CN114438163B - Fungus screening reagent, screening method, kit and application - Google Patents

Abstract

The invention relates to the field of colony screening, in particular to a fungus screening reagent, a screening method, a kit and application. The invention provides a lysozyme reagent, which comprises the following components: sorbitol 0.8-1.1 mol/L, EDTA 10-20 mol/L, snail proteinase 5-60 mg/mL. The CRISPRCas12a technology is applied to fungus colony screening for the first time, and is improved and optimized based on the technical principle, so that the method is more suitable for high-throughput screening. In plasmid design, the invention creatively introduces PAM sequences at the gene terminal, so that all crRNA sequences can simultaneously recognize gene fragments and vector fragments. In addition, the invention utilizes automatic equipment and a large batch of screening reaction systems and conditions to ensure that the method is fully suitable for an automatic scheme of colony screening, thereby greatly shortening the screening time and greatly improving the strain breeding speed and the strain screening efficiency.

Description

Fungus screening reagent, screening method, kit and application

Technical Field

The invention relates to the field of colony screening, in particular to a fungus screening reagent, a screening method, a kit and application.

Background

In engineering bacteria transformation process, positive monoclonal colonies are often required to be screened out for further transformation and culture. In the existing method, colony PCR is widely applied to engineering bacteria positive monoclonal screening work as a most rapid and convenient screening method. In the case of fungi, the sample pretreatment is required for colony PCR because of the cell wall and chromosome structure:

Taking 1.5mL of yeast strain in logarithmic growth phase, 13000r/min, centrifuging for 15s, removing supernatant, washing once with double distilled water, centrifuging for 15s at 13000r/min, suspending the precipitate in 200 mu L of TE buffer, boiling for 1-10 min in boiling water, ice-bath for 10min,13000r/min, centrifuging for 5min, storing the supernatant at-20 ℃ and taking 1 mu L for PCR. Or taking dry yeast colony with diameter larger than 3mm, covering the EP tube with a cover, heating in a microwave oven, adding 30 μL TE for shaking, 13000r/min, centrifuging for 2-5 min, storing supernatant in a bath at-20deg.C, and taking 1 μL for PCR. Then the size of the amplified sequence is analyzed and compared to achieve the aim of selecting positive monoclonal.

Because of the high flux and automation requirements of the research and development platform, the existing colony PCR technology cannot realize automatic substitution because the screening result is based on DNA gel electrophoresis, and the screening method of colony PCR and gel electrophoresis is long in time consumption and unfavorable for improving flux.

Disclosure of Invention

In view of this, the invention provides fungal screening reagents, screening methods, kits and uses.

The invention aims to develop a colony screening technology which is applicable to an automatic platform and is more rapid and effective, namely a rapid colony screening technology based on snail protease and Cas12a protein. The key point of the invention is that CRISPR CAS a technology is applied to fungus colony screening for the first time, and is improved and optimized based on the technical principle, so that the technology is more suitable for high-throughput screening. In plasmid design, the invention creatively introduces PAM sequences at the gene terminal, so that all crRNA sequences can simultaneously recognize gene fragments and vector fragments. In addition, the invention utilizes automatic equipment, a large batch of screening reaction systems and reaction conditions, so that the method is fully applicable to an automatic implementation scheme of colony screening, and greatly improves the strain breeding speed and strain screening efficiency.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a lysozyme reagent, which comprises the following components:

Sorbitol 0.8-1.1 mol/L

EDTA 10～20mol/L

Snail proteinase 5-60 mg/mL.

In some embodiments of the invention, the above-described bacteriolytic reagent comprises sorbitol 0.9mol/L.

In some embodiments of the invention, the above-described bacteriolytic reagent comprises EDTA 10mol/L.

In some embodiments of the invention, the above-described bacteriolytic reagent comprises 30mg/mL of snail protease.

The invention also provides a detection reagent, which comprises the following components:

1μM crRNA 20～200nM

10nM Cas12a protein 0.2-0.5 nM

1NM fluorescent reporter 0.1-0.5 nM

The volume ratio of 10 x buffer to ddH ₂ O is 1:6.

In some embodiments of the invention, the detection reagent comprises 1. Mu.M crRNA100nM.

In some embodiments of the invention, the detection reagent comprises 10nM of the Cas12a protein 0.5nM.

In some embodiments of the invention, the detection reagent comprises 1nM fluorescent reporter 0.1nM.

The invention also provides a method for designing the crRNA of the detection reagent, which comprises the step of selecting a base sequence of 20bp after a PAM locus TTTN on a target gene as a recognition sequence.

The invention also provides screening reagents, including the above-described bacteriolytic reagents and/or the above-described detection reagents.

The invention also provides a screening method of fungus colonies, which comprises the following steps:

s1: mixing the lysozyme and/or the lysozyme in the screening reagent with a sample to obtain a mixed bacterial solution;

S2: mixing the mixed bacterial liquid with the detection reagent and/or the detection reagent in the screening reagent, and detecting.

In some embodiments of the invention, the mixing time in the above screening method S1 is 10 to 50 minutes and the temperature is 35 to 38 ℃.

In some embodiments of the invention, the mixing time in the above screening method S1 is 30min.

In some embodiments of the invention, the temperature of the mixing in the above screening method S1 is 37 ℃.

In some embodiments of the invention, the volume ratio of the lysozyme to the sample in the screening method S1 is 35:1.

In some embodiments of the invention, the time of the mixing in the screening method S2 is 15min and the temperature is 35-38 ℃.

In some embodiments of the present invention, the temperature of the mixing in the screening method S2 is 37 DEG C

The invention also provides a kit comprising the above-mentioned lysozyme, the above-mentioned detection reagent and/or the above-mentioned screening reagent and an acceptable auxiliary agent.

The invention also provides application of the lysozyme, the detection reagent, the screening reagent and/or the kit in detecting and/or screening fungus colonies.

