before this is due to the interference vulnerable to unrelated biomolecule, or because non-specific
Property digestion and non-specific DNA cloning and generate false positive results, therefore its specificity is often relatively more limited.The present invention is by institute
Specific recognition and conversion of the high-fidelity thermostabilization ligase used to alkaline phosphatase activities signal, detection with higher
Specificity.
The present invention had both been able to achieve the quantitative detection to alkaline phosphatase enzymatic activity, can also carry out well about alkaline phosphorus
The experiment of sour inhibitor sifting；In addition, the present invention can also be used in the dynamic (dynamical) related assays of alkaline phosphatase enzyme activity and at
The sensitive determination for dividing complicated actual sample (cancer cell) interior alkaline phosphatase activities, has wide range of applications.
It is illustrated below by way of technical solution of the specific embodiment to the application.Wherein, 605 quantum dots are received for 605
The quantum dot (Qdot 605ITK) of rice is bought from match Mo Feishier company (Eugene, Oregon, the U.S.).
Embodiment 1:
1. fluorescence detection is tested
The preparation of cell extract: by human breast cancer cell (MCF-7) and human embryonic kidney cells (HEK293T) respectively with containing
10% fetal calf serum (FBS) and the dual anti-Dahl Burke Improved Eagle Medium (DMEM) of 1% Pen .- Strep are taken the photograph 37
Family name's degree, containing cultivated in 5% carbon dioxide incubator and for actual sample analyze.Logarithmic growth phase is grown into cell
When, cell is collected using trypsase, and use the automatic cell counter IC1000 of Countstar Bioisystech Co., Ltd
It is counted.Gained cell is washed twice with ice-cold PBS (pH7.4), is centrifuged 5 minutes and is carried out using the speed of 1000 revolutions per minute
Then separation is suspended in 50 microlitres of cell pyrolysis liquid (the trihydroxy methyl amino first for being 8.0 containing 10 mMs of every liter of pH
Alkane-hydrochloric acid, 150 mMs every liter of sodium chloride, 1% NP-40,0.25 mM every liter of NaTDC, 1% glycerol
With 0.1 mM every liter 4- (2- amino-ethyl) benzene sulfonyl fluorine hydrochloride) in, it is every at 12000 turns after being incubated for 30 minutes on ice
It is centrifuged 20 minutes under the revolving speed divided in 4 degrees Celsius.Supernatant is transferred in new pre-cooling EP pipe and in -80 degrees Celsius of refrigerators
In store for future use.The total protein concentration in extracting solution is measured using NanoDrop2000c spectrophotometer.
Alkaline phosphatase activities detection: in order to form dephosphorylized detection probe, preparing 20 microlitres of reaction system,
In the alkaline phosphatase containing 2 microlitres of various concentrations, the detection probe of 0.15 microlitre of 10 every liter of micromole and 2 microlitre 10 ×Buffer (500 mMs every liter of potassium acetate, 200 mMs every liter of trihydroxy ammonia methane-acetic acid, 100 millis
Mole every liter of magnesium acetate, the BSA of 1000 micrograms per millilitres, pH7.9), it is incubated for 30 minutes under 37 degrees Celsius, it is Celsius 65
Degree is lower to be incubated for 5 minutes to terminate reaction.Hereafter, dephosphorylation reaction product and the identification of 0.15 microlitre of 5 every liter of micromole are visited
Needle, the DNA profiling of 0.15 microlitre of 5 every liter of micromole, the biotinylated probes of 1.2 microlitre of 5 every liter of micromole, 1.2 microlitre of 5 micromole
Every liter of Cy5 probe, 3 microlitre 10 × reaction buffer (trihydroxy ammonia methane-hydrochloric acid containing 200 mMs of every liter of pH8.3,
250 mMs of every liter of potassium chloride, 100 mMs every liter of magnesium chloride, 5 mMs every liter of NAD and 0.1%X-
100), 10 unitsDNA ligase mixes and reaction volume is adjusted to 30 microlitres, according to 95 degree Celsius 1
Minute, 58 degrees Celsius of 2 minutes programs carry out the connection reaction of 80 thermal cycles.Finally, at room temperature by connection product with
605 quantum dots of 8.3 every liter of nanomoles are in 60 microlitres of buffers (containing 1.5 mMs every liter of magnesium chloride, 50 mMs every liter
Trihydroxy ammonia methane-hydrochloric acid, 5 mMs every liter of ammonium sulfate, pH8.0) in mixing 10 minutes to form 605 quantum dots/Cy5
Nanotube component.
