CN114438163A - Fungus screening reagent, screening method, kit and application - Google Patents

Fungus screening reagent, screening method, kit and application Download PDF

Info

Publication number
CN114438163A
CN114438163A CN202210103372.1A CN202210103372A CN114438163A CN 114438163 A CN114438163 A CN 114438163A CN 202210103372 A CN202210103372 A CN 202210103372A CN 114438163 A CN114438163 A CN 114438163A
Authority
CN
China
Prior art keywords
screening
reagent
detection
kit
crrna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210103372.1A
Other languages
Chinese (zh)
Other versions
CN114438163B (en
Inventor
黄鹤
方欣
赵弘
于铁妹
潘俊锋
刘建
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Readline Biotechnology Co ltd
Original Assignee
Shenzhen Readline Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Readline Biotechnology Co ltd filed Critical Shenzhen Readline Biotechnology Co ltd
Priority to CN202210103372.1A priority Critical patent/CN114438163B/en
Publication of CN114438163A publication Critical patent/CN114438163A/en
Application granted granted Critical
Publication of CN114438163B publication Critical patent/CN114438163B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Toxicology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the field of colony screening, in particular to a fungus screening reagent, a screening method, a kit and application. The invention provides a bacteriolysis reagent, which comprises the following components: 0.8-1.1 mol/L sorbitol, 10-20 mol/L EDTA, 5-60 mg/mL snail protease. The invention applies the CRISPRCs 12a technology to fungal colony screening for the first time, and carries out improved optimization based on the technical principle, so that the CRISPRCs are more suitable for high-throughput screening. In the aspect of plasmid design, a PAM sequence is creatively introduced at the end of a gene, so that all crRNA sequences can simultaneously recognize a gene fragment and a vector fragment. In addition, the invention utilizes the automatic equipment and a large-batch screening reaction system and conditions to fully adapt to an automatic scheme for bacterial colony screening, greatly shortens the screening time and greatly improves the strain breeding speed and the strain screening efficiency.

