CN114456949A

CN114456949A - Beauveria bassiana JSHA-MD912 and application thereof

Info

Publication number: CN114456949A
Application number: CN202210037726.7A
Authority: CN
Inventors: 陶刚; 孟玉; 姚遐俊; 常峻嘉
Original assignee: Guizhou Minzu University
Current assignee: Guizhou Minzu University
Priority date: 2022-01-13
Filing date: 2022-01-13
Publication date: 2022-05-10
Anticipated expiration: 2042-01-13
Also published as: CN114456949B

Abstract

The invention discloses beauveria bassiana JSHA-MD912 and application thereof, belonging to the technical field of microorganisms. The strain is a beauveria bassiana fungus strain, the beauveria bassiana fungus strain is Beauverian sp.JSHA-MD912, the preservation unit is China center for type culture Collection, and the preservation number is CCTCC NO: m20211673, preservation date of 2021, 12 months and 24 days. The invention also discloses application of the beauveria bassiana JSHA-MD 912. The beauveria bassiana JSHA-MD912 has the characteristics of strong dissolution of inorganic phosphorus and organic phosphorus, has the functions of promoting growth and antagonizing plant pathogenic bacteria, can be used in the practices of agricultural production, ecological modification application and the like, can effectively reduce the application of chemical fertilizers and pesticides, and has wide application prospect.

Description

Beauveria bassiana JSHA-MD912 and application thereof

Technical Field

The invention relates to beauveria bassiana JSHA-MD912 and application thereof, belonging to the technical field of microorganisms.

Background

Phosphorus is an important limiting factor in agricultural production, and phosphorus fertilizers are used in agriculture in large quantities as common fertilizers, so that insoluble phosphorus is continuously accumulated in soil. In the soil ecological environment, most of phosphorus elements exist in a form of not dissolving inorganic phosphorus or organic phosphorus by combining with metal cations, and plants are difficult to directly absorb and utilize. In recent years, the research on functional phosphorus-dissolving microorganisms in China is less, and particularly in the aspects of wide separation and screening of phosphorus-dissolving fungi groups and diversity resources, the phosphorus-dissolving microorganisms among different groups and different species have obvious difference in phosphorus-dissolving action, so that the industrial development of phosphorus-dissolving microbial fertilizers is restricted.

Although the research on the growth promoting and antagonistic functions of the fungi and related fungal resources are many, most of the fungi have single growth promoting or antagonistic action, and only aim at the antagonism of pathogenic bacteria of a certain plant, the multifunctional strain resources with phosphorus dissolving, antagonism and the like are few, so that the actual requirements of green agriculture and ecological application practice cannot be met.

Beauveria bassiana belongs to the Moniliaceae (Moniliaeae) Beauveria (Beauveria) of Aphyllophorales (Hyphomycetales) of Deuteromycotina (Deuteromycinia) in a fungus classification system, and is widely distributed all over the world. Beauveria bassiana fungi are common insect parasitic fungi, have wide host range, mainly infect larvae, and some are also found in adults. Spores penetrate through the body wall and enter the polypide after germinating on the polypide surface, so that the polypide is dead and is white, hairy or powdery. Conidiophores are bottle-shaped and can be branched for many times, and spores are spherical or egg-shaped and are clustered on dense conidiophores to form dense spore heads.

Beauveria bassiana can exist in various ecological environments, most of which are found and reported on insects as insect pathogens, have wide host range and can infect more than 700 kinds of insects. The beauveria bassiana can also survive in soil and at the rhizosphere of plants and can also internally grow in the plants. It can exist in soil or internally in plants as saprophytic hyphae or dormant propagules until it adheres to the appropriate host in the surrounding microenvironment.

The species of the beauveria fungus are mostly parasitic bacteria of harmful insects, and are widely prepared into biocontrol microbial inoculum of the harmful insects. However, the types of strains which can resist plant pathogenic fungi or have a phosphorus dissolving effect in the groups are few, and strains with multiple functions are lacked. If the varieties of the beauveria bassiana which has the functions of dissolving phosphorus, antagonizing and the like can be screened, an important resource basis is provided for the practical application of green agriculture and ecological environment. In view of the above, the new high-efficiency multifunctional beauveria bassiana strain has important value and significance for overcoming the defects of the prior art and resources.

Disclosure of Invention

One of the purposes of the invention is to provide a strain of beauveria bassiana JSHA-MD 912.