Fluorescence measurement: 50 microlitres of reactions are measured on Hitachi's F-7000 sepectrophotofluorometer using micro silica dish and are produced
Object.Excitation wavelength is set as 488 nanometers, while recording the emission spectrum in 500-720 nanometer wavelength range, excitation and transmitting
Slit width is 5 nanometers.
Single molecular fluorescence surveys fixed sum data analysis: by reaction product in imaging buffer (containing 1 milligram every milliliter of glucose
Oxidizing ferment, the D-Glucose of 0.4% (mass volume ratio), 0.04% milligram every milliliter of catalase, 50 micrograms per millilitres
Bovine serum albumin, 67 mMs every liter of glycine-potassium hydroxide, 1 milligram every milliliter of watermiscible vitamin E, 2.5 milligrams
Every milliliter of magnesium chloride, pH9.4) in dilution 100 times.10 microlitres of above-mentioned samples are drawn using liquid-transfering gun directly to drip on coverslip
To be imaged for TIRF, 605 quantum dots are excited using 488 nano laser of sapphire (50 milliwatt), 605 quantum dots and Cy5's
Luminous signal by 100 × Olympus object lens be collected, and by Andorra IxonDU897EMCCD with 500 milliseconds of exposure
Time image selects the image-region of 900 × 900 pixels to count Cy5 molecule using Image J software.
Gel electrophoresis: with 12% denaturing polyacrylamide gel electrophoresis to even under room temperature and 120 volts of constant voltage
The product for connecing enzymatic amplification reaction is analyzed, using 1 × tbe buffer liquid (the trihydroxy ammonia first containing 9 mMs of every liter of pH 7.9
Alkane-hydrochloric acid, 9 mMs every liter of boric acid and 0.2 mM every liter of EDTA), electrophoresis time is 50 minutes.Hereafter, using silver
Staining kit dyes the gel, and carries out shooting analysis by Bio-Rad ChemiDoc MP imaging system.
Alkaline phosphatase activities Inhibition test: the function and effect in order to assess Inhibitors of Alkaline Phosphatase, by 2 microlitres of differences
The alkaline phosphatase of the sodium vanadate of concentration and 2 microlitre of 1 units per ml premixes 20 minutes under 37 degrees Celsius；Hereafter, to mixing
In object be added 2 microlitre 10 ×The detection probe of buffer and 0.15 microlitre of 10 every liter of micromole simultaneously use ultrapure water
Reaction system is adjusted to 20 microlitres.Subsequent process is detected with alkaline phosphatase activities.
Experimental principle (such as Fig. 1): it uses the single stranded DNA of 3 '-terminal phosphates as detection probe, identifies alkaline phosphatase
Activation signal and be translated into DNA signal.In the presence of alkaline phosphatase, 3 '-phosphate terminals of detection probe can be catalyzed
(3 '-P) dephosphorylation generates 3 '-C-terminals (3 '-OH).The auxiliary of the 3 '-C-terminal probe and 5 '-phosphate terminals is visited
Needle can be with the annealed formation detection probe/assist probes/template interlayer structure of template probe.Heat-staple ligase is added,
Detection probe and assist probes connect into 1 DNA chain and form second level template.Second level template is last after being denaturalized, then with 5 '-phosphoric acid
The Cy5 probe of the biotinylated probes at end and 3 '-C-terminals is annealed, and is promoted it and is connected formation life under the action of ligase
Object element-Cy5 double labelling signal probe.In addition, the second level template of denaturation can further trigger biotin under the conditions of thermal denaturation
Probe and Cy5 probe are connected by circulation, and a large amount of Cy5- biotin double labelling signal probes of generation are affine by efficient strepto-
Element-biotin interaction is self-assembled to the surface of 605 quantum dots.Formed as a result, 605 quantum dots/double labelling signal probe/
The distance of Cy5 nanotube component, 605 quantum dots and Cy5 are close, therefore the high-efficiency fluorescence that can occur from 605 quantum dots to Cy5 is total
Vibration energy transfer.Single molecule fluorescence detection can with simple and sensitive detect the fluorescence resonance energy of each quantum dot nano component
Transfer signal.On the contrary, 3 '-phosphate terminals of detection probe are retained in the presence of without alkaline phosphatase, it cannot be with assist probes
Connection forms second level template, therefore, it is impossible to generate Cy5- biotin double labelling signal probe, is only assembled with life on 605 quantum dots
Object element probe, cannot cause fluorescence resonance energy transfer phenomenon.It is worth noting that, in the present invention, the thermostabilization of high-fidelity
Ligase can be catalyzed effective amplification of alkaline phosphatase activities signal, this will greatly improve the sensitivity of analysis, have higher
Ease for operation and accuracy.