Description

Fungus screening reagent, screening method, kit and application
Technical Field
The invention relates to the field of colony screening, in particular to a fungus screening reagent, a screening method, a kit and application.
Background
In the engineering bacteria modification process, a positive monoclonal bacterial colony is required to be screened out for further modification and culture. In the existing method, colony PCR is widely applied to screening work of positive monoclone of engineering bacteria as the most rapid and convenient screening method. In the case of fungi, due to their cell wall and chromosome structure, they require sample pretreatment for colony PCR:
taking 1.5mL of yeast strain in logarithmic phase, 13000r/min, centrifuging for 15s, removing supernatant, washing once with double distilled water, centrifuging for 15s at 13000r/min, suspending precipitate in 200 mu L of TE buffer solution, boiling on boiling water for 1-10 min, carrying out ice bath for 10min, 13000r/min, centrifuging for 5min, storing supernatant at-20 ℃, and taking 1 mu L for PCR. Or taking dried yeast colonies with the diameter of more than 3mm, placing the dried yeast colonies in an EP tube, covering the EP tube with a cover, heating the yeast colonies in a microwave oven, adding 30 mu L of TE, oscillating, 13000r/min, centrifuging for 2-5 min, storing supernatant in a bath at-20 ℃, and taking 1 mu L of the supernatant for PCR. Then, the size of the amplified sequence is analyzed and compared to achieve the purpose of selecting positive monoclone.
Due to the high throughput and automation requirements of a research and development platform, the screening result of the existing colony PCR technology is based on DNA gel electrophoresis, but the technology cannot realize automatic substitution, and the screening method of colony PCR and gel electrophoresis is long in time consumption and not beneficial to flux improvement.
Disclosure of Invention
In view of the above, the invention provides a fungus screening reagent, a screening method, a kit and an application.
The invention aims to develop a quick colony screening technology which is applicable to an automatic platform and is quicker and more effective, namely a quick colony screening technology based on snail protease and Cas12a protein. The key point of the invention is that the CRISPR Cas12a technology is applied to fungal colony screening for the first time, and is improved and optimized based on the technical principle, so that the CRISPR Cas12a technology is more suitable for high-throughput screening. In the aspect of plasmid design, a PAM sequence is creatively introduced into the tail end of a gene, so that all crRNA sequences can simultaneously recognize a gene fragment and a vector fragment. In addition, the invention utilizes the automatic equipment, large-batch screening reaction system and reaction conditions, so that the automatic bacterial colony screening method is fully suitable for the automatic implementation scheme of bacterial colony screening, and greatly improves the strain breeding speed and the strain screening efficiency.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a bacteriolysis reagent, which comprises the following components:
sorbitol 0.8-1.1 mol/L
EDTA 10～20mol/L
5-60 mg/mL snail protease.
In some embodiments of the invention, the lytic reagent comprises sorbitol in an amount of 0.9 mol/L.
In some embodiments of the invention, the lytic reagent comprises EDTA 10 mol/L.
In some embodiments of the invention, the lytic reagent comprises glusulin 30 mg/mL.
The invention also provides a detection reagent, which comprises the following components:
1μM crRNA 20～200nM
10nM Cas12a protein 0.2-0.5 nM
0.1-0.5 nM of 1nM fluorescent reporter
10 × Buffer and ddH2The volume ratio of O is 1: 6.
In some embodiments of the invention, the detection reagent comprises 1 μ M crRNA100 nM.
In some embodiments of the invention, the detection reagent comprises 10nM Cas12a protein 0.5 nM.
In some embodiments of the invention, the detection reagent comprises 0.1nM of 1nM fluorescent reporter.
The invention also provides a design method of the crRNA of the detection reagent, which comprises the step of selecting a base sequence of 20bp behind the TTTN site of PAM on a target gene as a recognition sequence.
The invention also provides a screening reagent which comprises the bacteriolysis reagent and/or the detection reagent.
The invention also provides a screening method of fungal colonies, which comprises the following steps:
s1: mixing the bacteriolytic reagent and/or the bacteriolytic reagent in the screening reagent with a sample to obtain a mixed bacterial liquid;
s2: and mixing the mixed bacterial liquid with the detection reagent and/or the detection reagent in the screening reagent, and detecting.
In some embodiments of the present invention, the mixing time in the screening method S1 is 10-50 min, and the temperature is 35-38 ℃.
In some embodiments of the invention, the mixing time described in screening method S1 above is 30 min.
In some embodiments of the invention, the temperature of the mixing described in screening method S1 above is 37 ℃.
In some embodiments of the present invention, the ratio of the volume of the bacteriolytic reagent to the volume of the sample in the screening method S1 is 35: 1.
In some embodiments of the present invention, the mixing time in the screening method S2 is 15min, and the temperature is 35 to 38 ℃.
In some embodiments of the invention, the temperature of the mixing in the screening method S2 is 37 deg.C
The invention also provides a kit comprising the lysis reagent, the detection reagent and/or the screening reagent and an acceptable auxiliary agent.
The invention also provides application of the bacteriolysis reagent, the detection reagent, the screening reagent and/or the kit in detection and/or screening of fungal colonies.
The invention provides a bacteriolysis reagent, which comprises the following components:
sorbitol 0.8-1.1 mol/L
EDTA 10～20mol/L
5-60 mg/mL snail protease.
Aiming at the defects of the existing colony PCR, the invention reforms the method and the technology for screening the target colony, breaks through the flux limitation of an instrument (an electrophoresis apparatus and a PCR instrument) for screening the colony on the colony screening, and can realize the maximum flux screening. Meanwhile, the screening time is shortened from 3 hours to 1 hour, and the screening efficiency is greatly improved.
The invention is compared with the colony PCR technology
Figure BDA0003492997990000031
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.
FIG. 1 shows a process for adjusting a bacteria-breaking system;
FIG. 2 shows the results of reaction system tests;
FIG. 3 shows pPIC9K-CT05 vector;
FIG. 4 shows new method screening results;
wherein: + is a positive internal reference, and 1-5 shows positive, namely the target bacterial colony;
FIG. 5 shows the results of colony PCR screening;
wherein: m is marker, and 1-5 shows positive, namely the target bacterial colony.
Detailed Description
The invention discloses a fungus screening reagent, a screening method, a kit and application.