The technical scheme for solving the technical problems is as follows: the strain is Beauverian sp.JSAH-MD 912, the preservation unit is China center for type culture Collection, and the preservation unit address is as follows: the preservation number of Wuhan university No. 16 Lojia mountain road in Wuchang district, Wuhan City, Hubei province of China is CCTCC NO: m20211673, preservation date 12/24/2021.

The invention screens out a strain, namely muscardine JSHA-MD912, which has strong characteristics of dissolving organic phosphorus and inorganic phosphorus and has the functions of promoting growth and antagonizing phytopathogen from the rhizosphere of green soy beans in Jinhu county of Huaian city, Jiangsu province and has the following morphological characteristics:

(1) culturing at 25 deg.C in PDA culture medium plate, and growing slowly, wherein the colony surface has soft hair, white or yellowish, aerial hypha is transparent, and the cell wall is thin and smooth, loose, and sometimes clumpy.

(2) The strain conidiophores have no diaphragm and consist of spore-forming cell clusters which are recurrent, compact, transparent and smooth in cell wall; the spore-forming cells are of a sympodial branch, a short sphere or a long-necked bottle shape; the top of the shaft is in a herringbone shape, the surface is in a sawtooth shape, a series of colorless, transparent and full-division conidia can be seen on the shaft, and the conidia are in a spherical shape, a nearly spherical shape, an oval shape to a cylindrical shape and the like.

Molecular systematic identification of the strain JHA-MD 912:

in order to further determine the classification status of the strain JSAH-MD 912, the identification is carried out by combining a molecular biology method. Firstly scraping activated strain JHA-MD 912 hypha from a culture plate, extracting strain JHA-MD 912 genome DNA from an EP tube by a CTAB method, and carrying out PCR amplification by using the genome DNA as a template and adopting a fungus ITS universal primer. And (3) sending the amplified product to Shanghai bio-chemical company for sequencing to obtain an ITS sequence with the length of about 512bp, which is shown as SEQ ID NO. 3. Meanwhile, the sequence is compared with ITS sequences of different species of Beauveria bassiana fungi with different sources in a BlastN comparison result to carry out multi-sequence comparison analysis, ClustalW in MEGA7.0 software is used for carrying out multi-sequence comparison, and then a phylogenetic tree is constructed by adopting an adjacency method (Neighbor join, NJ) in MEGA7.0, as shown in figure 5. The result shows that the strain JSHA-MD912 has the highest similarity with beauveria javanica B.majiangensis and the genetic relationship is the closest. Therefore, the strain JSHA-MD912 belongs to beauveria bassiana in molecular phylogenetic taxonomy. The result is consistent with the morphological identification characteristics, and the strain JSHA-MD912 is a Beauveria sp. Experimental results prove that the strain has the characteristics of dissolving organic phosphorus and inorganic phosphorus, and has the functions of promoting growth and antagonizing phytopathogen.

The beauveria bassiana JSHA-MD912 has the beneficial effects that:

the Beauveria bassiana JSHA-MD912 has the characteristics of strong dissolving of organic phosphorus and inorganic phosphorus, has the functions of promoting growth and antagonizing plant pathogenic bacteria, can be used in the practices of agricultural production, ecological transformation application and the like, can effectively reduce the application of chemical fertilizers and pesticides, and has wide application prospect.

The second purpose of the invention is to provide the application of the beauveria bassiana JSHA-MD912 in soil phosphorus dissolving.

The technical scheme for solving the technical problems is as follows: the application of the beauveria bassiana JSHA-MD912 in soil phosphorus dissolving is provided.

The application of the beauveria bassiana JSHA-MD912 in soil phosphorus dissolving has the beneficial effects that:

the beauveria bassiana JSHA-MD912 can be widely applied to the process of converting ineffective inorganic phosphorus and organic phosphorus which cannot be absorbed by plants in soil into available phosphorus which can be used by plants, can improve phosphorus elements which can be absorbed and utilized by the plants, and increases the utilization rate of insoluble phosphorus fixed by the soil.

The third purpose of the invention is to provide the application of the beauveria bassiana JSHA-MD912 in the preparation of microbial fertilizers.

The technical scheme for solving the technical problems is as follows: the application of the beauveria bassiana JSHA-MD912 in preparation of microbial fertilizers.