2. the experimental verification of principle
The present invention analyzes the company of alkaline phosphatase induced synthesis with 12% denaturing polyacrylamide gel electrophoresis silver staining
It practices midwifery object.As shown in Figure 2 A, in the presence of alkaline phosphatase, the connection that can trigger detection probe and assist probes is formed
Secondary template, also can trigger Cy5 probe and the connection of biotinylated probes forms double labelling signal probe, this is reflected in two on glue figure
Secondary template and the corresponding band of signal probe.On the contrary, in the control group of not alkaline phosphatase, secondary template and signal probe
Band disappears, and in the presence of showing no alkaline phosphatase, the amplified reaction for connecting enzymatic can not occur.
The present invention further demonstrates 605 quantum dots/signal probe/Cy5 nanotube component in alkaline phosphorus using fluoremetry
Assembling under sour enzyme induction.As shown in Figure 2 B, in the case where no alkaline phosphatase, Cy5- biotin double labelling cannot be generated
Signal probe, therefore biotinylated probes are only assembled on the surface of 605 quantum dots, therefore only observe the fluorescence hair of 605 quantum dots
Penetrate signal (Fig. 2 B, blue line).It is reacted on the contrary, alkaline phosphatase can induce generation biotinylated probes with the connection between Cy5 probe,
It forms complete double labelling signal probe and is assembled in the surface of 605 quantum dots, generate effective fluorescence resonance energy transfer, because
This observes the reduction of 605 quantum dot fluorescences transmitting signal and the increase (Fig. 2 B, red line) of Cy5 fluorescent emission signals.According to side
Formula E (%)=1-FALP/F (FALPThe fluorescence intensity of 605 quantum dots in the presence of alkaline phosphatase, F be alkaline phosphatase not
In the presence of 605 quantum dots fluorescence intensity) calculate gained fluorescence resonance energy transfer efficiency be 51.06%.
Compared with traditional fluorescence analysis, Single Molecule Detection is with sample consumption is few, analysis time is short, sensitivity
High remarkable advantage.Therefore the present invention further determines the fluorescence letter of single quantum dot using total internal reflection fluorescent imaging technique
Number.As shown in Fig. 3, in the case where no alkaline phosphatase, the fluorescence signal (Fig. 3 A) of 605 quantum dots is only observed, and do not have
There is the fluorescence signal (Fig. 3 B) for observing Cy5, shows in the absence of alkaline phosphatase, not formed 605 quantum dots/double labelling
Signal probe/Cy5 nanotube component, therefore there is no fluorescence resonance energy transfer.On the contrary, after adding alkaline phosphatase, together
When observe the fluorescence signal of 605 quantum dots (Fig. 3 D) and Cy5 (Fig. 3 E) and perfect can be superimposed (Fig. 3 F), this shows due to 605
Quantum dot/double labelling signal probe/Cy5 nanotube component formation and produce effective fluorescence resonance energy transfer.These knots
Fruit clearly illustrates that the nano-sensor proposed by the invention based on single quantum dot can be used for alkaline phosphatase activities
Quantitative detection.