It should be understood that one or more of the expressions "… …" individually includes each of the stated objects after the expression and various different combinations of two or more of the stated objects, unless otherwise understood from the context and usage. The expression "and/or" in connection with three or more of the stated objects shall be understood to have the same meaning unless otherwise understood from the context.
The use of the terms "comprising," "having," or "containing," including grammatical equivalents thereof, are generally to be construed as open-ended and non-limiting, e.g., without excluding other unstated elements or steps, unless specifically stated otherwise or otherwise understood from context.
It should be understood that the order of steps or order for performing certain actions is immaterial so long as the invention remains operable. Further, two or more steps or actions may be performed simultaneously.
The use of any and all examples, or exemplary language such as "for example" or "including" herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
Moreover, the numerical ranges and parameters setting forth the invention are approximations that may have numerical values that are within the numerical ranges specified in the specific examples. Any numerical value, however, inherently contains certain standard deviations found in their respective testing measurements. Accordingly, unless expressly stated otherwise, it is understood that all ranges, amounts, values and percentages used in this disclosure are by weight modified by "about". As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range.
The snail protease provided by the invention is purchased from Hoyi holy (the product name is Snailase snail enzyme, the product number is 10404ES08), and raw materials and reagents used in fluorescence detection and identification tests can be purchased from the market.
Abbreviations and English Means of
PCR Polymerase chain reaction
crRNA Gene editing-specific guide RNA
Tri-HCl Tris hydroxymethyl aminomethane hydrochloride
Cas12a protein Gene editing proteins
Buffer Reaction buffer
PAM sites Cas12a protein recognition site
TTTN Nucleic acid sequence, N is A, T, C, G
EDTA Ethylenediaminetetraacetic acid
The invention is further illustrated by the following examples:
example 1 Snail protease disruption
Raw materials and reagents: snail protease is purchased from Saccharum sinensis and digestive tract of Hodgy, Snail, and contains more than 20 enzymes such as cellulase, pectinase, amylase, and protease.
Reagent preparation: 0.9mol/L sorbitol, snail protein (30mg/ml) dissolved in 0.9mol/L sorbitol, 10mol/L EDTA
buffer I: 0.9mol/L sorbitol, 0.1mol/L EDTA (0.9mol/L sorbitol: 10mol/L EDTA ═ 1:100)
The experimental steps are as follows:
adding 30 μ L of buffer I and 5 μ L of snail protease solution into the single clone, performing water bath at 37 deg.C for 30min, separating the medium by 5min, and oscillating once to avoid cell precipitation to the bottom of the tube to obtain mixed bacterial liquid.
As the broken thalli and DNA are released in a large quantity, the reaction system is sticky and is not beneficial to liquid transfer operation, so the key point of the step is to adjust the fungus breaking efficiency according to the detection sensitivity requirement. The invention seeks balance in bacteria breaking efficiency, system viscosity and detection sensitivity, so that the whole screening system is more efficient and is beneficial to operation. So that the invention has great advantages in practical application. The adjustment process of the bacteria breaking system is shown in figure 1.
The reaction is carried out at the optimum temperature of 37 ℃, and in order to realize the balance and unification of normal liquid transfer and bacteria breaking plasmid release of the viscosity of the system, a large number of verification experiments are carried out on the concentration and the reaction time of the lysozyme. As shown in FIG. 1, we set 12 groups of lysozyme concentrations of 5mg/mL, 10mg/mL, 15mg/mL, 20mg/mL, 25mg/mL, 30mg/mL, 35mg/mL, 40mg/mL, 45mg/mL, 50mg/mL, 55mg/mL, 60mg/mL, and 9 groups of reaction time tests of 10min, 15min, 20min, 25min, 30min, 35min, 40min, 45min, 50 min.
There were 108 experimental groups, each group having eight parallel controls and 864 bacteria-breaking reactions, and the test results are shown in table 1:
TABLE 1 bacteria lysis reaction
Test results 10min 15min 20min 25min 30min 35min 40min 45min 50min
5mg/mL 1- 1- 1- 1- 1- 1- 1- 1- 1-
10mg/mL 1- 1- 1- 1- 1- 1- 1- 1- 1-
15mg/mL 1- 1- 1- 1- 1- 1- 1- 1- 1-
20mg/mL 1- 1- 1- 1- 1- 1- 1+/- 1+/- 1+
25mg/mL 1- 1- 1- 1+/- 1+/- 1+ 1+ 1+ 1+
30mg/mL 1- 1+/- 1+/- 1+ 1+ 1+ 1+ 1+ 1+
35mg/mL 1+/- 1+/- 1+ 0+ 0+ 0+ 0+ 0+ 0+
40mg/mL 1+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+
45mg/mL 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+
50mg/mL 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+
55mg/mL 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+
60mg/mL 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+
The result shows that the liquid viscosity is influenced by the bacteria breaking system, so that the liquid transferring process is difficult to carry out, when the liquid viscosity is moderate, the liquid can be transferred, and when the liquid viscosity is too high, the liquid can not be transferred; "pipetting possible is indicated by 1 and pipetting impossible is indicated by 0". The concentration of the fragment to be detected is influenced by a bacterium breaking system, the high concentration is detectable, and the low concentration is undetectable; "detectable is represented by + and non-detectable is represented by-.
Optional systems marked "bold and underlined" to meet detection requirements
Considering efficiency, cost and accuracy comprehensively, we select the lowest concentration dosage and the highest detection time, and ensure the detection accuracy, so that 30mg/mL snail protease is selected to react for 30min as the final reaction system.
Example 2 fluorescence detection
TABLE 2 reaction System test results statistics
Figure BDA0003492997990000072
TABLE 3 System 1
Reagent Dosage of Final reaction concentration
1μM crRNA 1μL 20nM
10nM Cas12a protein 1μL 0.2nM
1nM fluorescent reporter 1μL 0.1nM
10*Buffer 2μL -
ddH2O 13μL -
Mixed bacterial liquid 2μL -
TABLE 4 System 2
Figure BDA0003492997990000071
Figure BDA0003492997990000081
TABLE 5 System 3
Reagent Dosage of Final reaction concentration
1μM crRNA 2μL 100nM
10nM Cas12a protein 1μL 0.2nM
1nM fluorescent reporter 1μL 0.1nM
10*Buffer 2μL -
ddH2O 12μL -
Mixed bacterial liquid 2μL -
TABLE 6 System 4
Reagent Dosage of Final reaction concentration
1μM crRNA 2μL 200nM
10nM Cas12a protein 1μL 0.2nM
1nM fluorescent reporter 1μL 0.1nM
10*Buffer 2μL -
ddH2O 12μL -
Mixed bacterial liquid 2μL -
TABLE 7 System 5
Reagent Dosage of Final reaction concentration
1μM crRNA 2μL 200nM
10nM Cas12a protein 1μL 0.5nM
1nM fluorescenceLight reporter molecules 1μL 0.1nM
10*Buffer 2μL -
ddH2O 12μL -
Mixed bacterial liquid 2μL -
TABLE 8 System 6
Reagent Dosage of Final reaction concentration
1μM crRNA 2μL 150nM
10nM Cas12a protein 1μL 0.5nM
1nM fluorescent reporter 1μL 0.1nM
10*Buffer 2μL -
ddH2O 12μL -
Mixed bacterial liquid 2μL -