The application of the beauveria bassiana JSHA-MD912 in the preparation of the microbial fertilizer has the beneficial effects that:

the beauveria bassiana JSHA-MD912 can be used for preparing microbial fertilizers, has remarkable beneficial effects on growth promotion of plant plants and ecological soil improvement under the condition of keeping activity, can promote plant germination and rooting, reduces the application amount of chemical fertilizers and pesticides, and improves the yield and quality of crops.

On the basis of the technical scheme, the invention can be further improved as follows.

Further, in the microbial fertilizer, the total viable bacteria concentration of the beauveria bassiana JSHA-MD912 is 1 x 10⁶CFU/mL。

The adoption of the further beneficial effects is as follows: tests show that the beauveria bassiana JSHA-MD912 has the total viable bacteria concentration in the microbial fertilizer, and the phosphorus dissolving effect of the microbial fertilizer can be better realized.

Further, the microbial fertilizer is a liquid fertilizer, and the preparation method comprises the following steps: inoculating the bacterial liquid of Beauveria bassiana JSHA-MD912 into a potato liquid culture medium according to the inoculation amount of 2-5% by volume ratio, and performing shake culture at 25-30 ℃ and 160r/min for 7d to obtain the microbial fertilizer, wherein the total viable bacteria concentration is 1 x 10⁶CFU/mL。

The adoption of the further beneficial effects is as follows: the beauveria bassiana JHA-MD 912 can be used for preparing liquid fertilizers, has a remarkable phosphorus dissolving effect, can dissolve insoluble inorganic phosphorus and degrade insoluble organic phosphorus, releases insoluble inorganic phosphorus and organic phosphorus by utilizing the metabolic capacity of the beauveria bassiana JHA-MD 912, and greatly improves the effective phosphorus content in bacteria liquid or soil.

The fourth purpose of the invention is to provide the application of the beauveria bassiana JSHA-MD912 in the preparation of the biocontrol microbial inoculum.

The technical scheme for solving the technical problems is as follows: the application of the beauveria bassiana JSHA-MD912 in preparing a biocontrol microbial inoculum.

The application of the beauveria bassiana JSHA-MD912 in the preparation of the biocontrol microbial inoculum has the beneficial effects that:

the beauveria bassiana JSHA-MD912 can be used for preparing biocontrol microbial inoculum, has obvious control effects on oil tea anthracnose, soybean sclerotinia sclerotiorum and fusarium oxysporum, can remarkably promote the growth and yield of plants, is convenient to use, takes effect quickly, and is convenient to apply and popularize.

Further, in the biocontrol microbial inoculum, the total viable bacteria concentration of beauveria bassiana JSHA-MD912 is 1 × 10⁶CFU/mL。

The adoption of the further beneficial effects is as follows: tests show that the beauveria bassiana JSHA-MD912 in the biocontrol microbial inoculum has the total viable bacteria concentration, so that the control effect of the biocontrol microbial inoculum can be better realized.

Further, the preparation method of the biocontrol microbial inoculum comprises the following steps: inoculating the bacterial liquid of Beauveria bassiana JSHA-MD912 into a potato liquid culture medium according to the inoculation amount of 2-5% volume ratio, and performing shake culture at 25-30 deg.C and 160r/min for 7d to obtain the biocontrol microbial inoculum with the total viable bacteria concentration of 1 × 10⁶CFU/mL。

The adoption of the further beneficial effects is as follows: by adopting the method, the biocontrol microbial inoculum can be prepared, and the preparation method is simple, easy to operate, low in cost and suitable for large-scale popularization and application.

Drawings

FIG. 1 is a phosphorus-solubilizing circle diagram of the strain JSHA-MD912 in the front of the organophosphorus culture medium in example 1 of the present invention.

FIG. 2 is a map of the soluble phosphorus circle of the strain JSHA-MD912 on the reverse side of the organophosphorus culture medium in example 1 of the invention.

FIG. 3 is a phosphorus-solubilizing circle map of the strain JSHA-MD912 in the front of inorganic phosphorus medium in example 1 of the present invention.

FIG. 4 is a map of the soluble phosphorus circle of the strain JSHA-MD912 on the reverse side of the inorganic phosphorus medium in example 1 of the present invention.

FIG. 5 is a phylogenetic tree of the strain JSAH-MD 912 in example 2 of the present invention.

FIG. 6 is a graph showing the growth promoting effect of the strain JSHA-MD912 on cucumber seedlings in example 4 of the invention.

Wherein, three cucumber seedlings in the first row from top to bottom are blank controls, and three cucumber seedlings in the second row from top to bottom are the growth promoting effect of the strain JSAH-MD 912.