3. sensitivity experiment
Under the experiment condition of optimization, the present invention measures the corresponding Cy5 monomolecular counting of various concentration alkaline phosphatase
To assess sensitivity for analysis of the invention.Such as Fig. 4, as alkaline phosphatase concentration increases to 2 units per mls, the list of Cy5 from 0
Numerator counts gradually increase.Meanwhile the monomolecular counting of Cy5 is 1 × 10-6In to the concentration range of 0.1 units per ml and alkali
Linearly related, linearly dependent coefficient (R is presented in the logarithm of acid phosphatase concentration2) it is 0.9987.Equation of linear regression is N=
278.20+36.87log10C, wherein N is the monomolecular counting of Cy5, and C is the concentration (units per ml) of alkaline phosphatase.Pass through
The average signal of control group is limited to 5.63 × 10 plus detection determined by three times standard deviation-7Units per ml.Institute of the present invention
The carbon quantum dot fluorescent method (1.4 × 10 of no signal amplification is compared in the sensitivity of the nano-sensor of building-3Units per ml)
It is 2222 times high, amplify Taqman fluorescence probe method (2 × 10 compared to the dual signal mediated based on responsive transcription-5Units per ml)
It is 35 times high.The sensitivity of superelevation of the present invention is attributable to: (1) the ligase amplified reaction that alkaline phosphatase enzyme induction occurs is produced
Raw useful signal amplification；(2) by the way that multiple double labelling signal probes to be assembled into Gao Ying caused on single 605 quantum dot
Photoresonance energy transfer efficiency；(3) the intrinsic high sensitivity of Single Molecule Detection itself.
4. specificity experiments
The alkaline phosphatase activities analysis method reported before this is due to the interference vulnerable to unrelated biomolecule, or because non-specific
Property digestion and non-specific DNA cloning and generate false positive results, therefore its specificity is often relatively more limited.In order to examine this hair
Bright specific analytical effect, the present invention measure Cy5 monomolecular counting signal to thymidine DNA glycosylase (TDG),
The difference bioturbation object such as HhaI restriction nuclease enzyme (HhaI), glucose oxidase (GOX) and bovine serum albumin(BSA) (BSA)
Response.TDG can remove the part of thymidine from G/T mispairing, and HhaI can be identified and be cut 5 '-GCGC-3 ' double-strand
DNA, GOX can be catalyzed glucose and be oxidized to hydrogen peroxide and maltonic acid-delta-lactone, and BSA is a kind of common uncorrelated
Albumen.Theoretically, these enzymes and albumen not can induce the dephosphorylation of detection probe, therefore can't detect the fluorescence letter of Cy5
Number.As shown in figure 5, detect high Cy5 signal in the presence of alkaline phosphatase, and existing for TDG, HhaI, GOX and BSA
In the case of observe extremely low Cy5 signal.The response signal of alkaline phosphatase is TDG, HhaI, GOX and BSA response signal respectively
13.22 times, 12.13 times, 14.41 times and 13.16 times.Therefore the present invention has the specificity of height, this can be attributed to height
Specific recognition and conversion of the use of fidelity thermostabilization ligase to alkaline phosphatase activities signal.
5. inhibitors experiment
The inhibitor of alkaline phosphatase is a kind of potential disease therapeuticing medicine, can inhibit vascular smooth muscle cells calcium
Change, for treating cardiovascular disease.The present invention uses a kind of famous Inhibitors of Alkaline Phosphatase sodium vanadate (Na3VO4) test
The present invention is used for the ability of alkaline phosphatase activities inhibition analysis.As shown in fig. 6, with the increase of vanadic acid na concn, alkaline phosphorus
Dose dependent decline is presented in the relative activity of sour enzyme.It is computed, 503nhibiting concentration IC50For 87.69 every liter of micromoles, and use
Method (141.9 every liter of micromole) result based near infrared fluorescent probe is similar, this shows that the present invention can be used for alkaline phosphatase
The screening of enzyme inhibitor, and selectivity with higher.Huge potentiality are shown in terms of drug development and disease treatment.