TABLE 9 System 7
Reagent Dosage of Final reaction concentration
1μM crRNA 2μL 100nM
10nM Cas12a protein 1μL 0.5nM
1nM fluorescent reporter 1μL 0.1nM
10*Buffer 2μL -
ddH2O 12μL -
Mixed bacterial liquid 2μL -
TABLE 10 CRISPR Cas12a detection technology reaction System
Reagent Dosage of Final reaction concentration
1μM crRNA 2μL 100nM
10nM Cas12a protein 1μL 0.5nM
1nM fluorescent reporter 1μL 0.1nM
10*Buffer 2μL -
ddH2O 12μL -
Mixed bacterium solution 2μL -
The final protein concentration was determined to be 0.5 nM. The higher the crRNA concentration, the better, and the best effect is achieved when the crRNA concentration in the final reaction system is 100nM after multiple tests. From system 1 to system 4, we believe that the crRNA concentration 20nM is too low to achieve specific recognition, thus increasing the crRNA concentration, and finally increasing to 200nM in system 4. However, the situation is not changed, and it is guessed that the Cas12a protein concentration is too low at 0.2nM, so that in system 5 we increased the Cas12a protein concentration to 0.5nM, a false negative phenomenon occurs, i.e. there are some positive samples that are not detected, so in system 6 and system 7 we overturns the previously increased crRNA concentration, and the gradual decrease of the crRNA concentration on the current basis results in that at the final concentration of 100nM, a hundred percent detection can be achieved. After the above debugging, (part of the debugging process is shown in fig. 2 and table 2), the final reaction system is determined (table 10).
Under the reaction system, the prepared system is added into a sample to be detected, and then the sample is placed at 37 ℃ for reaction for 20min, so that the experimental result can be observed under ultraviolet light.
Example 3crRNA design
Different screening genes designed different crrnas. PAM locus (TTTN) is selected on the target gene, 20bp base sequence after the PAM locus is selected as a recognition sequence, and crRNA is designed.
5′UAAUUUCUACUAAGUGUAGAUGAUUGCCGGACCCGGACCGC3' (shown as SEQ ID NO: 1)
Wherein: the non-underlined part is a structural sequence and the underlined part is an identification sequence.
Example 4 identification of whether the pichia pastoris was screened for a positive monoclonal vector sequence with the pPIC9K-CT05 vector:
AGATCTAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCCACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGCCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAGGATCCAAACGATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTATGCACCACCATCATCACCATACTTCTCGTGACGGCTACCAATGGACACCTGAAACTGGTTTGACTCAG GGTGTGCCATCCCTAGGAGTTATCTCTCCACCAACGAACATAGAGGACACGGATAAGGACGGCCCTTGGGACGTGA TCGTAATTGGAGGAGGATATTGCGGTTTAACTGCAACACGTGATCTCACTGTAGCCGGTTTTAAGACTTTATTGTT AGAGGCAAGAGATCGTATTGGAGGTAGATCGTGGTCCTCCAATATTGACGGTTATCCTTACGAAATGGGTGGGACC TGGGTTCATTGGCACCAATCTCATGTGTGGAGAGAGATCACACGTTACAAAATGCATAATGCTTTGTCCCCCTCCT TCAACTTTTCAAGAGGTGTCAACCACTTTCAACTGAGAACAAATCCAACAACCTCGACATATATGACTCATGAAGC AGAGGATGAATTGCTTAGATCAGCTTTGCATAAGTTCACAAATGTTGACGGTACGAACGGCAGAACTGTTTTACCG TTCCCTCACGATATGTTCTATGTCCCCGAATTTCGAAAATACGACGAGATGAGTTACTCCGAACGTATTGATCAAA TACGTGATGAATTGAGTCTGAATGAGAGAAGCAGCCTAGAAGCATTCATCCTGTTGTGTTCAGGTGGTACACTTGA AAACTCTTCGTTCGGAGAATTTCTCCATTGGTGGGCTATGTCTGGTTACACATATCAGGGTTGTATGGATTGTCTA ATGAGCTATAAGTTTAAGGATGGTCAGAGTGCTTTTGCTAGAAGATTCTGGGAAGAGGCTGCTGGAACTGGTAGAT TGGGATACGTTTTCGGTTGTCCTGTCAGGTCCGTGGTTAACGAAAGGGATGCTGCAAGAGTAACAGCAAGAGATGG TCGTGAATTTGCCGCTAAAAGGCTGGTTTGTACTATTCCATTGAATGTCTTGTCCACCATTCAATTTAGTCCAGCA CTTTCAACAGAACGTATTAGCGCCATGCAGGCTGGTCATGTGAGCATGTGCACCAAAGTTCACGCAGAAGTTGACA ACAAGGACATGAGATCATGGACTGGAATCGCCTATCCTTTCAATAAGTTGTGTTACGCTATCGGTGACGGAACTAC TCCAGCTGGTAATACACATTTGGTCTGTTTCGGTAATAGCGCCAATCATATCCAACCCGATGAGGACGTTAGAGAA ACCCTGAAAGCTGTTGGTCAACTGGCTCCTGGTACCTTTGGTGTTAAAAGATTGGTGTTCCACAATTGGGTGAAAG ATGAGTTTGCTAAAGGAGCATGGTTCTTTTCAAGACCAGGTATGGTTTCTGAGTGCCTGCAAGGATTAAGAGAGAA GCACCGAGGAGTAGTGTTCGCAAATTCCGATTGGGCCCTTGGATGGAGGTCTTTTATCGACGGTGCAATTGAAGAG GGTACGAGAGCTGCGAGGGTCGTCTTGGAGGAGCTTGGCACTAAAAGGGAGGTAAAGGCTCGTTTGTAATACGTAGAATTCCCTAGGGCGGCCGCGAATTAATTCGCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTTATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCTATCGAATCTAAATGTAAGTTAAAATCTCTAAATAATTAAATAAGTCCCAGTTTCTCCATACGAACCTTAACAGCATTGCGGTGAGCATCTAGACCTTCAACAGCAGCCAGATCCATCACTGCTTGGCCAATATGTTTCAGTCCCTCAGGAGTTACGTCTTGTGAAGTGATGAACTTCTGGAAGGTTGCAGTGTTAACTCCGCTGTATTGACGGGCATATCCGTACGTTGGCAAAGTGTGGTTGGTACCGGAGGAGTAATCTCCACAACTCTCTGGAGAGTAGGCACCAACAAACACAGATCCAGCGTGTTGTACTTGATCAACATAAGAAGAAGCATTCTCGATTTGCAGGATCAAGTGTTCAGGAGCGTACTGATTGGACATTTCCAAAGCCTGCTCGTAGGTTGCAACCGATAGGGTTGTAGAGTGTGCAATACACTTGCGTACAATTTCAACCCTTGGCAACTGCACAGCTTGGTTGTGAACAGCATCTTCAATTCTGGCAAGCTCCTTGTCTGTCATATCGACAGCCAACAGAATCACCTGGGAATCAATACCATGTTCAGCTTGAGACAGAAGGTCTGAGGCAACGAAATCTGGATCAGCGTATTTATCAGCAATAACTAGAACTTCAGAAGGCCCAGCAGGCATGTCAATACTACACAGGGCTGATGTGTCATTTTGAACCATCATCTTGGCAGCAGTAACGAACTGGTTTCCTGGACCAAATATTTTGTCACACTTAGGAACAGTTTCTGTTCCGTAAGCCATAGCAGCTACTGCCTGGGCGCCTCCTGCTAGCACGATACACTTAGCACCAACCTTGTGGGCAACGTAGATGACTTCTGGGGTAAGGGTACCATCCTTCTTAGGTGGAGATGCAAAAACAATTTCTTTGCAACCAGCAACTTTGGCAGGAACACCCAGCATCAGGGAAGTGGAAGGCAGAATTGCGGTTCCACCAGGAATATAGAGGCCAACTTTCTCAATAGGTCTTGCAAAACGAGAGCAGACTACACCAGGGCAAGTCTCAACTTGCAACGTCTCCGTTAGTTGAGCTTCATGGAATTTCCTGACGTTATCTATAGAGAGATCAATGGCTCTCTTAACGTTATCTGGCAATTGCATAAGTTCCTCTGGGAAAGGAGCTTCTAACACAGGTGTCTTCAAAGCGACTCCATCAAACTTGGCAGTTAGTTCTAAAAGGGCTTTGTCACCATTTTGACGAACATTGTCGACAATTGGTTTGACTAATTCCATAATCTGTTCCGTTTTCTGGATAGGACGACGAAGGGCATCTTCAATTTCTTGTGAGGAGGCCTTAGAAACGTCAATTTTGCACAATTCAATACGACCTTCAGAAGGGACTTCTTTAGGTTTGGATTCTTCTTTAGGTTGTTCCTTGGTGTATCCTGGCTTGGCATCTCCTTTCCTTCTAGTGACCTTTAGGGACTTCATATCCAGGTTTCTCTCCACCTCGTCCAACGTCACACCGTACTTGGCACATCTAACTAATGCAAAATAAAATAAGTCAGCACATTCCCAGGCTATATCTTCCTTGGATTTAGCTTCTGCAAGTTCATCAGCTTCCTCCCTAATTTTAGCGTTCAACAAAACTTCGTCGTCAAATAACCGTTTGGTATAAGAACCTTCTGGAGCATTGCTCTTACGATCCCACAAGGTGGCTTCCATGGCTCTAAGACCCTTTGATTGGCCAAAACAGGAAGTGCGTTCCAAGTGACAGAAACCAACACCTGTTTGTTCAACCACAAATTTCAAGCAGTCTCCATCACAATCCAATTCGATACCCAGCAACTTTTGAGTTGCTCCAGATGTAGCACCTTTATACCACAAACCGTGACGACGAGATTGGTAGACTCCAGTTTGTGTCCTTATAGCCTCCGGAATAGACTTTTTGGACGAGTACACCAGGCCCAACGAGTAATTAGAAGAGTCAGCCACCAAAGTAGTGAATAGACCATCGGGGCGGTCAGTAGTCAAAGACGCCAACAAAATTTCACTGACAGGGAACTTTTTGACATCTTCAGAAAGTTCGTATTCAGTAGTCAATTGCCGAGCATCAATAATGGGGATTATACCAGAAGCAACAGTGGAAGTCACATCTACCAACTTTGCGGTCTCAGAAAAAGCATAAACAGTTCTACTACCGCCATTAGTGAAACTTTTCAAATCGCCCAGTGGAGAAGAAAAAGGCACAGCGATACTAGCATTAGCGGGCAAGGATGCAACTTTATCAACCAGGGTCCTATAGATAACCCTAGCGCCTGGGATCATCCTTTGGACAACTCTTTCTGCCAAATCTAGGTCCAAAATCACTTCATTGATACCATTATTGTACAACTTGAGCAAGTTGTCGATCAGCTCCTCAAATTGGTCCTCTGTAACGGATGACTCAACTTGCACATTAACTTGAAGCTCAGTCGATTGAGTGAACTTGATCAGGTTGTGCAGCTGGTCAGCAGCATAGGGAAACACGGCTTTTCCTACCAAACTCAAGGAATTATCAAACTCTGCAACACTTGCGTATGCAGGTAGCAAGGGAAATGTCATACTTGAAGTCGGACAGTGAGTGTAGTCTTGAGAAATTCTGAAGCCGTATTTTTATTATCAGTGAGTCAGTCATCAGGAGATCCTCTACGCCGGACGCATCGTGGCCGACCTGCAGGGGGGGGGGGGGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGAGGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTTTCCCCCCCCCCCCTGCAGGTCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGAGTATCTATGATTGGAAGTATGGGAATGGTGATACCCGCATTCTTCAGTGTCTTGAGGTCTCCTATCAGATTATGCCCAACTAAAGCAACCGGAGGAGGAGATTTCATGGTAAATTTCTCTGACTTTTGGTCATCAGTAGACTCGAACTGTGAGACTATCTCGGTTATGACAGCAGAAATGTCCTTCTTGGAGACAGTAAATGAAGTCCCACCAATAAAGAAATCCTTGTTATCAGGAACAAACTTCTTGTTTCGAACTTTTTCGGTGCCTTGAACTATAAAATGTAGAGTGGATATGTCGGGTAGGAATGGAGCGGGCAAATGCTTACCTTCTGGACCTTCAAGAGGTATGTAGGGTTTGTAGATACTGATGCCAACTTCAGTGACAACGTTGCTATTTCGTTCAAACCATTCCGAATCCAGAGAAATCAAAGTTGTTTGTCTACTATTGATCCAAGCCAGTGCGGTCTTGAAACTGACAATAGTGTGCTCGTGTTTTGAGGTCATCTTTGTATGAATAAATCTAGTCTTTGATCTAAATAATCTTGACGAGCCAAGGCGATAAATACCCAAATCTAAAACTCTTTTAAAACGTTAAAAGGACAAGTATGTCTGCCTGTATTAAACCCCAAATCAGCTCGTAGTCTGATCCTCATCAACTTGAGGGGCACTATCTTGTTTTAGAGAAATTTGCGGAGATGCGATATCGAGAAAAAGGTACGCTGATTTTAAACGTGAAATTTATCTCAAGATCTCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTAATTCTCATGTTTGACAGCTTATCATCGATAAGCTGACTCATGTTGGTATTGTGAAATAGACGCAGATCGGGAACACTGAAAAATAACAGTTATTATTCG (shown as SEQ ID NO: 2)