The invention provides a lysozyme reagent, which comprises the following components:

Sorbitol 0.8-1.1 mol/L

EDTA 10～20mol/L

Snail proteinase 5-60 mg/mL.

The invention changes the method and technology for screening target colony against the deficiency of the existing colony PCR, breaks through the flux limit of colony screening instruments (electrophoresis apparatus and PCR apparatus), and can realize maximum flux screening. Meanwhile, the screening time is shortened from 3 hours to 1 hour, and the screening efficiency is greatly improved.

Comparison of colony PCR technique

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 illustrates a process for the modification of a degerming system;

FIG. 2 shows the results of the reaction system test;

FIG. 3 shows the pPIC9K-CT05 vector;

FIG. 4 shows the results of the novel method screen;

wherein: + is positive internal reference, 1-5 show positive, namely target colony;

FIG. 5 shows colony PCR screening results;

Wherein: m is marker, 1-5 show positive, namely target colony.

Detailed Description

The invention discloses a fungus screening reagent, a screening method, a kit and application.

It should be understood that the expression "one or more of … …" individually includes each stated object after the expression and various combinations of two or more of the stated objects unless otherwise understood from the context and usage. The expression "and/or" in combination with three or more recited objects should be understood as having the same meaning unless otherwise understood from the context.

The use of the terms "comprising," "having," or "containing," including grammatical equivalents thereof, should generally be construed as open-ended and non-limiting, e.g., not to exclude other unrecited elements or steps, unless specifically stated otherwise or otherwise understood from the context.

It should be understood that the order of steps or order of performing certain actions is not important so long as the invention remains operable. Furthermore, two or more steps or actions may be performed simultaneously.

The use of any and all examples, or exemplary language, such as "e.g." or "comprising" herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

Furthermore, the numerical ranges and parameters setting forth the present invention are approximations that may vary as precisely as possible in the exemplary embodiments. However, any numerical value inherently contains certain standard deviations found in their respective testing measurements. Accordingly, unless explicitly stated otherwise, it is to be understood that all ranges, amounts, values and percentages used in this disclosure are modified by "about". As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a particular value or range.

The snail protease provided by the invention is purchased from Holly (the product name is Snailase snail enzyme, the product number is 10404ES 08), and raw materials and reagents used in fluorescence detection and identification tests can be purchased from the market.

Abbreviations and English	Meaning of
		PCR	Polymerase chain reaction
crRNA	Gene editing specific guide RNA
		Tri-HCl	Trimethylolaminomethane hydrochloride
Cas12a proteins	Gene editing proteins
		Buffer	Reaction buffer
PAM site	Cas12a protein recognition site
		TTTN	Nucleic acid sequence, N is A, T, C, G
EDTA	Ethylenediamine tetraacetic acid

The invention is further illustrated by the following examples:

EXAMPLE 1 snail protease disruption

Raw materials and reagents: the snail protease is obtained from Yisheng, the cord bag of snail and the mixed enzyme prepared in digestive tract, and contains more than 20 enzymes such as cellulase, pectase, amylase, protease, etc.

And (3) preparation of a reagent: 0.9mol/L sorbitol, snail protein (30 mg/ml) was dissolved in 0.9mol/L sorbitol, 10mol/L EDTA

BufferI:0.9mol/L sorbitol, 0.1mol/L EDTA (0.9 mol/L sorbitol: 10mol/L EDTA=1:100)

The experimental steps are as follows:

Adding 30 mu L bufferI and 5 mu L snail protease solution into the monoclonal, water-bathing for 30min at 37 ℃, and shaking once in 5 min, so as to prevent the cells from sinking to the bottom of the tube, thus obtaining the mixed bacterial liquid.

As the broken thalli and DNA are released in a large amount, the reaction system is sticky and is unfavorable for pipetting operation, so the key point of the step is to adjust the bacterial breaking efficiency according to the detection sensitivity requirement. The invention aims at balancing the bacteria breaking efficiency, the system viscosity and the detection sensitivity, so that the whole screening system is more efficient and is beneficial to operation. So that the invention has great advantages in practical application. The process of the bacteria breaking system is shown in figure 1.

The reaction is carried out at the optimal temperature of 37 ℃, and in order to realize the balance and unification of normal pipetting and release of the bacterial-destroying plasmids of the system viscosity, a large number of verification experiments are carried out on the concentration and the reaction time of lysozyme. As shown in FIG. 1, we set 12 groups of lysozyme concentrations, 5mg/mL, 10mg/mL, 15mg/mL, 20mg/mL, 25mg/mL, 30mg/mL, 35mg/mL, 40mg/mL, 45mg/mL, 50mg/mL, 55mg/mL, 60mg/mL, and 9 groups of reaction time tests, 10min, 15min, 20min, 25min, 30min, 35min, 40min, 45min, 50min, respectively.

There were 108 experimental groups, each with eight parallel controls, and 864 total bacterial responses, and the test results are shown in table 1:

TABLE 1 bacterial disruption reaction

Test results

10min

15min

20min

25min

30min

35min

40min

45min

50min

5mg/mL

1-

1-

1-

1-

1-

1-

1-

1-

1-

10mg/mL

1-

1-

1-

1-

1-

1-

1-

1-

1-

15mg/mL

1-

1-

1-

1-

1-

1-

1-

1-

1-

20mg/mL

1-

1-

1-

1-

1-

1-

1+/-

1+/-

1+

25mg/mL

1-

1-

1-

1+/-

1+/-

1+

1+

1+

1+

30mg/mL

1-

1+/-

1+/-

1+

1+

1+

1+

1+

1+

35mg/mL

1+/-

1+/-

1+

0+

0+

0+

0+

0+

0+

40mg/mL

1+

0+

0+

0+

0+

0+

0+

0+

0+

45mg/mL

0+

0+

0+

0+

0+

0+

0+

0+

0+

50mg/mL

0+

0+

0+

0+

0+

0+

0+

0+

0+

55mg/mL

0+

0+

0+

0+

0+

0+

0+

0+

0+

60mg/mL

0+

0+

0+

0+

0+

0+

0+

0+

0+

The result shows that the liquid viscosity is influenced by the bacteria breaking system, so that the pipetting process is difficult to carry out, and when the liquid viscosity is moderate, pipetting is realized, and when the liquid viscosity is too high, pipetting is not realized; "pipettable" is denoted by 1 and not pipettable by 0. Because the concentration of the fragment to be detected is influenced by the bacteria breaking system, the high concentration is detectable, and the low concentration is undetectable; "detectable" is indicated by +, and undetectable by-is indicated by- ".