Finally it should be noted that the foregoing is only a preferred embodiment of the present invention, it is not limited to this hair
It is bright, although the present invention is described in detail referring to the foregoing embodiments, for those skilled in the art, still
It can modify to technical solution documented by previous embodiment, or part is equivalently replaced.It is all in this hair
Within bright spirit and principle, any modification, equivalent replacement, improvement and so on should be included in protection scope of the present invention
Within.Above-mentioned, although specific embodiments of the present invention have been described, and it is not intended to limit the protection scope of the present invention, institute
Category field technical staff should be understood that based on the technical solutions of the present invention those skilled in the art do not need to pay wound
The various modifications or changes that the property made labour can be made are still within protection scope of the present invention.
Claims (10)
1. a kind of single quantum dot nanosensor for detection of alkaline phosphatase, based on the catalysis assembling of ligase amplified reaction
Device characterized by comprising detection probe, differentiate probe, Cy5 probe, biotinylated probes and 605 quantum dots.
2. single amount being used for detection of alkaline phosphatase as described in claim 1, being assembled based on the catalysis of ligase amplified reaction
Son point nano-sensor, which is characterized in that the detection probe by 5 ' to 3 ' sequence are as follows: ATCGAGTGCACCTGACTCCTG-
P, wherein P is phosphorylation modification.
3. single amount being used for detection of alkaline phosphatase as described in claim 1, being assembled based on the catalysis of ligase amplified reaction
Son point nano-sensor, which is characterized in that the Cy5 probe has the nucleotide sequence of SEQ ID No.1: Cy5-
ACGGCAGACTTCTCC。
4. single amount being used for detection of alkaline phosphatase as described in claim 1, being assembled based on the catalysis of ligase amplified reaction
Son point nano-sensor, which is characterized in that the differentiate probe has the nucleotide sequence of SEQ ID No.1: P-
GGAGAAGTCTGCCGTATCGAG。
5. single amount being used for detection of alkaline phosphatase as described in claim 1, being assembled based on the catalysis of ligase amplified reaction
Son point nano-sensor, which is characterized in that the biotinylated probes by 5 ' to 3 ' sequence are as follows: P-CAGGAGTCAGGTGCA-
biotin。
6. single amount being used for detection of alkaline phosphatase as described in claim 1, being assembled based on the catalysis of ligase amplified reaction
Son point nano-sensor, which is characterized in that 605 quantum dots are as follows: the quantum dot of Streptavidin modification, maximum emission wavelength are
605nm。
7. a kind of method of the single quantum dot nano-sensor detection of alkaline phosphatase based on the catalysis assembling of ligase amplified reaction,
It is characterised by comprising:
Alkaline phosphatase and detection probe are mixed in buffer I, are incubated for, dephosphorylation reaction product is formed；
By above-mentioned phosphorylation reaction product, differentiate probe, DNA profiling, biotinylated probes, Cy5 probe, buffer II, DNA connection
Enzyme mixing carries out the connection reaction of thermal cycle, forms connection product；
By the mixing of connection product and 605 quantum dots in buffer III, 605 quantum dots/Cy5 nanotube component is formed；
Single molecule fluorescence detection is carried out to 605 quantum dots/Cy5 nanotube component, if detecting fluorescence resonance energy transfer signal,
There are alkaline phosphatases, and fluorescence resonance energy transfer signal strength determines content of alkaline phosphatase；If it is total that fluorescence is not detected
Shake energy transfer signal, then alkaline phosphatase is not present.
8. the method for claim 7, which is characterized in that the actual conditions of the incubation are as follows: under 37~38 degrees Celsius
It is incubated for 28~30 minutes, is incubated for 4~5 minutes under 65~67 degrees Celsius to terminate reaction.
9. the method for claim 7, which is characterized in that the actual conditions of the connection reaction of the thermal cycle are according to 95
Degree Celsius 1 minute, 58 degrees Celsius of 2 minutes programs carry out the connection reaction of 80 thermal cycles.