Wherein the underline is CT05 gene, the bold part is PAM locus, the italic part is specific recognition sequence (20bp)
The crRNA sequence is therefore:
5’UAAUUUCUACUAAGUGUAGAUAUUAUGCAUCUUAAGGGAUC3' (shown as SEQ ID NO: 3)
Wherein: the non-underlined part is a structural sequence and the underlined part is an identification sequence.
And (3) experimental operation:
from a solid medium cultured overnight at 37 ℃, a single colony was picked up, and 1. mu.L of the bacterial solution was added to 30. mu.L of bufferI prepared in example 1 and 5. mu.L of the snail protease solution prepared in example 1 in 10. mu.L of the medium. The reaction was carried out at 37 ℃ and 600rpm for 30 min. mu.L of the reaction solution was added to the detection system prepared in example 2 (see Table 10), and the reaction was carried out at 37 ℃ for 15min, so that the experimental results were observed under UV (FIG. 4), and the results were obtained by colony PCR (FIG. 5).
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Shenzhen Reddlin Biotechnology Limited
<120> fungus screening reagent, screening method, kit and application
<130> S21P003752
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 41
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
uaauuucuac uaaguguaga ugauugccgg acccggaccg c 41
<210> 2
<211> 10782
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 60
gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 120
tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc 180
agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta 240
acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta 300
tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg 360
agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct 420
gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg 480
ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcgcca taccgtttgt 540
cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct 600
ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct 660
ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact 720
gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat 780
atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt 840
actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga 900
caacttgaga agatcaaaaa acaactaatt attcgaagga tccaaacgat gagatttcct 960
tcaattttta ctgcagtttt attcgcagca tcctccgcat tagctgctcc agtcaacact 1020
acaacagaag atgaaacggc acaaattccg gctgaagctg tcatcggtta ctcagattta 1080
gaaggggatt tcgatgttgc tgttttgcca ttttccaaca gcacaaataa cgggttattg 1140
tttataaata ctactattgc cagcattgct gctaaagaag aaggggtatc tctcgagaaa 1200
agagaggctg aagctatgca ccaccatcat caccatactt ctcgtgacgg ctaccaatgg 1260
acacctgaaa ctggtttgac tcagggtgtg ccatccctag gagttatctc tccaccaacg 1320
aacatagagg acacggataa ggacggccct tgggacgtga tcgtaattgg aggaggatat 1380
tgcggtttaa ctgcaacacg tgatctcact gtagccggtt ttaagacttt attgttagag 1440
gcaagagatc gtattggagg tagatcgtgg tcctccaata ttgacggtta tccttacgaa 1500
atgggtggga cctgggttca ttggcaccaa tctcatgtgt ggagagagat cacacgttac 1560
aaaatgcata atgctttgtc cccctccttc aacttttcaa gaggtgtcaa ccactttcaa 1620
ctgagaacaa atccaacaac ctcgacatat atgactcatg aagcagagga tgaattgctt 1680
agatcagctt tgcataagtt cacaaatgtt gacggtacga acggcagaac tgttttaccg 1740
ttccctcacg atatgttcta tgtccccgaa tttcgaaaat acgacgagat gagttactcc 1800
gaacgtattg atcaaatacg tgatgaattg agtctgaatg agagaagcag cctagaagca 1860
ttcatcctgt tgtgttcagg tggtacactt gaaaactctt cgttcggaga atttctccat 1920
tggtgggcta tgtctggtta cacatatcag ggttgtatgg attgtctaat gagctataag 1980
tttaaggatg gtcagagtgc ttttgctaga agattctggg aagaggctgc tggaactggt 2040
agattgggat acgttttcgg ttgtcctgtc aggtccgtgg ttaacgaaag ggatgctgca 2100
agagtaacag caagagatgg tcgtgaattt gccgctaaaa ggctggtttg tactattcca 2160
ttgaatgtct tgtccaccat tcaatttagt ccagcacttt caacagaacg tattagcgcc 2220
atgcaggctg gtcatgtgag catgtgcacc aaagttcacg cagaagttga caacaaggac 2280
atgagatcat ggactggaat cgcctatcct ttcaataagt tgtgttacgc tatcggtgac 2340
ggaactactc cagctggtaa tacacatttg gtctgtttcg gtaatagcgc caatcatatc 2400
caacccgatg aggacgttag agaaaccctg aaagctgttg gtcaactggc tcctggtacc 2460
tttggtgtta aaagattggt gttccacaat tgggtgaaag atgagtttgc taaaggagca 2520
tggttctttt caagaccagg tatggtttct gagtgcctgc aaggattaag agagaagcac 2580
cgaggagtag tgttcgcaaa ttccgattgg gcccttggat ggaggtcttt tatcgacggt 2640
gcaattgaag agggtacgag agctgcgagg gtcgtcttgg aggagcttgg cactaaaagg 2700
gaggtaaagg ctcgtttgta atacgtagaa ttccctaggg cggccgcgaa ttaattcgcc 2760
ttagacatga ctgttcctca gttcaagttg ggcacttacg agaagaccgg tcttgctaga 2820
ttctaatcaa gaggatgtca gaatgccatt tgcctgagag atgcaggctt catttttgat 2880
acttttttat ttgtaaccta tatagtatag gatttttttt gtcattttgt ttcttctcgt 2940
acgagcttgc tcctgatcag cctatctcgc agctgatgaa tatcttgtgg taggggtttg 3000
ggaaaatcat tcgagtttga tgtttttctt ggtatttccc actcctcttc agagtacaga 3060
agattaagtg agaagttcgt ttgtgcaagc ttatcgataa gctttaatgc ggtagtttat 3120
cacagttaaa ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg 3180
tcatcctcgg caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc 3240
cgggcctctt gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc 3300
tagcgctata tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc 3360
gctttggccg ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga 3420
tcatggcgac cacacccgtc ctgtggatct atcgaatcta aatgtaagtt aaaatctcta 3480
aataattaaa taagtcccag tttctccata cgaaccttaa cagcattgcg gtgagcatct 3540
agaccttcaa cagcagccag atccatcact gcttggccaa tatgtttcag tccctcagga 3600
gttacgtctt gtgaagtgat gaacttctgg aaggttgcag tgttaactcc gctgtattga 3660
cgggcatatc cgtacgttgg caaagtgtgg ttggtaccgg aggagtaatc tccacaactc 3720
tctggagagt aggcaccaac aaacacagat ccagcgtgtt gtacttgatc aacataagaa 3780
gaagcattct cgatttgcag gatcaagtgt tcaggagcgt actgattgga catttccaaa 3840
gcctgctcgt aggttgcaac cgatagggtt gtagagtgtg caatacactt gcgtacaatt 3900
tcaacccttg gcaactgcac agcttggttg tgaacagcat cttcaattct ggcaagctcc 3960
ttgtctgtca tatcgacagc caacagaatc acctgggaat caataccatg ttcagcttga 4020
gacagaaggt ctgaggcaac gaaatctgga tcagcgtatt tatcagcaat aactagaact 4080
tcagaaggcc cagcaggcat gtcaatacta cacagggctg atgtgtcatt ttgaaccatc 4140
atcttggcag cagtaacgaa ctggtttcct ggaccaaata ttttgtcaca cttaggaaca 4200
gtttctgttc cgtaagccat agcagctact gcctgggcgc ctcctgctag cacgatacac 4260
ttagcaccaa ccttgtgggc aacgtagatg acttctgggg taagggtacc atccttctta 4320
ggtggagatg caaaaacaat ttctttgcaa ccagcaactt tggcaggaac acccagcatc 4380
agggaagtgg aaggcagaat tgcggttcca ccaggaatat agaggccaac tttctcaata 4440
ggtcttgcaa aacgagagca gactacacca gggcaagtct caacttgcaa cgtctccgtt 4500