FIG. 7 is a culture diagram showing the confrontation of the strain JSAH-MD 912 in the inhibition of soybean sclerotinia in example 4 of the present invention.

FIG. 8 is a photograph showing colonies of a blank soybean sclerotinia sclerotiorum cultured on the opposite side in example 4 of the present invention.

FIG. 9 is a graph showing the culture of strain JSHA-MD912 in the detection of the inhibition of Fusarium oxysporum in example 4 of the present invention.

FIG. 10 is a photograph of a blank Fusarium oxysporum colony in example 4 of the present invention.

FIG. 11 is a graph showing the culture of the strain JHA-MD 912 in the inhibition of Botrytis cinerea in example 4 of the present invention.

FIG. 12 is a graph of a blank control Botrytis cinerea colony in example 4 of the present invention.

FIG. 13 is a culture diagram showing the confrontation of the strain JSHA-MD912 in the detection of the inhibition effect of the oil tea anthrax in example 4 of the present invention.

FIG. 14 is a colony chart of blank control oil tea anthracnose bacteria in example 4 of the present invention.

FIG. 15 is a graph showing the inhibitory effect of JSHA-MD912 fermentation broth on oil tea anthrax in example 4 of the present invention.

FIG. 16 is a colony chart of blank control oil tea anthracnose bacteria in example 4 of the present invention.

FIG. 17 shows the inhibitory effect of JSAE-MD 912 strain fermentation broth on Botrytis cinerea in example 4 of the present invention.

FIG. 18 is a graph of a blank control Botrytis cinerea colony in example 4 of the present invention.

FIG. 19 is a graph showing the effect of fermentation broth JSHA-MD912 in inhibiting Fusarium oxysporum in example 4 of the present invention.

FIG. 20 is a photograph of a blank Fusarium oxysporum colony in example 4 of the present invention.

FIG. 21 is a graph showing the inhibitory effect of a fermentation broth of strain JSAE-MD 912 on Sclerotinia sclerotiorum in example 4 of the present invention.

FIG. 22 is a colony map of a blank control soybean sclerotinia sclerotiorum in example 4 of the present invention.

Detailed Description

The principles and features of this invention are described below in conjunction with the following drawings, which are set forth by way of illustration only and are not intended to limit the scope of the invention.

Example 1: separating and purifying strain

1.1 test materials

1.1.1 plant rhizosphere soil sample sources: the method is characterized in that the rhizosphere soil of green soy beans is collected on streets of Li city in Jinhuo county, Huai An city, Jiangsu province by using a five-point sampling method. Setting points near the roots, shoveling 1-2cm of soil on the surface layer, taking about 200g of soil around the root systems of the green soy beans, mixing and filling into a sample bag, recording information such as longitude and latitude, date, plant names and the like of sampling points as shown in table 1, and photographing the plants and the environment of the sampled green soy beans. The soil sample is taken back to the laboratory and stored at 4 ℃ for later use.

TABLE 1

Name of plant	Collection site	Latitude and longitude	Sampling time
				Green soy bean	Huaian city Jinhucounty of Jiangsu province	E118°59′33″N33°2′20″	10 and 13 days of 2020

1.1.2 culture Medium

Inorganic phosphorus medium (g/L): glucose 10g, (NH)₄)₂SO₄0.5g、NaCl 0.3g、KCl 0.3g、 MgSO₄0.3g、MnSO₄0.03g、FeSO₄·7H₂0.03g of O, 0.5g of yeast extract and Ca₃(PO₄)₂3g of agar, 16g of agar and 1000mL of distilled water, and the pH value is 6.8-7.0. Sterilizing at 121 deg.C for 30 min.

Organophosphorus medium (g/L): glucose 10g, (NH)₄)₂SO₄0.5g、NaCl 0.3g、KCl 0.3g、 MgSO₄0.3g、MnSO₄0.03g、FeSO₄·7H₂0.03g of O, 0.4g of yeast extract, 0.2g of lecithin and CaCO₃5g of agar, 16g of agar and l000mL of distilled water, and the pH value is 7.0-7.2. Sterilizing at 121 deg.C for 30 min.

1.2 isolation and screening of phosphorus-solubilizing fungi

(1) Weighing 10g of soil sample in 90mL of sterilized water, and carrying out shake culture in a shaking table at 28 ℃ for 30min at the rotating speed of 150 r/min;

(2) the concentration of the soil suspension is sequentially diluted to 10 by adopting a gradient dilution method^-3、10^-4And 10^-5Then, 100. mu.L of the suspension was applied to an inorganic phosphorus medium plate and an organic phosphorus medium plate in this order, and each concentration was repeated 3 times, 2 timesCulturing at 8 deg.C in dark at constant temperature;

(3) after culturing for 5-7 days, selecting single bacterial colonies with phosphorus-dissolving rings on an inorganic phosphorus solid plate and an organic phosphorus solid plate for purification verification, repeating each single bacterial colony for 2 times, and performing inversion culture at the constant temperature of 28 ℃;

(4) and after purification, combining and storing the strains with similar forms in the same crop.

1.3 determination of phosphate solubilizing ability of plate

Inoculating the purified phosphate solubilizing fungi on inorganic phosphorus and organic phosphorus culture medium plates by a plate assay method, carrying out inverted culture at a constant temperature of 28 ℃, measuring the diameter (D) of a colony and the diameter (D) of a phosphate solubilizing ring by a cross method at 5-7D, and calculating the phosphate solubilizing index (SPI) according to the formula (1).

SPI-diameter of phosphate solubilizing circle/diameter of colony formula (1).

1.4 results

After the strain JSHA-MD912 grows for 7d on organic phosphorus and inorganic phosphorus culture media, the SPI values respectively reach 1.09 and 1.35. As shown in fig. 1-4. The strain JSHA-MD912 has strong capability of dissolving organic phosphorus and inorganic phosphorus.

Example 2: identification of strain JSAH-MD 912

And (3) strain morphological identification: in a clean bench, fresh blocks of strain JSHA-MD912 were cut out using a sterile punch with a diameter of 6.0mm, placed in the center of PDA medium, and cultured at a constant temperature of 28 ℃. And observing the growth condition, the morphology, the color and the like of the bacterial colony in time, and recording the transverse and longitudinal diameters of the bacterial colony. When culturing at 7d, hyphae at the edge of the colony were picked and placed on a glass slide, and morphological characteristics of the hyphae were observed with an optical microscope to perform morphological identification. The morphological identification is referred to in the handbook of fungal identification.

Morphological characteristics of the strain JSHA-MD 912:

The solid culture medium comprises glucose 20g, potato 200g, agar 16g and water 1L, and has natural pH value. The solid culture medium is sterilized at 121 deg.C under 0.1MPa for 20min before use.

The liquid fermentation culture medium comprises glucose 20g, potato 200g and water 1L, and has natural pH. The liquid fermentation culture medium is obtained after the raw materials are uniformly mixed. The liquid fermentation culture medium is sterilized at 121 deg.C under 0.1MPa for 20min before use.

Molecular phylogenetic identification of the strain JHA-MD 912:

(1) after the activated strain JSHA-MD912 grows to be fully paved with PDA culture plates, hyphae are scraped by a sterilization scalpel and collected, and genome DNA is extracted by adopting a 2% CTAB method.

(2) PCR amplification was performed using fungal ITS universal primers. Upstream primer ITS₁As shown in SEQ ID NO.1, 5'-tccgtaggtgaacctgcgg-3', downstream primer ITS₄As shown in SEQ ID NO.2, 5'-tcctccgcttattgatatgc-3'. PCR reaction (25. mu.L): 2 XEs Taq Master Mix (Beijing Tiangen Biotechnology Co., Ltd.) 12.5. mu. L, DNA template 1. mu.L, upstream primer ITS₁And the downstream primer ITS₄Each 1 μ L, dd H₂O9.5. mu.L, control added dd H₂O replaces the DNA template. PCR amplification conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 1min, and 35 cycles; extension at 72 ℃ for 10min and infinity at 8 ℃. The amplified product was detected by 1.2% agarose gel electrophoresis and sequenced by Shanghai Biotech to obtain a 512bp long sequence as shown in SEQ ID NO. 3.

tcctacccttatgtgaacctacctattgttgcttcggcggactcgccccagccggacgcgg actggaccagcggccgccggggaccctcaaactcttgtattatcagcatcttctgaatacgccgc aaggcaaaacaaataaatcaaaactttcaacaacggatctcttggctctggcatcgatgaagaac gcagcgaaacgcgataagtaatgtgaattgcagaatccagtgaatcatcgaatctttgaacgcac attgcgcccgccagcattctggcgggcatgcctgttcgagcgtcatttcaaccctcgacctccct ttggggaagtcggcgttggggaccggcagcacaccgccggccctgaaatggagtggcggcccgtc cgcggcgacctctgcgtagtaatccaactcgcaccggaaccccgacgtggccacgccgtaaaaca cccaacttctgaacgttgacctcgaatcaggtaggactacccgctgaacttaagcatatca(SEQ ID NO.3)。

(3) Comparing the sequencing result with an ITS sequence in a GenBank of NCBI, selecting a sequence with higher similarity as a reference sequence, then using BioEdit software (version 7.0.9) to carry out sequence comparison and manual correction, carrying out multi-site sequence comparison on the processed data through MEGA6.0 software and the sequencing sequence, manually shearing the corrected sequence, selecting a Neighbor-Joining Tree (Neighbor-Joining Tree) to construct a molecular phylogenetic Tree, and identifying the classification status of the strain JHA-MD 912. A phylogenetic tree was constructed as shown in fig. 5.

The strain JSHA-MD912 is clustered with beauveria javanica (B. majiangensis) of beauveria as a branch, and is a similar species, and the strain JSHA-MD912 is preliminarily identified as the beauveria fungus species.

Example 3: preservation of the Strain

The strain JHA-MD 912 is preserved, the Beauveria fungus strain is Beauveria sp. JHA-MD 912, the preservation unit is China center for type culture Collection, and the preservation number is CCTCC NO: m20211673, preservation date 12/24/2021.

Example 4: growth promotion test for fungal strains

(1) Cucumber test-tube plantlet growth promotion evaluation experiment

Inoculating the experimental strain to a PDA culture plate for activation, and after culturing for 5d at 28 ℃, spreading hypha and spores of the strain on the culture plate for later use. Wherein, the PDA plate culture medium consists of 200g/L of potatoes, 20g/L of glucose and 16g/L of agar powder.

Selecting full-seed Zhongnong No. 6 cucumber seeds, firstly disinfecting the seeds for 5 minutes by using 10% sodium hypochlorite, and then washing the seeds for 5 times by using sterile water; dipping the washed seeds with 1 percent of CMC (sodium carboxymethyl cellulose) by mass percent, and then respectively dipping the seeds with bacterial strain spores; placing the seeds dipped with the spores on a culture dish paved with gauze according to 10 grains/dish (the gauze and the culture dish are sterilized), dripping sterilized water for moisturizing, culturing for 4 days at 28 ℃ in an incubator, growing cotyledon and root, and then culturing for 24 hours by illumination for later use.

Sterilizing a test tube with the diameter of 150 multiplied by 15 mm; 1/8MS culture medium, sterilizing; the sterilized tubes were placed on a tube rack and half the amount of sterilized 1/8MS medium was added. 1/8MS medium was purchased from Eimeria technologies, Inc. (Hygroscopic, USA).

Transplanting the cucumber seedlings into a test tube, 1 plant/tube, repeating 5 plants each, culturing in a greenhouse at 23-25 deg.C under alternate illumination and darkness for 15-20 days, harvesting, and measuring fresh weight and dry weight.

(2) Analysis of Experimental data

The data were collated using Excel software and analyzed for variance using DPS software. The growth promoting rate of the experimental strain on the plant height of the cucumber test-tube plantlet is calculated by the formula (2), and the fresh weight and the dry weight are also the same.

The growth promotion rate (%) of the experimental strain is (weight of treated test-tube plantlet-weight of control test-tube plantlet)/weight of control test-tube plantlet × 100% formula (2).

(3) Results

The effect of strain JSHA-MD912 on cucumber shoot growth is shown in table 2 and figure 6.

TABLE 2 Effect of the strain JHA-MD 912 on cucumber seedling growth

Numbering	Fresh weight	Dry weight of
			Control (CK)	0.57g±0.005g	0.091g±0.002g
Strain JSHA-MD912	0.768g±0.02g	0.119g±0.01g
			Growth promoting rate	34.74％±0.043％	30.29％±0.111％

The evaluation test result of the cucumber test-tube plantlet shows that the growth promotion rates of the strain JSHA-MD912 to the fresh weight and the dry weight of the cucumber plantlet are 34.74% + -0.043% and 30.29% + -0.111% respectively compared with the control.

Example 5: antagonistic test of strains

(1) Pathogenic bacteria for test

The crop pathogens oil tea anthracnose (Colltotrichum camelliae), Botrytis cinerea (Botrytis cinerea), Sclerotinia sclerotiorum (sclerotiorum) and Fusarium oxysporum (Fusarium oxysporum) are provided by the laboratory of the Li Shi east, institute of plant protection, academy of agricultural sciences, China.

(2) Flat plate opposing method test method

Inoculating an experimental strain to be detected to a PDA culture plate for activation, culturing at 28 ℃ for 7d, then respectively taking pathogenic bacteria and a bacterial cake to be detected by using a puncher, inoculating the two bacteria on the same PDA plate, keeping the distance between the two bacteria at 4cm, repeating the steps for 3-5 times in each group, taking singly inoculated pathogenic bacteria as a control, culturing at 28 ℃, measuring the radius of a bacterial colony of the pathogenic bacteria facing the experimental strain after 7d, and calculating the inhibition rate according to the formula (3).

Inhibition (%) - (control pathogen colony radius-treatment pathogen colony radius)/control pathogen colony radius × 100% formula (3)

(3) Fermentation liquor antagonism test method

Inoculating the experimental strain to a PDA culture medium for about 7 days, taking 8 bacterial cakes with the diameter of 5mm from a culture plate full of bacterial colonies, inoculating the bacterial cakes to a PDB liquid culture medium, carrying out shaking culture on a shaking table at 28 ℃ and 200r/min for 4 days, filtering by using sterilized filter paper to remove spores and mycelia of the strain, centrifuging for 10min at 7830r/min under the normal temperature condition, and filtering supernatant by using a filter membrane with the diameter of 0.22 mu m to prepare sterile filtrate. And then cooled to about 50 ℃, 10mL of sterile filtrate of the experimental strain is added into 90mL of PDA culture medium, and the mixture is evenly mixed and poured into a flat plate. Inoculating plant pathogenic bacteria to the center of the plate, and culturing at 28 deg.C in dark box for 7 d. The bacterial colony radius of pathogenic bacteria is measured by a cross method to calculate the bacteriostatic effect. The data were collated using Excel 2010 software, and the DPS software was used for analysis of variance. The inhibition rate against plant pathogenic bacteria was calculated according to formula (3).

(4) Results

The antagonistic action of the strain JSHA-MD912 on 4 plant pathogenic bacteria is shown in Table 3 and figures 7-22. The diameter of a colony cultured with a pathogen alone was used as a Control (CK).

TABLE 3 inhibitory Effect of the culture on plant pathogenic fungi

The results of plate antagonism experiments show that the bacterial strain JSHA-MD912 has bacteriostatic rates of 56.58% +/-0.019%, 57.66% +/-0.009%, 50.5% +/-0.009% and 58.44% +/-0.017% on oil tea anthracnose bacteria, botrytis cinerea, sclerotinia rot of soybean and fusarium oxysporum respectively.

The diameter (mm) of the strain JSAE-MD 912 fermentation liquor on pathogenic bacteria and the inhibition rate (%) are shown in Table 4. The Control (CK) was established by culturing a growing colony with a pathogen without addition of the strain broth.

TABLE 4 diameter (mm) and inhibition (%)

Pathogenic bacteria	Oil tea anthracnose	Botrytis cinerea	Sclerotinia rot of soybean	Fusarium oxysporum
					Diameter of colony	59.33mm±0.88mm	35mm±0.58mm	26.67mm±2.4mm	7mm±0.58mm
Control (CK)	71mm±0.58mm	35mm±1.73mm	41.67mm±0.88mm	67.67mm±1.45mm
					Inhibition rate	16.43％±0.012％	0％±0.016％	36.01％±0.057％	89.66％±0.008

The results of strain fermentation liquor antagonism experiments show that the inhibition rates of the strain JSHA-MD912 fermentation liquor on the 4 pathogenic bacteria are respectively 16.43% + -0.012%, 0% + -0.016%, 36.01% + -0.057% and 89.66% + -0.008%, and the strain JSHA-MD912 fermentation liquor has very strong inhibition effect (89.66%) on fusarium oxysporum, but has no inhibition activity on botrytis cinerea.

The tests show that, firstly, the strain JSHA-MD912 can be used for dissolving phosphorus in soil.

Secondly, the strain JSAE-MD 912 can be used for preparing microbial fertilizers. In the microbial fertilizerIn the preparation method, the total viable bacteria concentration of the beauveria bassiana JSHA-MD912 is 1 × 10⁶CFU/mL. The microbial fertilizer is a liquid fertilizer, and the preparation method comprises the following steps: inoculating the bacterial liquid of Beauveria bassiana JSHA-MD912 into a potato liquid culture medium according to the inoculation amount of 2-5% by volume ratio, and performing shake culture at 25-30 ℃ and 160r/min for 7d to obtain the microbial fertilizer, wherein the total viable bacteria concentration is 1 x 10⁶CFU/mL。

Thirdly, the strain JSHA-MD912 can be used for preparing a biocontrol microbial inoculum. In the biocontrol microbial inoculum, the total viable bacteria concentration of the beauveria bassiana JSHA-MD912 is 1 multiplied by 10⁶CFU/mL. The preparation method of the biocontrol microbial inoculum comprises the following steps: inoculating the bacterial liquid of Beauveria bassiana JSHA-MD912 into a potato liquid culture medium according to the inoculation amount of 2-5% volume ratio, and performing shake culture at 25-30 deg.C and 160r/min for 7d to obtain the biocontrol microbial inoculum with the total viable bacteria concentration of 1 × 10⁶CFU/mL。

In conclusion, the beauveria bassiana JSHA-MD912 has the characteristics of strong dissolving of organic phosphorus and inorganic phosphorus, has the functions of promoting growth and antagonizing plant pathogenic bacteria, can be used in the practices of agricultural production, ecological modification application and the like, can effectively reduce the application of chemical fertilizers and pesticides, and has wide application prospects.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> Guizhou national university

<120> beauveria bassiana JSHA-MD912 and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tccgtaggtg aacctgcgg 19

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcctccgctt attgatatgc 20

<210> 3

<211> 512

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tcctaccctt atgtgaacct acctattgtt gcttcggcgg actcgcccca gccggacgcg 60

gactggacca gcggccgccg gggaccctca aactcttgta ttatcagcat cttctgaata 120

cgccgcaagg caaaacaaat aaatcaaaac tttcaacaac ggatctcttg gctctggcat 180

cgatgaagaa cgcagcgaaa cgcgataagt aatgtgaatt gcagaatcca gtgaatcatc 240

gaatctttga acgcacattg cgcccgccag cattctggcg ggcatgcctg ttcgagcgtc 300

atttcaaccc tcgacctccc tttggggaag tcggcgttgg ggaccggcag cacaccgccg 360

gccctgaaat ggagtggcgg cccgtccgcg gcgacctctg cgtagtaatc caactcgcac 420

cggaaccccg acgtggccac gccgtaaaac acccaacttc tgaacgttga cctcgaatca 480

ggtaggacta cccgctgaac ttaagcatat ca 512

Claims

1. The beauveria bassiana JHA-MD 912 is characterized in that the strain is a beauveria bassiana fungus strain, the beauveria bassiana strain is Beauverian sp.JHA-MD 912, the preservation unit is China center for type culture Collection, and the preservation number is CCTCC NO: m20211673, preservation date 12/24/2021.

2. The use of beauveria bassiana JSHA-MD912 of claim 1 in soil phosphorus solubilization.

3. Use of the beauveria bassiana JSHA-MD912 of claim 1 in the preparation of microbial fertilizers.

4. The use as claimed in claim 3, wherein the total viable bacteria concentration of Beauveria bassiana JSHA-MD912 in the microbial fertilizer is 1 x 10⁶CFU/mL。

5. The use according to claim 4, wherein the microbial fertilizer is a liquid fertilizer and is prepared by: inoculating the bacterial liquid of Beauveria bassiana JSHA-MD912 into a potato liquid culture medium according to the inoculation amount of 2-5% by volume ratio, and performing shake culture at 25-30 ℃ and 160r/min for 7d to obtain the microbial fertilizer, wherein the total viable bacteria concentration is 1 x 10⁶CFU/mL。

6. The use of Beauveria bassiana JSHA-MD912 as claimed in claim 1 in the preparation of biocontrol microbial inoculum.

7. The use as claimed in claim 6, wherein the total viable bacteria concentration of Beauveria bassiana JSHA-MD912 in the biocontrol microbial inoculum is 1 x 10⁶CFU/mL。

8. The use of claim 7, wherein the biocontrol microbial inoculum is prepared by the method comprising the following steps: inoculating the bacterial liquid of Beauveria bassiana JSHA-MD912 into a potato liquid culture medium according to the inoculation amount of 2-5% volume ratio, and performing shake culture at 25-30 deg.C and 160r/min for 7d to obtain the biocontrol microbial inoculum with the total viable bacteria concentration of 1 × 10⁶CFU/mL。