10. nano-sensor described in claim 1-6, in Inhibitors of Alkaline Phosphatase screening experiment, alkaline phosphatase enzyme activity is dynamic
Application in the actual sample of dynamics measurement and complicated component in the high sensitivity, specific detection of alkaline phosphatase activities.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910576733.2A CN110408680A (en) | 2019-06-28 | 2019-06-28 | For detection of alkaline phosphatase, based on ligase amplified reaction catalysis assembling single quantum dot nano-sensor and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910576733.2A CN110408680A (en) | 2019-06-28 | 2019-06-28 | For detection of alkaline phosphatase, based on ligase amplified reaction catalysis assembling single quantum dot nano-sensor and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110408680A true CN110408680A (en) | 2019-11-05 |
Family
ID=68358711
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910576733.2A Pending CN110408680A (en) | 2019-06-28 | 2019-06-28 | For detection of alkaline phosphatase, based on ligase amplified reaction catalysis assembling single quantum dot nano-sensor and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110408680A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112048544A (en) * | 2020-09-04 | 2020-12-08 | 重庆工商大学 | Detection method based on target protease autocatalytic property |
| CN114250271A (en) * | 2021-11-29 | 2022-03-29 | 山东师范大学 | Non-amplification single quantum dot biosensor for detecting TET2 at single molecule level and detection method and application thereof |
| CN114457159A (en) * | 2022-02-24 | 2022-05-10 | 珠海圣美生物诊断技术有限公司 | Method for detecting tumor cells or tumor cell fragments |
| CN114517225A (en) * | 2021-12-08 | 2022-05-20 | 山东师范大学 | Single-molecule fluorescent biosensor for detecting alkaline phosphatase and method thereof |
| CN116926160A (en) * | 2023-09-15 | 2023-10-24 | 江苏康为世纪生物科技股份有限公司 | Enzyme activity detection kit for T4 DNA ligase and enzyme activity determination method |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070269825A1 (en) * | 2006-03-08 | 2007-11-22 | Atila Biosystems, Inc. | Method and kit for nucleic acid sequence detection |
| WO2011090445A1 (en) * | 2010-01-22 | 2011-07-28 | Huseyin Avni Oktem | Method for detection of non-labeled pcr products on sandwich hybridization based array platforms |
| CN106990084A (en) * | 2017-05-27 | 2017-07-28 | 山东师范大学 | A kind of being used for based on single quantum dot detects the nano-sensor of dnmt rna |
| CN107604042A (en) * | 2017-09-22 | 2018-01-19 | 山东师范大学 | The method of detection terminal deoxynucleotidyl transferase activity based on single quantum dot |
| CN108018336A (en) * | 2018-01-05 | 2018-05-11 | 山东师范大学 | A kind of DNA methylation detection kit and its application method |
| CN109161583A (en) * | 2018-09-06 | 2019-01-08 | 山东师范大学 | The method for the cycle index augmentation detection alkaline phosphatase that primer dephosphorylation causes |
-
2019
- 2019-06-28 CN CN201910576733.2A patent/CN110408680A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070269825A1 (en) * | 2006-03-08 | 2007-11-22 | Atila Biosystems, Inc. | Method and kit for nucleic acid sequence detection |
| WO2011090445A1 (en) * | 2010-01-22 | 2011-07-28 | Huseyin Avni Oktem | Method for detection of non-labeled pcr products on sandwich hybridization based array platforms |
| CN106990084A (en) * | 2017-05-27 | 2017-07-28 | 山东师范大学 | A kind of being used for based on single quantum dot detects the nano-sensor of dnmt rna |
| CN107604042A (en) * | 2017-09-22 | 2018-01-19 | 山东师范大学 | The method of detection terminal deoxynucleotidyl transferase activity based on single quantum dot |
| CN108018336A (en) * | 2018-01-05 | 2018-05-11 | 山东师范大学 | A kind of DNA methylation detection kit and its application method |
| CN109161583A (en) * | 2018-09-06 | 2019-01-08 | 山东师范大学 | The method for the cycle index augmentation detection alkaline phosphatase that primer dephosphorylation causes |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112048544A (en) * | 2020-09-04 | 2020-12-08 | 重庆工商大学 | Detection method based on target protease autocatalytic property |
| CN114250271A (en) * | 2021-11-29 | 2022-03-29 | 山东师范大学 | Non-amplification single quantum dot biosensor for detecting TET2 at single molecule level and detection method and application thereof |