agttgagctt catggaattt cctgacgtta tctatagaga gatcaatggc tctcttaacg 4560
ttatctggca attgcataag ttcctctggg aaaggagctt ctaacacagg tgtcttcaaa 4620
gcgactccat caaacttggc agttagttct aaaagggctt tgtcaccatt ttgacgaaca 4680
ttgtcgacaa ttggtttgac taattccata atctgttccg ttttctggat aggacgacga 4740
agggcatctt caatttcttg tgaggaggcc ttagaaacgt caattttgca caattcaata 4800
cgaccttcag aagggacttc tttaggtttg gattcttctt taggttgttc cttggtgtat 4860
cctggcttgg catctccttt ccttctagtg acctttaggg acttcatatc caggtttctc 4920
tccacctcgt ccaacgtcac accgtacttg gcacatctaa ctaatgcaaa ataaaataag 4980
tcagcacatt cccaggctat atcttccttg gatttagctt ctgcaagttc atcagcttcc 5040
tccctaattt tagcgttcaa caaaacttcg tcgtcaaata accgtttggt ataagaacct 5100
tctggagcat tgctcttacg atcccacaag gtggcttcca tggctctaag accctttgat 5160
tggccaaaac aggaagtgcg ttccaagtga cagaaaccaa cacctgtttg ttcaaccaca 5220
aatttcaagc agtctccatc acaatccaat tcgataccca gcaacttttg agttgctcca 5280
gatgtagcac ctttatacca caaaccgtga cgacgagatt ggtagactcc agtttgtgtc 5340
cttatagcct ccggaataga ctttttggac gagtacacca ggcccaacga gtaattagaa 5400
gagtcagcca ccaaagtagt gaatagacca tcggggcggt cagtagtcaa agacgccaac 5460
aaaatttcac tgacagggaa ctttttgaca tcttcagaaa gttcgtattc agtagtcaat 5520
tgccgagcat caataatggg gattatacca gaagcaacag tggaagtcac atctaccaac 5580
tttgcggtct cagaaaaagc ataaacagtt ctactaccgc cattagtgaa acttttcaaa 5640
tcgcccagtg gagaagaaaa aggcacagcg atactagcat tagcgggcaa ggatgcaact 5700
ttatcaacca gggtcctata gataacccta gcgcctggga tcatcctttg gacaactctt 5760
tctgccaaat ctaggtccaa aatcacttca ttgataccat tattgtacaa cttgagcaag 5820
ttgtcgatca gctcctcaaa ttggtcctct gtaacggatg actcaacttg cacattaact 5880
tgaagctcag tcgattgagt gaacttgatc aggttgtgca gctggtcagc agcataggga 5940
aacacggctt ttcctaccaa actcaaggaa ttatcaaact ctgcaacact tgcgtatgca 6000
ggtagcaagg gaaatgtcat acttgaagtc ggacagtgag tgtagtcttg agaaattctg 6060
aagccgtatt tttattatca gtgagtcagt catcaggaga tcctctacgc cggacgcatc 6120
gtggccgacc tgcagggggg gggggggcgc tgaggtctgc ctcgtgaaga aggtgttgct 6180
gactcatacc aggcctgaat cgccccatca tccagccaga aagtgaggga gccacggttg 6240
atgagagctt tgttgtaggt ggaccagttg gtgattttga acttttgctt tgccacggaa 6300
cggtctgcgt tgtcgggaag atgcgtgatc tgatccttca actcagcaaa agttcgattt 6360
attcaacaaa gccgccgtcc cgtcaagtca gcgtaatgct ctgccagtgt tacaaccaat 6420
taaccaattc tgattagaaa aactcatcga gcatcaaatg aaactgcaat ttattcatat 6480
caggattatc aataccatat ttttgaaaaa gccgtttctg taatgaagga gaaaactcac 6540
cgaggcagtt ccataggatg gcaagatcct ggtatcggtc tgcgattccg actcgtccaa 6600
catcaataca acctattaat ttcccctcgt caaaaataag gttatcaagt gagaaatcac 6660
catgagtgac gactgaatcc ggtgagaatg gcaaaagctt atgcatttct ttccagactt 6720
gttcaacagg ccagccatta cgctcgtcat caaaatcact cgcatcaacc aaaccgttat 6780
tcattcgtga ttgcgcctga gcgagacgaa atacgcgatc gctgttaaaa ggacaattac 6840
aaacaggaat cgaatgcaac cggcgcagga acactgccag cgcatcaaca atattttcac 6900
ctgaatcagg atattcttct aatacctgga atgctgtttt cccggggatc gcagtggtga 6960
gtaaccatgc atcatcagga gtacggataa aatgcttgat ggtcggaaga ggcataaatt 7020
ccgtcagcca gtttagtctg accatctcat ctgtaacatc attggcaacg ctacctttgc 7080
catgtttcag aaacaactct ggcgcatcgg gcttcccata caatcgatag attgtcgcac 7140
ctgattgccc gacattatcg cgagcccatt tatacccata taaatcagca tccatgttgg 7200
aatttaatcg cggcctcgag caagacgttt cccgttgaat atggctcata acaccccttg 7260
tattactgtt tatgtaagca gacagtttta ttgttcatga tgatatattt ttatcttgtg 7320
caatgtaaca tcagagattt tgagacacaa cgtggctttc cccccccccc ctgcaggtcg 7380
gcatcaccgg cgccacaggt gcggttgctg gcgcctatat cgccgacatc accgatgggg 7440
aagatcgggc tcgccacttc gggctcatga gcgcttgttt cggcgtgggt atggtggcag 7500
gccccgtggc cgggggactg ttgggcgcca tctccttgca tgcaccattc cttgcggcgg 7560
cggtgctcaa cggcctcaac ctactactgg gctgcttcct aatgcaggag tcgcataagg 7620
gagagcgtcg agtatctatg attggaagta tgggaatggt gatacccgca ttcttcagtg 7680
tcttgaggtc tcctatcaga ttatgcccaa ctaaagcaac cggaggagga gatttcatgg 7740
taaatttctc tgacttttgg tcatcagtag actcgaactg tgagactatc tcggttatga 7800
cagcagaaat gtccttcttg gagacagtaa atgaagtccc accaataaag aaatccttgt 7860
tatcaggaac aaacttcttg tttcgaactt tttcggtgcc ttgaactata aaatgtagag 7920
tggatatgtc gggtaggaat ggagcgggca aatgcttacc ttctggacct tcaagaggta 7980
tgtagggttt gtagatactg atgccaactt cagtgacaac gttgctattt cgttcaaacc 8040
attccgaatc cagagaaatc aaagttgttt gtctactatt gatccaagcc agtgcggtct 8100
tgaaactgac aatagtgtgc tcgtgttttg aggtcatctt tgtatgaata aatctagtct 8160
ttgatctaaa taatcttgac gagccaaggc gataaatacc caaatctaaa actcttttaa 8220
aacgttaaaa ggacaagtat gtctgcctgt attaaacccc aaatcagctc gtagtctgat 8280
cctcatcaac ttgaggggca ctatcttgtt ttagagaaat ttgcggagat gcgatatcga 8340
gaaaaaggta cgctgatttt aaacgtgaaa tttatctcaa gatctctgcc tcgcgcgttt 8400
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct 8460
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg 8520
tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg gcttaactat 8580
gcggcatcag agcagattgt actgagagtg caccatatgc ggtgtgaaat accgcacaga 8640
tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac tgactcgctg 8700
cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta 8760
tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc 8820
aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag 8880
catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac 8940
caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc 9000
ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcaatg ctcacgctgt 9060
aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc 9120
gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga 9180
cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta 9240
ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta 9300
tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga 9360
tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg 9420
cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag 9480
tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc 9540
tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact 9600
tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt 9660
cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta 9720
ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta 9780
tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc 9840
gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat 9900
agtttgcgca acgttgttgc cattgctgca ggcatcgtgg tgtcacgctc gtcgtttggt 9960
atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg 10020
tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca 10080
gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta 10140
agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg 10200
cgaccgagtt gctcttgccc ggcgtcaaca cgggataata ccgcgccaca tagcagaact 10260
ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg 10320
ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt 10380
actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga 10440
ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc 10500
atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa 10560
caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt 10620
attatcatga cattaaccta taaaaatagg cgtatcacga ggccctttcg tcttcaagaa 10680
ttaattctca tgtttgacag cttatcatcg ataagctgac tcatgttggt attgtgaaat 10740
agacgcagat cgggaacact gaaaaataac agttattatt cg 10782
<210> 3
<211> 41
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
uaauuucuac uaaguguaga uauuaugcau cuuaagggau c 41