The label "bold and underline" is an alternative system to meet the detection requirements

In combination with efficiency, cost and accuracy, we choose the lowest concentration dosage and the fastest detection time as possible, and ensure the detection accuracy, so 30mg/mL snail protease reaction for 30min is chosen as the final reaction system.

Example 2 fluorescence detection

TABLE 2 statistics of reaction system test results

Table 3 System 1

Reagent(s)	Dosage of	Final reaction concentration
			1μM crRNA	1μL	20nM
10NM Cas12a protein	1μL	0.2nM
			1NM fluorescent reporter	1μL	0.1nM
10*Buffer	2μL	-
			ddH2O	13μL	-
Mixed bacterial liquid	2μL	-

Table 4 System 2

Table 5 System 3

Reagent(s)	Dosage of	Final reaction concentration
			1μM crRNA	2μL	100nM
10NM Cas12a protein	1μL	0.2nM
			1NM fluorescent reporter	1μL	0.1nM
10*Buffer	2μL	-
			ddH2O	12μL	-
Mixed bacterial liquid	2μL	-

Table 6 System 4

Reagent(s)	Dosage of	Final reaction concentration
			1μM crRNA	2μL	200nM
10NM Cas12a protein	1μL	0.2nM
			1NM fluorescent reporter	1μL	0.1nM
10*Buffer	2μL	-
			ddH2O	12μL	-
Mixed bacterial liquid	2μL	-

Table 7 System 5

Reagent(s)	Dosage of	Final reaction concentration
			1μM crRNA	2μL	200nM
10NM Cas12a protein	1μL	0.5nM
			1NM fluorescent reporter	1μL	0.1nM
10*Buffer	2μL	-
			ddH2O	12μL	-
Mixed bacterial liquid	2μL	-

Table 8 System 6

Reagent(s)	Dosage of	Final reaction concentration
			1μM crRNA	2μL	150nM
10NM Cas12a protein	1μL	0.5nM
			1NM fluorescent reporter	1μL	0.1nM
10*Buffer	2μL	-
			ddH2O	12μL	-
Mixed bacterial liquid	2μL	-

Table 9 System 7

Reagent(s)	Dosage of	Final reaction concentration
			1μM crRNA	2μL	100nM
10NM Cas12a protein	1μL	0.5nM
			1NM fluorescent reporter	1μL	0.1nM
10*Buffer	2μL	-
			ddH2O	12μL	-
Mixed bacterial liquid	2μL	-

Table 10 CRISPR Cas12a detection technology reaction system

Reagent(s)	Dosage of	Final reaction concentration
			1μM crRNA	2μL	100nM
10NM Cas12a protein	1μL	0.5nM
			1NM fluorescent reporter	1μL	0.1nM
10*Buffer	2μL	-
			ddH2O	12μL	-
Mixed bacterial liquid	2μL	-

The final protein concentration was determined to be 0.5nM. The higher the crRNA concentration is, the better the crRNA concentration is, and the best effect is obtained when the crRNA concentration in the final reaction system is 100nM after multiple tests. From system 1 to system 4, we consider that crRNA concentrations are too low for specific recognition to be achieved, thus increasing crRNA concentrations to 200nM in system 4. However, the situation is not changed, and it is hypothesized that the Cas12a protein concentration is too low, so that in the system 5 we increase the Cas12a protein concentration to 0.5nM, a false negative phenomenon occurs, that is, a part of positive samples are not detected, so that in the systems 6 and 7 we override the previously elevated crRNA concentration, and gradually decrease the crRNA concentration on the current basis to obtain that the final concentration is 100nM, and the percent detection can be realized. After the above-mentioned debugging (see fig. 2, table 2 for part of the debugging process), the final reaction system was determined (table 10).

Under the reaction system, the experimental result can be observed under ultraviolet light only by adding the prepared system into a sample to be detected and then placing the sample into the reaction system for reaction for 20min at 37 ℃.

Example 3crRNA design

Different screening genes design different crrnas. And selecting a PAM locus (TTTN) on a target gene, selecting a 20bp base sequence after the locus as a recognition sequence, and designing crRNA.

5'UAAUUUCUACUAAGUGUAGAUGAUUGCCGGACCCGGACCGC 3' (shown as SEQ ID NO: 1)

Wherein: the non-underlined part is the structural sequence and the underlined part is the recognition sequence.