| CN114250271B (en) * | 2021-11-29 | 2024-03-08 | 山东师范大学 | Amplification-free single quantum dot biosensor for detecting TET2 at single molecule level and detection method and application thereof |
| CN114517225A (en) * | 2021-12-08 | 2022-05-20 | 山东师范大学 | Single-molecule fluorescent biosensor for detecting alkaline phosphatase and method thereof |
| CN114517225B (en) * | 2021-12-08 | 2024-04-05 | 山东师范大学 | Single-molecule fluorescent biosensor for detecting alkaline phosphatase and method thereof |
| CN114457159A (en) * | 2022-02-24 | 2022-05-10 | 珠海圣美生物诊断技术有限公司 | Method for detecting tumor cells or tumor cell fragments |
| CN114457159B (en) * | 2022-02-24 | 2023-09-19 | 珠海圣美生物诊断技术有限公司 | Method for detecting tumor cells or tumor cell fragments |
| CN116926160A (en) * | 2023-09-15 | 2023-10-24 | 江苏康为世纪生物科技股份有限公司 | Enzyme activity detection kit for T4 DNA ligase and enzyme activity determination method |
| CN116926160B (en) * | 2023-09-15 | 2023-12-19 | 江苏康为世纪生物科技股份有限公司 | Enzyme activity detection kit for T4DNA ligase and enzyme activity determination method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110408680A (en) | For detection of alkaline phosphatase, based on ligase amplified reaction catalysis assembling single quantum dot nano-sensor and application | |
| Tan et al. | Recent advances in recombinase polymerase amplification: Principle, advantages, disadvantages and applications | |
| Qin et al. | Emerging biosensing and transducing techniques for potential applications in point-of-care diagnostics | |
| CN110398481B (en) | Single quantum dot fluorescence nano sensor based on enzyme-free catalysis self-assembly and preparation method and application thereof | |
| CN108588178A (en) | A kind of kit and its method of detection of alkaline phosphatase | |
| Ma et al. | Ligase amplification reaction-catalyzed assembly of a single quantum dot-based nanosensor for sensitive detection of alkaline phosphatase | |
| CN106990084A (en) | A kind of being used for based on single quantum dot detects the nano-sensor of dnmt rna | |
| JP2005504543A (en) | An adaptive baseline algorithm for quantitative PCR | |
| CN110144384A (en) | The fluorescence chemical sensor and its detection method of a kind of test side intragranular oxidative damage and application | |
| US20230332255A1 (en) | Crispr-cas-based detection of sars-cov-2 using recombinase polymerase amplification | |
| Li et al. | Integration of single-molecule detection with magnetic separation for multiplexed detection of DNA glycosylases | |
| Feng et al. | Label-free optical bifunctional oligonucleotide probe for homogeneous amplification detection of disease markers | |
| Wang et al. | Target-fueled catalytic hairpin assembly for sensitive and multiplex microRNA detection | |
| Zhang et al. | Catalytic single-molecule Förster resonance energy transfer biosensor for uracil-DNA glycosylase detection and cellular imaging | |
| CN109161583A (en) | The method for the cycle index augmentation detection alkaline phosphatase that primer dephosphorylation causes | |
| CN111172235A (en) | Biosensor for detecting cathepsin B and detection method and application thereof | |
| CN107109481A (en) | Foranalysis of nucleic acids | |
| CN107083437B (en) | Method for simultaneously detecting multiple DNA glycosylases by using inherent fluorescent nucleotide ultrasensitiveness | |
| Jiang et al. | A dual-labeled fluorescence quenching lateral flow assay based on one-pot enzyme-free isothermal cascade amplification for the rapid and sensitive detection of pathogens | |
| CN116287129B (en) | Ultra-short chain miRNA detection method and system based on reverse-folded crRNA | |
| CN114507706B (en) | Enzyme DNA repair cascade driving fluorophore coding/de-coding based biosensor and application thereof in telomerase detection | |
| CN114517225B (en) | Single-molecule fluorescent biosensor for detecting alkaline phosphatase and method thereof | |
| US20210388420A1 (en) | Method for detecting a plurality of short-chain nucleic acid in sample, combinatorial analysis kit, analysis kit supply management method | |
| JP2003527866A (en) | Methods for detecting polynucleotide kinase and their use as labels | |
| Lei et al. | Non-canonical CRISPR/Cas12a-based technology: A novel horizon for biosensing in nucleic acid detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191105 |