Claims (10)

1. The bacteriolysis reagent is characterized by comprising the following components:
sorbitol 0.8-1.1 mol/L
EDTA 10～20mol/L
5-60 mg/mL snail protease.
2. The detection reagent is characterized by comprising the following components:
1μM crRNA 20～200nM
10nM Cas12a protein 0.2-0.5 nM
0.1-0.5 nM of 1nM fluorescent reporter
10 Buffer and ddH2The volume ratio of O is 1: 6.
3. The method for designing the crRNA as the detection reagent according to claim 2, comprising selecting a base sequence of 20bp after the TTTN site PAM as a recognition sequence on the target gene.
4. A screening reagent comprising the lytic reagent according to claim 1 and/or the detection reagent according to claim 2.
5. A method for screening fungal colonies, comprising the steps of:
s1: mixing the bacteriolytic reagent according to claim 1 and/or the bacteriolytic reagent in the screening reagent according to claim 4 with a sample to obtain a mixed bacterial liquid;
s2: mixing the mixed bacterial liquid with the detection reagent according to claim 2 and/or the detection reagent in the screening reagent according to claim 4, and detecting.
6. The screening method according to claim 5, wherein the mixing in S1 is performed for 10 to 50min at a temperature of 35 to 38 ℃.
7. The screening method of claim 5 or 6, wherein the volume ratio of the lytic reagent to the sample in S1 is 35: 1.
8. The screening method according to any one of claims 5 to 7, wherein the mixing in S2 is carried out for 15min at a temperature of 35 to 38 ℃.
9. A kit comprising the lytic reagent of claim 1, the detection reagent of claim 2, and/or the screening reagent of claim 4, and an acceptable adjuvant.
10. Use of a lytic reagent according to claim 1, a detection reagent according to claim 2, a screening reagent according to claim 4 and/or a kit according to claim 8 for detecting and/or screening fungal colonies.
CN202210103372.1A 2022-01-27 2022-01-27 Fungus screening reagent, screening method, kit and application Active CN114438163B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210103372.1A CN114438163B (en) 2022-01-27 2022-01-27 Fungus screening reagent, screening method, kit and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210103372.1A CN114438163B (en) 2022-01-27 2022-01-27 Fungus screening reagent, screening method, kit and application