Example 4 identification of whether the screening pichia pastoris is a positive monoclonal vector sequence with the pPIC9K-CT05 vector:

AGATCTAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCCACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGCCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAGGATCCAAACGATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTATGCACCACCATCATCACCATACTTCTCGTGACGGCTACCAATGGACACCTGAAACTGGTTTGACTCAGGGTGTGCCATCCCTAGGAGTTATCTCTCCACCAACGAACATAGAGGACACGGATAAGGACGGCCCTTGGGACGTGATCGTAATTGGAGGAGGATATTGCGGTTTAACTGCAACACGTGATCTCACTGTAGCCGGTTTTAAGACTTTATTGTTAGAGGCAAGAGATCGTATTGGAGGTAGATCGTGGTCCTCCAATATTGACGGTTATCCTTACGAAATGGGTGGGACCTGGGTTCATTGGCACCAATCTCATGTGTGGAGAGAGATCACACGTTACAAAATGCATAATGCTTTGTCCCCCTCCTTCAACTTTTCAAGAGGTGTCAACCACTTTCAACTGAGAACAAATCCAACAACCTCGACATATATGACTCATGAAGCAGAGGATGAATTGCTTAGATCAGCTTTGCATAAGTTCACAAATGTTGACGGTACGAACGGCAGAACTGTTTTACCGTTCCCTCACGATATGTTCTATGTCCCCGAATTTCGAAAATACGACGAGATGAGTTACTCCGAACGTATTGATCAAATACGTGATGAATTGAGTCTGAATGAGAGAAGCAGCCTAGAAGCATTCATCCTGTTGTGTTCAGGTGGTACACTTGAAAACTCTTCGTTCGGAGAATTTCTCCATTGGTGGGCTATGTCTGGTTACACATATCAGGGTTGTATGGATTGTCTAATGAGCTATAAGTTTAAGGATGGTCAGAGTGCTTTTGCTAGAAGATTCTGGGAAGAGGCTGCTGGAACTGGTAGATTGGGATACGTTTTCGGTTGTCCTGTCAGGTCCGTGGTTAACGAAAGGGATGCTGCAAGAGTAACAGCAAGAGATGGTCGTGAATTTGCCGCTAAAAGGCTGGTTTGTACTATTCCATTGAATGTCTTGTCCACCATTCAATTTAGTCCAGCACTTTCAACAGAACGTATTAGCGCCATGCAGGCTGGTCATGTGAGCATGTGCACCAAAGTTCACGCAGAAGTTGACAACAAGGACATGAGATCATGGACTGGAATCGCCTATCCTTTCAATAAGTTGTGTTACGCTATCGGTGACGGAACTACTCCAGCTGGTAATACACATTTGGTCTGTTTCGGTAATAGCGCCAATCATATCCAACCCGATGAGGACGTTAGAGAAACCCTGAAAGCTGTTGGTCAACTGGCTCCTGGTACCTTTGGTGTTAAAAGATTGGTGTTCCACAATTGGGTGAAAGATGAGTTTGCTAAAGGAGCATGGTTCTTTTCAAGACCAGGTATGGTTTCTGAGTGCCTGCAAGGATTAAGAGAGAAGCACCGAGGAGTAGTGTTCGCAAATTCCGATTGGGCCCTTGGATGGAGGTCTTTTATCGACGGTGCAATTGAAGAGGGTACGAGAGCTGCGAGGGTCGTCTTGGAGGAGCTTGGCACTAAAAGGGAGGTAAAGGCTCGTTTGTAATACGTAGAATTCCCTAGGGCGGCCGCGAATTAATTCGCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTTATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCTATCGAATCTAAATGTAAGTTAAAATCTCTAAATAATTAAATAAGTCCCAGTTTCTCCATACGAACCTTAACAGCATTGCGGTGAGCATCTAGACCTTCAACAGCAGCCAGATCCATCACTGCTTGGCCAATATGTTTCAGTCCCTCAGGAGTTACGTCTTGTGAAGTGATGAACTTCTGGAAGGTTGCAGTGTTAACTCCGCTGTATTGACGGGCATATCCGTACGTTGGCAAAGTGTGGTTGGTACCGGAGGAGTAATCTCCACAACTCTCTGGAGAGTAGGCACCAACAAACACAGATCCAGCGTGTTGTACTTGATCAACATAAGAAGAAGCATTCTCGATTTGCAGGATCAAGTGTTCAGGAGCGTACTGATTGGACATTTCCAAAGCCTGCTCGTAGGTTGCAACCGATAGGGTTGTAGAGTGTGCAATACACTTGCGTACAATTTCAACCCTTGGCAACTGCACAGCTTGGTTGTGAACAGCATCTTCAATTCTGGCAAGCTCCTTGTCTGTCATATCGACAGCCAACAGAATCACCTGGGAATCAATACCATGTTCAGCTTGAGACAGAAGGTCTGAGGCAACGAAATCTGGATCAGCGTATTTATCAGCAATAACTAGAACTTCAGAAGGCCCAGCAGGCATGTCAATACTACACAGGGCTGATGTGTCATTTTGAACCATCATCTTGGCAGCAGTAACGAACTGGTTTCCTGGACCAAATATTTTGTCACACTTAGGAACAGTTTCTGTTCCGTAAGCCATAGCAGCTACTGCCTGGGCGCCTCCTGCTAGCACGATACACTTAGCACCAACCTTGTGGGCAACGTAGATGACTTCTGGGGTAAGGGTACCATCCTTCTTAGGTGGAGATGCAAAAACAATTTCTTTGCAACCAGCAACTTTGGCAGGAACACCCAGCATCAGGGAAGTGGAAGGCAGAATTGCGGTTCCACCAGGAATATAGAGGCCAACTTTCTCAATAGGTCTTGCAAAACGAGAGCAGACTACACCAGGGCAAGTCTCAACTTGCAACGTCTCCGTTAGTTGAGCTTCATGGAATTTCCTGACGTTATCTATAGAGAGATCAATGGCTCTCTTAACGTTATCTGGCAATTGCATAAGTTCCTCTGGGAAAGGAGCTTCTAACACAGGTGTCTTCAAAGCGACTCCATCAAACTTGGCAGTTAGTTCTAAAAGGGCTTTGTCACCATTTTGACGAACATTGTCGACAATTGGTTTGACTAATTCCATAATCTGTTCCGTTTTCTGGATAGGACGACGAAGGGCATCTTCAATTTCTTGTGAGGAGGCCTTAGAAACGTCAATTTTGCACAATTCAATACGACCTTCAGAAGGGACTTCTTTAGGTTTGGATTCTTCTTTAGGTTGTTCCTTGGTGTATCCTGGCTTGGCATCTCCTTTCCTTCTAGTGACCTTTAGGGACTTCATATCCAGGTTTCTCTCCACCTCGTCCAACGTCACACCGTACTTGGCACATCTAACTAATGCAAAATAAAATAAGTCAGCACATTCCCAGGCTATATCTTCCTTGGATTTAGCTTCTGCAAGTTCATCAGCTTCCTCCCTAATTTTAGCGTTCAACAAAACTTCGTCGTCAAATAACCGTTTGGTATAAGAACCTTCTGGAGCATTGCTCTTACGATCCCACAAGGTGGCTTCCATGGCTCTAAGACCCTTTGATTGGCCAAAACAGGAAGTGCGTTCCAAGTGACAGAAACCAACACCTGTTTGTTCAACCACAAATTTCAAGCAGTCTCCATCACAATCCAATTCGATACCCAGCAACTTTTGAGTTGCTCCAGATGTAGCACCTTTATACCACAAACCGTGACGACGAGATTGGTAGACTCCAGTTTGTGTCCTTATAGCCTCCGGAATAGACTTTTTGGACGAGTACACCAGGCCCAACGAGTAATTAGAAGAGTCAGCCACCAAAGTAGTGAATAGACCATCGGGGCGGTCAGTAGTCAAAGACGCCAACAAAATTTCACTGACAGGGAACTTTTTGACATCTTCAGAAAGTTCGTATTCAGTAGTCAATTGCCGAGCATCAATAATGGGGATTATACCAGAAGCAACAGTGGAAGTCACATCTACCAACTTTGCGGTCTCAGAAAAAGCATAAACAGTTCTACTACCGCCATTAGTGAAACTTTTCAAATCGCCCAGTGGAGAAGAAAAAGGCACAGCGATACTAGCATTAGCGGGCAAGGATGCAACTTTATCAACCAGGGTCCTATAGATAACCCTAGCGCCTGGGATCATCCTTTGGACAACTCTTTCTGCCAAATCTAGGTCCAAAATCACTTCATTGATACCATTATTGTACAACTTGAGCAAGTTGTCGATCAGCTCCTCAAATTGGTCCTCTGTAACGGATGACTCAACTTGCACATTAACTTGAAGCTCAGTCGATTGAGTGAACTTGATCAGGTTGTGCAGCTGGTCAGCAGCATAGGGAAACACGGCTTTTCCTACCAAACTCAAGGAATTATCAAACTCTGCAACACTTGCGTATGCAGGTAGCAAGGGAAATGTCATACTTGAAGTCGGACAGTGAGTGTAGTCTTGAGAAATTCTGAAGCCGTATTTTTATTATCAGTGAGTCAGTCATCAGGAGATCCTCTACGCCGGACGCATCGTGGCCGACCTGCAGGGGGGGGGGGGGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGAGGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTTTCCCCCCCCCCCCTGCAGGTCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGAGTATCTATGATTGGAAGTATGGGAATGGTGATACCCGCATTCTTCAGTGTCTTGAGGTCTCCTATCAGATTATGCCCAACTAAAGCAACCGGAGGAGGAGATTTCATGGTAAATTTCTCTGACTTTTGGTCATCAGTAGACTCGAACTGTGAGACTATCTCGGTTATGACAGCAGAAATGTCCTTCTTGGAGACAGTAAATGAAGTCCCACCAATAAAGAAATCCTTGTTATCAGGAACAAACTTCTTGTTTCGAACTTTTTCGGTGCCTTGAACTATAAAATGTAGAGTGGATATGTCGGGTAGGAATGGAGCGGGCAAATGCTTACCTTCTGGACCTTCAAGAGGTATGTAGGGTTTGTAGATACTGATGCCAACTTCAGTGACAACGTTGCTATTTCGTTCAAACCATTCCGAATCCAGAGAAATCAAAGTTGTTTGTCTACTATTGATCCAAGCCAGTGCGGTCTTGAAACTGACAATAGTGTGCTCGTGTTTTGAGGTCATCTTTGTATGAATAAATCTAGTCTTTGATCTAAATAATCTTGACGAGCCAAGGCGATAAATACCCAAATCTAAAACTCTTTTAAAACGTTAAAAGGACAAGTATGTCTGCCTGTATTAAACCCCAAATCAGCTCGTAGTCTGATCCTCATCAACTTGAGGGGCACTATCTTGTTTTAGAGAAATTTGCGGAGATGCGATATCGAGAAAAAGGTACGCTGATTTTAAACGTGAAATTTATCTCAAGATCTCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTAATTCTCATGTTTGACAGCTTATCATCGATAAGCTGACTCATGTTGGTATTGTGAAATAGACGCAGATCGGGAACACTGAAAAATAACAGTTATTATTCG( As shown in SEQ ID NO. 2

Wherein the underline is CT05 gene, the bold part is PAM site, the italic part is specific recognition sequence (20 bp)

Thus crRNA sequence is:

5 'UAAUUUCUACUAAGUGUUAGAUAUAUGCAUCUUAAGGGAUC 3' (shown in SEQ ID NO: 3)

Wherein: the non-underlined part is the structural sequence and the underlined part is the recognition sequence.

Experimental operation:

From the solid medium incubated overnight at 37℃the monoclonal colonies were picked up, and in 10. Mu.L of the medium, 1. Mu.L of the bacterial liquid was added to 30. Mu.L of bufferI prepared in example 1, followed by 5. Mu.L of the snail protease solution prepared in example 1. The reaction was carried out at 37℃and 600rpm for 30min. 2 mu L of the reaction solution is added into the pre-prepared detection system of the example 2 (see table 10), and the reaction is carried out for 15min at 37 ℃, so that the experimental result can be observed under ultraviolet light (figure 4), and meanwhile, colony PCR is used for screening, and the result is shown in figure 5.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> Shenzhen Ruidelin Biotechnology Co., ltd

<120> Fungus screening reagent, screening method, kit and application

<130> S21P003752

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 41

<212> RNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 1

uaauuucuac uaaguguaga ugauugccgg acccggaccg c 41

<210> 2

<211> 10782

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 2

agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 60

gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 120

tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc 180

agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta 240

acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta 300

tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg 360

agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct 420

gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg 480

ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcgcca taccgtttgt 540

cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct 600

ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct 660

ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact 720

gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat 780

atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt 840

actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga 900

caacttgaga agatcaaaaa acaactaatt attcgaagga tccaaacgat gagatttcct 960

tcaattttta ctgcagtttt attcgcagca tcctccgcat tagctgctcc agtcaacact 1020

acaacagaag atgaaacggc acaaattccg gctgaagctg tcatcggtta ctcagattta 1080

gaaggggatt tcgatgttgc tgttttgcca ttttccaaca gcacaaataa cgggttattg 1140

tttataaata ctactattgc cagcattgct gctaaagaag aaggggtatc tctcgagaaa 1200

agagaggctg aagctatgca ccaccatcat caccatactt ctcgtgacgg ctaccaatgg 1260

acacctgaaa ctggtttgac tcagggtgtg ccatccctag gagttatctc tccaccaacg 1320

aacatagagg acacggataa ggacggccct tgggacgtga tcgtaattgg aggaggatat 1380

tgcggtttaa ctgcaacacg tgatctcact gtagccggtt ttaagacttt attgttagag 1440

gcaagagatc gtattggagg tagatcgtgg tcctccaata ttgacggtta tccttacgaa 1500

atgggtggga cctgggttca ttggcaccaa tctcatgtgt ggagagagat cacacgttac 1560

aaaatgcata atgctttgtc cccctccttc aacttttcaa gaggtgtcaa ccactttcaa 1620

ctgagaacaa atccaacaac ctcgacatat atgactcatg aagcagagga tgaattgctt 1680

agatcagctt tgcataagtt cacaaatgtt gacggtacga acggcagaac tgttttaccg 1740

ttccctcacg atatgttcta tgtccccgaa tttcgaaaat acgacgagat gagttactcc 1800

gaacgtattg atcaaatacg tgatgaattg agtctgaatg agagaagcag cctagaagca 1860

ttcatcctgt tgtgttcagg tggtacactt gaaaactctt cgttcggaga atttctccat 1920

tggtgggcta tgtctggtta cacatatcag ggttgtatgg attgtctaat gagctataag 1980

tttaaggatg gtcagagtgc ttttgctaga agattctggg aagaggctgc tggaactggt 2040

agattgggat acgttttcgg ttgtcctgtc aggtccgtgg ttaacgaaag ggatgctgca 2100

agagtaacag caagagatgg tcgtgaattt gccgctaaaa ggctggtttg tactattcca 2160

ttgaatgtct tgtccaccat tcaatttagt ccagcacttt caacagaacg tattagcgcc 2220

atgcaggctg gtcatgtgag catgtgcacc aaagttcacg cagaagttga caacaaggac 2280

atgagatcat ggactggaat cgcctatcct ttcaataagt tgtgttacgc tatcggtgac 2340

ggaactactc cagctggtaa tacacatttg gtctgtttcg gtaatagcgc caatcatatc 2400

caacccgatg aggacgttag agaaaccctg aaagctgttg gtcaactggc tcctggtacc 2460

tttggtgtta aaagattggt gttccacaat tgggtgaaag atgagtttgc taaaggagca 2520

tggttctttt caagaccagg tatggtttct gagtgcctgc aaggattaag agagaagcac 2580

cgaggagtag tgttcgcaaa ttccgattgg gcccttggat ggaggtcttt tatcgacggt 2640

gcaattgaag agggtacgag agctgcgagg gtcgtcttgg aggagcttgg cactaaaagg 2700

gaggtaaagg ctcgtttgta atacgtagaa ttccctaggg cggccgcgaa ttaattcgcc 2760

ttagacatga ctgttcctca gttcaagttg ggcacttacg agaagaccgg tcttgctaga 2820

ttctaatcaa gaggatgtca gaatgccatt tgcctgagag atgcaggctt catttttgat 2880

acttttttat ttgtaaccta tatagtatag gatttttttt gtcattttgt ttcttctcgt 2940

acgagcttgc tcctgatcag cctatctcgc agctgatgaa tatcttgtgg taggggtttg 3000

ggaaaatcat tcgagtttga tgtttttctt ggtatttccc actcctcttc agagtacaga 3060

agattaagtg agaagttcgt ttgtgcaagc ttatcgataa gctttaatgc ggtagtttat 3120

cacagttaaa ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg 3180

tcatcctcgg caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc 3240

cgggcctctt gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc 3300

tagcgctata tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc 3360

gctttggccg ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga 3420

tcatggcgac cacacccgtc ctgtggatct atcgaatcta aatgtaagtt aaaatctcta 3480

aataattaaa taagtcccag tttctccata cgaaccttaa cagcattgcg gtgagcatct 3540

agaccttcaa cagcagccag atccatcact gcttggccaa tatgtttcag tccctcagga 3600

gttacgtctt gtgaagtgat gaacttctgg aaggttgcag tgttaactcc gctgtattga 3660

cgggcatatc cgtacgttgg caaagtgtgg ttggtaccgg aggagtaatc tccacaactc 3720

tctggagagt aggcaccaac aaacacagat ccagcgtgtt gtacttgatc aacataagaa 3780

gaagcattct cgatttgcag gatcaagtgt tcaggagcgt actgattgga catttccaaa 3840

gcctgctcgt aggttgcaac cgatagggtt gtagagtgtg caatacactt gcgtacaatt 3900

tcaacccttg gcaactgcac agcttggttg tgaacagcat cttcaattct ggcaagctcc 3960

ttgtctgtca tatcgacagc caacagaatc acctgggaat caataccatg ttcagcttga 4020

gacagaaggt ctgaggcaac gaaatctgga tcagcgtatt tatcagcaat aactagaact 4080

tcagaaggcc cagcaggcat gtcaatacta cacagggctg atgtgtcatt ttgaaccatc 4140

atcttggcag cagtaacgaa ctggtttcct ggaccaaata ttttgtcaca cttaggaaca 4200

gtttctgttc cgtaagccat agcagctact gcctgggcgc ctcctgctag cacgatacac 4260

ttagcaccaa ccttgtgggc aacgtagatg acttctgggg taagggtacc atccttctta 4320

ggtggagatg caaaaacaat ttctttgcaa ccagcaactt tggcaggaac acccagcatc 4380

agggaagtgg aaggcagaat tgcggttcca ccaggaatat agaggccaac tttctcaata 4440

ggtcttgcaa aacgagagca gactacacca gggcaagtct caacttgcaa cgtctccgtt 4500

agttgagctt catggaattt cctgacgtta tctatagaga gatcaatggc tctcttaacg 4560

ttatctggca attgcataag ttcctctggg aaaggagctt ctaacacagg tgtcttcaaa 4620

gcgactccat caaacttggc agttagttct aaaagggctt tgtcaccatt ttgacgaaca 4680

ttgtcgacaa ttggtttgac taattccata atctgttccg ttttctggat aggacgacga 4740

agggcatctt caatttcttg tgaggaggcc ttagaaacgt caattttgca caattcaata 4800

cgaccttcag aagggacttc tttaggtttg gattcttctt taggttgttc cttggtgtat 4860

cctggcttgg catctccttt ccttctagtg acctttaggg acttcatatc caggtttctc 4920

tccacctcgt ccaacgtcac accgtacttg gcacatctaa ctaatgcaaa ataaaataag 4980

tcagcacatt cccaggctat atcttccttg gatttagctt ctgcaagttc atcagcttcc 5040

tccctaattt tagcgttcaa caaaacttcg tcgtcaaata accgtttggt ataagaacct 5100

tctggagcat tgctcttacg atcccacaag gtggcttcca tggctctaag accctttgat 5160

tggccaaaac aggaagtgcg ttccaagtga cagaaaccaa cacctgtttg ttcaaccaca 5220

aatttcaagc agtctccatc acaatccaat tcgataccca gcaacttttg agttgctcca 5280

gatgtagcac ctttatacca caaaccgtga cgacgagatt ggtagactcc agtttgtgtc 5340

cttatagcct ccggaataga ctttttggac gagtacacca ggcccaacga gtaattagaa 5400

gagtcagcca ccaaagtagt gaatagacca tcggggcggt cagtagtcaa agacgccaac 5460

aaaatttcac tgacagggaa ctttttgaca tcttcagaaa gttcgtattc agtagtcaat 5520

tgccgagcat caataatggg gattatacca gaagcaacag tggaagtcac atctaccaac 5580

tttgcggtct cagaaaaagc ataaacagtt ctactaccgc cattagtgaa acttttcaaa 5640

tcgcccagtg gagaagaaaa aggcacagcg atactagcat tagcgggcaa ggatgcaact 5700

ttatcaacca gggtcctata gataacccta gcgcctggga tcatcctttg gacaactctt 5760

tctgccaaat ctaggtccaa aatcacttca ttgataccat tattgtacaa cttgagcaag 5820

ttgtcgatca gctcctcaaa ttggtcctct gtaacggatg actcaacttg cacattaact 5880

tgaagctcag tcgattgagt gaacttgatc aggttgtgca gctggtcagc agcataggga 5940

aacacggctt ttcctaccaa actcaaggaa ttatcaaact ctgcaacact tgcgtatgca 6000

ggtagcaagg gaaatgtcat acttgaagtc ggacagtgag tgtagtcttg agaaattctg 6060

aagccgtatt tttattatca gtgagtcagt catcaggaga tcctctacgc cggacgcatc 6120

gtggccgacc tgcagggggg gggggggcgc tgaggtctgc ctcgtgaaga aggtgttgct 6180

gactcatacc aggcctgaat cgccccatca tccagccaga aagtgaggga gccacggttg 6240

atgagagctt tgttgtaggt ggaccagttg gtgattttga acttttgctt tgccacggaa 6300

cggtctgcgt tgtcgggaag atgcgtgatc tgatccttca actcagcaaa agttcgattt 6360

attcaacaaa gccgccgtcc cgtcaagtca gcgtaatgct ctgccagtgt tacaaccaat 6420

taaccaattc tgattagaaa aactcatcga gcatcaaatg aaactgcaat ttattcatat 6480

caggattatc aataccatat ttttgaaaaa gccgtttctg taatgaagga gaaaactcac 6540

cgaggcagtt ccataggatg gcaagatcct ggtatcggtc tgcgattccg actcgtccaa 6600

catcaataca acctattaat ttcccctcgt caaaaataag gttatcaagt gagaaatcac 6660

catgagtgac gactgaatcc ggtgagaatg gcaaaagctt atgcatttct ttccagactt 6720

gttcaacagg ccagccatta cgctcgtcat caaaatcact cgcatcaacc aaaccgttat 6780

tcattcgtga ttgcgcctga gcgagacgaa atacgcgatc gctgttaaaa ggacaattac 6840

aaacaggaat cgaatgcaac cggcgcagga acactgccag cgcatcaaca atattttcac 6900

ctgaatcagg atattcttct aatacctgga atgctgtttt cccggggatc gcagtggtga 6960

gtaaccatgc atcatcagga gtacggataa aatgcttgat ggtcggaaga ggcataaatt 7020

ccgtcagcca gtttagtctg accatctcat ctgtaacatc attggcaacg ctacctttgc 7080

catgtttcag aaacaactct ggcgcatcgg gcttcccata caatcgatag attgtcgcac 7140

ctgattgccc gacattatcg cgagcccatt tatacccata taaatcagca tccatgttgg 7200

aatttaatcg cggcctcgag caagacgttt cccgttgaat atggctcata acaccccttg 7260

tattactgtt tatgtaagca gacagtttta ttgttcatga tgatatattt ttatcttgtg 7320

caatgtaaca tcagagattt tgagacacaa cgtggctttc cccccccccc ctgcaggtcg 7380

gcatcaccgg cgccacaggt gcggttgctg gcgcctatat cgccgacatc accgatgggg 7440

aagatcgggc tcgccacttc gggctcatga gcgcttgttt cggcgtgggt atggtggcag 7500

gccccgtggc cgggggactg ttgggcgcca tctccttgca tgcaccattc cttgcggcgg 7560

cggtgctcaa cggcctcaac ctactactgg gctgcttcct aatgcaggag tcgcataagg 7620

gagagcgtcg agtatctatg attggaagta tgggaatggt gatacccgca ttcttcagtg 7680

tcttgaggtc tcctatcaga ttatgcccaa ctaaagcaac cggaggagga gatttcatgg 7740

taaatttctc tgacttttgg tcatcagtag actcgaactg tgagactatc tcggttatga 7800

cagcagaaat gtccttcttg gagacagtaa atgaagtccc accaataaag aaatccttgt 7860

tatcaggaac aaacttcttg tttcgaactt tttcggtgcc ttgaactata aaatgtagag 7920

tggatatgtc gggtaggaat ggagcgggca aatgcttacc ttctggacct tcaagaggta 7980

tgtagggttt gtagatactg atgccaactt cagtgacaac gttgctattt cgttcaaacc 8040

attccgaatc cagagaaatc aaagttgttt gtctactatt gatccaagcc agtgcggtct 8100

tgaaactgac aatagtgtgc tcgtgttttg aggtcatctt tgtatgaata aatctagtct 8160

ttgatctaaa taatcttgac gagccaaggc gataaatacc caaatctaaa actcttttaa 8220

aacgttaaaa ggacaagtat gtctgcctgt attaaacccc aaatcagctc gtagtctgat 8280

cctcatcaac ttgaggggca ctatcttgtt ttagagaaat ttgcggagat gcgatatcga 8340

gaaaaaggta cgctgatttt aaacgtgaaa tttatctcaa gatctctgcc tcgcgcgttt 8400

cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct 8460

gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg 8520

tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg gcttaactat 8580

gcggcatcag agcagattgt actgagagtg caccatatgc ggtgtgaaat accgcacaga 8640

tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac tgactcgctg 8700

cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta 8760

tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc 8820

aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag 8880

catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac 8940

caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc 9000

ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcaatg ctcacgctgt 9060

aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc 9120

gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga 9180

cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta 9240

ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta 9300

tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga 9360

tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg 9420

cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag 9480

tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc 9540

tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact 9600

tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt 9660

cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta 9720

ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta 9780

tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc 9840

gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat 9900

agtttgcgca acgttgttgc cattgctgca ggcatcgtgg tgtcacgctc gtcgtttggt 9960

atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg 10020

tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca 10080

gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta 10140

agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg 10200

cgaccgagtt gctcttgccc ggcgtcaaca cgggataata ccgcgccaca tagcagaact 10260

ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg 10320

ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt 10380

actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga 10440

ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc 10500

atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa 10560

caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt 10620

attatcatga cattaaccta taaaaatagg cgtatcacga ggccctttcg tcttcaagaa 10680

ttaattctca tgtttgacag cttatcatcg ataagctgac tcatgttggt attgtgaaat 10740

agacgcagat cgggaacact gaaaaataac agttattatt cg 10782

<210> 3

<211> 41

<212> RNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 3

uaauuucuac uaaguguaga uauuaugcau cuuaagggau c 41

Claims (4)

1. A method for screening a fungal colony comprising the steps of:

S1: mixing a lysozyme reagent with a sample to obtain a mixed bacterial solution;

s2: mixing the mixed bacterial liquid with a detection reagent, and detecting;

The mixing time in the step S1 is 25-50 min, and the temperature is 35-38 ℃;

The lysozyme comprises the following components:

Sorbitol 0.9 mol/L

EDTA 0.1 mol/L

Snail protease 30 mg/mL;

The detection reagent comprises the following components:

1µM crRNA 100 nM

10nM Cas12a protein 0.5 nM

1NM fluorescent reporter 0.1 nM

The volume ratio of 10 XBuffer to ddH ₂ O is 1:6;

The crRNA design method comprises the step of selecting a base sequence of 20 bp base sequences after a PAM locus TTTN on a target gene as a recognition sequence.

2. The screening method of claim 1, wherein the volume ratio of said lysozyme to said sample in S1 is 35:1.

3. The method of claim 1, wherein the mixing in S2 is performed for a period of 15 min and at a temperature of 35 to 38 ℃.

4. The application of the lysozyme and the detection reagent in detecting and/or screening fungus colonies;

The lysozyme comprises the following components:

Sorbitol 0.9 mol/L

EDTA 0.1 mol/L

Snail protease 30 mg/mL;

The detection reagent comprises the following components:

1µM crRNA 100 nM

10nM Cas12a protein 0.5 nM

1NM fluorescent reporter 0.1 nM

The volume ratio of 10 XBuffer to ddH ₂ O is 1:6;

The crRNA design method comprises the step of selecting a base sequence of 20 bp base sequences after a PAM locus TTTN on a target gene as a recognition sequence.