Publications (2)

Publication Number Publication Date
CN114438163A true CN114438163A (en) 2022-05-06
CN114438163B CN114438163B (en) 2024-05-14

Family

ID=81370621

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210103372.1A Active CN114438163B (en) 2022-01-27 2022-01-27 Fungus screening reagent, screening method, kit and application

Country Status (1)

Country Link
CN (1) CN114438163B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1641025A (en) * 2004-11-29 2005-07-20 中国水产科学研究院黄海水产研究所 Pagrosomus major antibacterial peptide gene, and recombinant yeast expression vector and its preparing method
CN102230010A (en) * 2011-06-14 2011-11-02 北京大北农科技集团股份有限公司 Bacterial colony polymerase chain reaction (PCR) method and kit
US20190153475A1 (en) * 2015-12-17 2019-05-23 Evonik Degussa (China) Co., Ltd. Gene cassette for homologous recombination knock-out in yeast cells
CN111394347A (en) * 2020-03-26 2020-07-10 中国人民解放军联勤保障部队第九八〇医院 Preparation method of candida-free nucleic acid sample suitable for PCR (polymerase chain reaction) experiment

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1641025A (en) * 2004-11-29 2005-07-20 中国水产科学研究院黄海水产研究所 Pagrosomus major antibacterial peptide gene, and recombinant yeast expression vector and its preparing method
CN102230010A (en) * 2011-06-14 2011-11-02 北京大北农科技集团股份有限公司 Bacterial colony polymerase chain reaction (PCR) method and kit
US20190153475A1 (en) * 2015-12-17 2019-05-23 Evonik Degussa (China) Co., Ltd. Gene cassette for homologous recombination knock-out in yeast cells
CN111394347A (en) * 2020-03-26 2020-07-10 中国人民解放军联勤保障部队第九八〇医院 Preparation method of candida-free nucleic acid sample suitable for PCR (polymerase chain reaction) experiment

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HAN SUN等: "Powerful tools for productivity improvements in microalgal production", RENEWABLE AND SUSTAINABLE ENERGY REVIEWS, vol. 152, pages 111609 *
JUHONG CHEN等: "Rapid genotypic antibiotic susceptibility test using CRISPR-Cas12a for urinary tract infection", ANALYST, vol. 145, no. 15, pages 5227 *
NING ZHANG等: "Cell permeability and nuclear DNA staining by propidium iodide in basidiomycetous yeasts", APPL MICROBIOL BIOTECHNOL, vol. 102, no. 9, pages 4183 - 4191, XP036477583, DOI: 10.1007/s00253-018-8906-8 *
王艳梅等: "利用CRISPR-Cas9技术失活黑曲霉中果胶酶基因及突变株性能评价", 中国生物工程杂志, vol. 41, no. 5, pages 35 - 44 *

Also Published As

Publication number Publication date
CN114438163B (en) 2024-05-14

Similar Documents

Publication Publication Date Title
CN110042067B (en) Method for improving xylose utilization capacity of recombinant saccharomyces cerevisiae strain and mutant strain thereof
CN114736893A (en) Method for realizing A/T to G/C editing on mitochondrial DNA
CN103224955A (en) Vector for efficiently labeling zebra fish PGC, and preparation method and use of transgenic fish
CN108676848B (en) Mixed gene, standard plasmid and kit for detecting fusion gene and preparation method thereof
CN114438163B (en) Fungus screening reagent, screening method, kit and application
CN114957448B (en) Yeast strain for efficiently expressing alpha-lactalbumin, alpha-lactalbumin and application thereof
CN113493855B (en) Kit for detecting HBV cccDNA based on RAA-CRISPR-cas13a
CN110093277A (en) Toxoplasma Gallus gallusShouguang strain knocks out the construction method and purposes of worm strain
CN109468338A (en) A kind of method of purpose pU6-sgRNA plasmid needed for rapid build caenorhabditis elegan gene editing
CN108085371B (en) Method for judging whether PCR result is false positive
CN114959110A (en) Kit for detecting hepatitis B virus pregenomic RNA based on PCR-CRISPR-Cas13a
CN102703474A (en) New bunyavirus NP protein coding sequence and application thereof
CN112553098B (en) Biological preparation method of caffeic acid
CN114874927B (en) Yeast genetic engineering bacterium for high-yield recombinant protein, construction method and application thereof
CN101659967B (en) PiggyBac transposon vector for producing transgenic pig and construction method thereof
CN114959107A (en) Kit for detecting hepatitis B virus DNA based on RAA-CRISPR-Cas13a technology
CN108949793B (en) Recombinant bacterium for representing genetic toxicity and construction method and application thereof
CN108715888A (en) A kind of homogeneous detecting systems of PCR based on FRET and its application
JPH10248585A (en) In vitro transcription for screening natural substance and other chemical substances
CN114149975B (en) Cell model with specific HBV sequence inserted into specific gene region, construction method and application thereof
Walter et al. Method for multiplexed integration of synergistic alleles and metabolic pathways in yeasts via CRISPR-Cas9
CN101481703A (en) Avian origin promoter expression vector, construction method and use thereof
CN110117612A (en) A kind of Expressed in Xenopus Oocytes carrier pGH19-EGFP and application with green fluorescent protein tag
CN106399223B (en) A kind of separation of tripterygium wilfordii protoplast and transient transformation methods
CN113832091A (en) Bacillus thuringiensis engineering bacterium for expressing bivalent insecticidal protein, and construction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
CB02 Change of applicant information
CB02 Change of applicant information

Address after: 518000 floor 3, building 2, Shenzhen biological incubation base, No. 10, Gaoxin Zhongyi Road, Maling community, Yuehai street, Nanshan District, Shenzhen, Guangdong

Applicant after: SHENZHEN READLINE BIOTECHNOLOGY Co.,Ltd.

Address before: 518000 Room 101, 1st floor, building 2, Shenzhen biological incubation base, No.10, Gaoxin middle 1st Road, Maling community, Yuehai street, Nanshan District, Shenzhen City, Guangdong Province

Applicant before: SHENZHEN READLINE BIOTECHNOLOGY Co.,Ltd.

SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant