CN114438055A - Novel CRISPR enzymes and systems and uses - Google Patents

Novel CRISPR enzymes and systems and uses Download PDF

Info

Publication number
CN114438055A
CN114438055A CN202210168270.8A CN202210168270A CN114438055A CN 114438055 A CN114438055 A CN 114438055A CN 202210168270 A CN202210168270 A CN 202210168270A CN 114438055 A CN114438055 A CN 114438055A
Authority
CN
China
Prior art keywords
sequence
cas
protein
nucleic acid
grna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210168270.8A
Other languages
Chinese (zh)
Other versions
CN114438055B (en
Inventor
李珊珊
孙洁
赵庆芝
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Shunfeng Biotechnology Co Ltd
Original Assignee
Shandong Shunfeng Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Shunfeng Biotechnology Co Ltd filed Critical Shandong Shunfeng Biotechnology Co Ltd
Publication of CN114438055A publication Critical patent/CN114438055A/en
Application granted granted Critical
Publication of CN114438055B publication Critical patent/CN114438055B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention belongs to the field of nucleic acid editing, and particularly relates to the technical field of regularly clustered spaced short palindromic repeats (CRISPR). Specifically, the invention provides a novel Cas enzyme, which is Cas-sf0005, has low homology with the reported Cas enzyme, can show nuclease activity in cells and outside the cells, and has wide application prospect.

Description

Novel CRISPR enzymes and systems and uses
Technical Field
The invention relates to the field of gene editing, in particular to the technical field of regularly clustered spaced short palindromic repeats (CRISPR). In particular, the present invention relates to a novel CRISPR enzyme (alternatively referred to as CRISPR protein, Cas effector protein, Cas enzyme or Cas protein), fusion proteins comprising such proteins, and nucleic acid molecules encoding them. The invention also relates to complexes and compositions for nucleic acid editing (e.g., gene or genome editing) comprising a Cas protein or fusion protein of the invention, or a nucleic acid molecule encoding the same.
Background
The CRISPR/Cas technology is a widely used gene editing technology, which specifically binds to a target sequence on a genome and cleaves DNA to generate a double-strand break through RNA guide, and performs site-directed gene editing using biological non-homologous end joining or homologous recombination.
The CRISPR/Cas9 system is the most commonly used type II CRISPR system, which recognizes the PAM motif of 3' -NGG, performing blunt-end cleavage of the target sequence. The CRISPR/Cas Type V system is a newly discovered Type of CRISPR system that has a motif of 5' -TTN, with sticky end cleavage of the target sequence, e.g. Cpf1, C2C1, CasX, CasY. However, the different CRISPRs/Cas currently available have different advantages and disadvantages. For example, Cas9, C2C1 and CasX all require two RNAs for guide RNA, whereas Cpf1 requires only one guide RNA and can be used for multiple gene editing. CasX has a size of 980 amino acids, while the common Cas9, C2C1, CasY and Cpf1 are typically around 1300 amino acids in size. In addition, the PAM sequences of Cas9, Cpf1, CasX, and CasY are complex and diverse, while C2C1 recognizes the stringent 5' -TTN, so its target site is easily predicted than other systems to reduce potential off-target effects.
In summary, given that currently available CRISPR/Cas systems are all limited by some drawbacks, the development of a new more robust CRISPR/Cas system with versatile good performance is of great significance for the development of biotechnology.
Disclosure of Invention
The inventors of the present application have unexpectedly discovered a novel endonuclease (Cas enzyme) through a large number of experiments and repeated trials. Based on this finding, the present inventors developed a new CRISPR/Cas system and a gene editing method based on the system.
Cas effector protein
In one aspect, the invention provides a Cas protein that is an effector protein in a CRISPR/Cas system, which in the present invention is designated Cas-sf0005 (amino acid sequence shown in SEQ ID No. 1).
In one embodiment, the Cas protein amino acid sequence has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID No.1 and substantially retains the biological function of the sequence from which it is derived.
In one embodiment, the Cas protein amino acid sequence has a sequence with one or more amino acid substitutions, deletions, or additions compared to SEQ ID No. 1; and substantially retains the biological function of the sequence from which it is derived; the substitution, deletion, or addition of one or more amino acids includes substitution, deletion, or addition of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.
It will be clear to those skilled in the art that the structure of a protein may be altered without adversely affecting its activity and functionality, for example, one or more conservative amino acid substitutions may be introduced into the amino acid sequence of a protein without adversely affecting the activity and/or three-dimensional structure of the protein molecule. Examples and embodiments of conservative amino acid substitutions will be apparent to those skilled in the art. Specifically, the amino acid residue may be substituted with another amino acid residue belonging to the same group as the site to be substituted, i.e., a nonpolar amino acid residue is substituted for another nonpolar amino acid residue, a polar uncharged amino acid residue is substituted for another polar uncharged amino acid residue, a basic amino acid residue is substituted for another basic amino acid residue, and an acidic amino acid residue is substituted for another acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions where one amino acid is replaced by another amino acid belonging to the same group are within the scope of the present invention, as long as the substitution does not result in inactivation of the biological activity of the protein. Thus, the proteins of the invention may comprise one or more conservative substitutions in the amino acid sequence, which are preferably made by substitution according to Table 1. In addition, proteins that also comprise one or more other non-conservative substitutions are also encompassed by the present invention, provided that the non-conservative substitutions do not significantly affect the desired function and biological activity of the proteins of the present invention.
Conservative amino acid substitutions may be made at one or more predicted nonessential amino acid residues. A "nonessential" amino acid residue is an amino acid residue that can be altered (deleted, substituted, or substituted) without altering the biological activity, while an "essential" amino acid residue is required for biological activity. A "conservative amino acid substitution" is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Amino acid substitutions can be made in the non-conserved regions of the Cas protein described above. In general, such substitutions are not made to conserved amino acid residues, or to amino acid residues located within conserved motifs, where such residues are required for protein activity. However, one skilled in the art will appreciate that functional variants may have fewer conservative or non-conservative changes in conserved regions.
TABLE 1
Figure BDA0003516424430000021
Figure BDA0003516424430000031
It is well known in the art that one or more amino acid residues may be altered (substituted, deleted, truncated, or inserted) from the N-and/or C-terminus of a protein while still retaining its functional activity. Thus, proteins that have one or more amino acid residues altered from the N-and/or C-terminus of the Cas protein while retaining their desired functional activity are also within the scope of the present invention. These changes may include changes introduced by modern molecular methods such as PCR, including PCR amplification by altering or extending the protein coding sequence by inclusion of amino acid coding sequences among the oligonucleotides used in PCR amplification.
It will be appreciated that proteins may be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions, and methods for such manipulations are generally known in the art. For example, amino acid sequence variants of the above proteins can be prepared by mutation of the DNA. It may also be accomplished by other forms of mutagenesis and/or by directed evolution, e.g., using known methods of mutagenesis, recombination and/or shuffling (shuffling), in conjunction with related screening methods, to make single or multiple amino acid substitutions, deletions and/or insertions.
One skilled in the art will appreciate that these minor amino acid changes in the Cas protein of the invention can occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site, or other functional domain of the protein, the properties of the polypeptide may change, but the polypeptide may retain its activity. Minor effects can be expected if the mutations present are not close to the catalytic domain, active site or other functional domains.
One skilled in the art can identify the essential amino acids of the Cas protein of the present invention according to methods known in the art, such as site-directed mutagenesis or analysis of protein evolution or biological information systems. The catalytic domain, active site or other functional domain of a protein can also be determined by physical analysis of the structure, such as by the following techniques: such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in combination with mutations in putative key site amino acids.
In one embodiment, the Cas protein comprises the amino acid sequence shown as SEQ ID No. 1.
In one embodiment, the Cas protein is an amino acid sequence shown in SEQ ID No. 1.
In one embodiment, the Cas protein is a derivatized protein having the same biological function as the protein having the sequence shown in SEQ ID No. 1.
Such biological functions include, but are not limited to, activity for binding to a guide RNA, endonuclease activity, activity for binding to a specific site on a target sequence under the guidance of a guide RNA and cleavage, including, but not limited to Cis cleavage activity.
The invention also provides a fusion protein comprising a Cas protein as described above and other modifying moieties.
In one embodiment, the modifying moiety is selected from an additional protein or polypeptide, a detectable label, or any combination thereof.
In one embodiment, the modifying moiety is selected from the group consisting of an epitope tag, a reporter sequence, a Nuclear Localization Signal (NLS) sequence, a targeting moiety, a transcription activation domain (e.g., VP64), a transcription repression domain (e.g., KRAB domain or SID domain), a nuclease domain (e.g., Fok1), and a domain having an activity selected from the group consisting of: nucleotide deaminase, methylase activity, demethylase, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, single-stranded DNA cleavage activity, double-stranded DNA cleavage activity and nucleic acid binding activity; and any combination thereof. Such NLS sequences are well known to those skilled in the art, examples of which include, but are not limited to, the SV40 large T antigen, EGL-13, c-Myc, and TUS proteins.
In one embodiment, the NLS sequence is located at, near, or near a terminus (e.g., N-terminus, C-terminus, or both) of a Cas protein of the invention.
Such epitope tags (epitoptags) are well known to those skilled in the art and include, but are not limited to, His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and other suitable epitope tags (e.g., purification, detection, or tracking) may be selected by those skilled in the art.
The reporter gene sequences are well known to those skilled in the art, examples of which include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, and the like.
In one embodiment, the fusion protein of the invention comprises a domain capable of binding to a DNA molecule or an intracellular molecule, such as Maltose Binding Protein (MBP), the DNA binding domain of Lex a (DBD), the DBD of GAL4, and the like.
In one embodiment, the fusion protein of the invention comprises a detectable label, such as a fluorescent dye, e.g. FITC or DAPI.
In one embodiment, the Cas protein of the present invention is coupled, conjugated or fused to the modifying moiety, optionally via a linker.
In one embodiment, the modification moiety is directly linked to the N-terminus or C-terminus of the Cas protein of the present invention.
In one embodiment, the modification moiety is linked to the N-terminus or C-terminus of the Cas protein of the present invention via a linker. Such linkers are well known in the art, examples of which include, but are not limited to, linkers comprising one or more (e.g., 1, 2, 3, 4, or 5) amino acids (e.g., Glu or Ser) or amino acid derivatives (e.g., Ahx, β -Ala, GABA, or Ava), or PEG, and the like.
The Cas protein, protein derivative or fusion protein of the present invention is not limited by the manner of its production, and for example, it may be produced by a genetic engineering method (recombinant technology) or may be produced by a chemical synthesis method.
Nucleic acid of Cas protein
In another aspect, the invention provides an isolated polynucleotide comprising:
(a) a polynucleotide sequence encoding a Cas protein or a fusion protein of the invention;
(b) a polynucleotide having a sequence as shown in SEQ ID No.2 or 3;
(c) a sequence having substitution, deletion or addition of one or more bases (e.g., substitution, deletion or addition of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases) as compared with the sequence represented by SEQ ID No.2 or 3;
(d) a polynucleotide having a nucleotide sequence homology of 80% or more (preferably 90% or more, more preferably 95% or more, most preferably 98% or more) to the sequence shown in SEQ ID No.2 or 3, and encoding the polypeptide shown in SEQ ID No. 1; alternatively, the first and second electrodes may be,
(e) a polynucleotide complementary to any one of the polynucleotides of (a) - (d).
In one embodiment, the nucleotide sequence described in any of (a) - (e) is codon optimized for expression in a prokaryotic cell. In one embodiment, the nucleotide sequence described in any of (a) - (e) is codon optimized for expression in a eukaryotic cell.
In one embodiment, the polynucleotide is preferably single-stranded or double-stranded.
Direct Repeat (Direct Repeat) sequences
In another aspect, the invention provides an engineered direct repeat sequence that forms a complex with a Cas protein as described above.
The direct repeat sequence is connected with a guide sequence capable of hybridizing with a target sequence to form a guide RNA (guide RNA or gRNA).
Hybridization of the target sequence to the gRNA represents at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity of the target sequence and the guide sequence of the gRNA, such that a complex can be hybridized; or at least 12, 15, 16, 17, 18, 19, 20, 21, 22, or more bases representing the target sequence and the guide sequence of the gRNA can be complementarily paired to form a complex.
In some embodiments, the direct repeat sequence has at least 90% sequence identity to a sequence set forth in SEQ ID No.4 or 5. In some embodiments, the direct repeat sequence has a substitution, deletion, or addition of one or more bases (e.g., a substitution, deletion, or addition of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases) as compared to the sequence set forth in SEQ ID No.4 or 5.
In some embodiments, the direct repeat sequence is as set forth in SEQ ID Nos. 4 or 5.
Guide RNA (gRNA)
In another aspect, the invention provides a gRNA comprising a first segment and a second segment; the first segment is also referred to as "framework region", "protein binding segment", "protein binding sequence", or "Direct Repeat (Direct Repeat) sequence"; the second segment is also referred to as a "targeting sequence for targeting nucleic acid" or a "targeting segment for targeting nucleic acid", or a "targeting sequence for targeting a target sequence".
The first segment of the gRNA is capable of interacting with a Cas protein of the invention, thereby allowing the Cas protein and the gRNA to form a complex.
In a preferred embodiment, the first segment is a direct repeat sequence as described above.
The targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid of the invention comprises a nucleotide sequence that is complementary to a sequence in the target nucleic acid. In other words, the targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid of the present invention interacts in a sequence-specific manner with the target nucleic acid upon hybridization (i.e., base pairing). Thus, the targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid may be altered or may be modified to hybridize to any desired sequence within the target nucleic acid. The nucleic acid is selected from DNA or RNA.
The percent complementarity between the targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid and the target sequence of the target nucleic acid can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%).
The "framework region", "protein-binding segment", "protein-binding sequence", or "direct repeat" of a gRNA of the invention can interact with a CRISPR protein (or, alternatively, a Cas protein). The gRNA of the invention directs its interacting Cas protein to a specific nucleotide sequence within a target nucleic acid through the action of a targeting sequence of the targeting nucleic acid.
Preferably, the guide RNA comprises a first segment and a second segment in the 5 'to 3' direction.
In the context of the present invention, the second segment is also understood to be a leader sequence which hybridizes to the target sequence.
The grnas of the invention are capable of forming a complex with the Cas protein.
The gRNA of the Cas-sf0005 protein of the present invention comprises a guide sequence that hybridizes to a target nucleic acid, wherein the target nucleic acid comprises a sequence located 3' of a Protospacer Adjacent Motif (PAM); the PAM sequence is 5 'TBN-3', where B ═ T/C/G and N ═ a/T/C/G.
Carrier
The present invention also provides a vector comprising a Cas protein, an isolated nucleic acid molecule or a polynucleotide as described above; preferably, it further comprises a regulatory element operably linked thereto.
In one embodiment, the regulatory element is selected from one or more of the group consisting of: enhancers, transposons, promoters, terminators, leader sequences, polyadenylation sequences, marker genes.
In one embodiment, the vector comprises a cloning vector, an expression vector, a shuttle vector, an integration vector.
In some embodiments, the vectors included in the system are viral vectors (e.g., retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated vectors and herpes simplex vectors), and may also be of the type of plasmid, virus, cosmid, phage, and the like, which are well known to those skilled in the art.
CRISPR system
The present invention provides an engineered non-naturally occurring vector system, or CRISPR-Cas system, comprising a Cas protein or a nucleic acid sequence encoding said Cas protein and nucleic acid encoding one or more guide RNAs.
In one embodiment, the nucleic acid sequence encoding the Cas protein and the nucleic acid encoding the one or more guide RNAs are artificially synthesized.
In one embodiment, the nucleic acid sequence encoding the Cas protein and the nucleic acid encoding the one or more guide RNAs do not occur naturally together.
The one or more guide RNAs target one or more target sequences in the cell. The one or more target sequences hybridize to the genomic locus of the DNA molecule encoding the one or more gene products and direct the Cas protein to the genomic locus site of the DNA molecule of the one or more gene products, and the Cas protein modifies, edits, or cleaves the target sequence upon reaching the target sequence position, whereby expression of the one or more gene products is altered or modified.
The cells of the invention include one or more of animals, plants, or microorganisms.
In some embodiments, the Cas protein is codon optimized for expression in a cell.
In some embodiments, the Cas protein directs cleavage of one or both strands at the target sequence position.
The present invention also provides an engineered non-naturally occurring vector system, which may include one or more vectors, the one or more vectors including:
a) a first regulatory element operably linked to the gRNA,
b) a second regulatory element operably linked to the Cas protein;
wherein components (a) and (b) are located on the same or different carriers of the system.
The first and second regulatory elements include promoters (e.g., constitutive promoters or inducible promoters), enhancers (e.g., 35S promoter or 35S enhanced promoter), Internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences).
In some embodiments, the vector in the system is a viral vector (e.g., retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated vectors and herpes simplex vectors), and may also be of the type of plasmid, virus, cosmid, phage, and the like, which are well known to those skilled in the art.
In some embodiments, the systems provided herein are in a delivery system. In some embodiments, the delivery system is a nanoparticle, a liposome, an exosome, a microbubble, and a gene gun.
In one embodiment, the target sequence is a DNA or RNA sequence from a prokaryotic or eukaryotic cell. In one embodiment, the target sequence is a non-naturally occurring DNA or RNA sequence.
In one embodiment, the target sequence is present within a cell. In one embodiment, the target sequence is present within the nucleus or within the cytoplasm (e.g., organelle). In one embodiment, the cell is a eukaryotic cell. In other embodiments, the cell is a prokaryotic cell.
In one embodiment, the Cas protein has one or more NLS sequences attached thereto. In one embodiment, the fusion protein comprises one or more NLS sequences. In one embodiment, the NLS sequence is linked to the N-terminus or C-terminus of the protein. In one embodiment, the NLS sequence is fused to the N-terminus or C-terminus of the protein.
In another aspect, the invention relates to an engineered CRISPR system comprising a Cas protein as described above and one or more guide RNAs, wherein the guide RNA comprises a direct repeat and a spacer sequence capable of hybridizing to a target nucleic acid, the Cas protein being capable of binding to the guide RNA and targeting a target nucleic acid sequence complementary to the spacer sequence.
In one embodiment, when the target nucleic acid is DNA (preferably, double-stranded DNA), the target nucleic acid is located at the 3 ' end of a protospacer adjacent to a motif (PAM) and the PAM has a sequence represented by 5' TBN-3 ', wherein B ═ T/C/G and N ═ a/T/C/G.
Protein-nucleic acid complexes/compositions
In another aspect, the present invention provides a complex or composition comprising:
(i) a protein component selected from: the above Cas protein, derivatized protein, or fusion protein, and any combination thereof; and
(ii) a nucleic acid component comprising (a) a guide sequence capable of hybridizing to a target sequence; and (b) a direct repeat sequence capable of binding to a Cas protein of the present invention.
The protein component and the nucleic acid component are combined with each other to form a complex.
In one embodiment, the nucleic acid component is a guide RNA in a CRISPR-Cas system.
In one embodiment, the complex or composition is non-naturally occurring or modified. In one embodiment, at least one component of the complex or composition is non-naturally occurring or modified. In one embodiment, the first component is non-naturally occurring or modified; and/or, the second component is non-naturally occurring or modified.
Activated CRISPR complexes
In another aspect, the present invention also provides an activated CRISPR complex comprising: (1) a protein component selected from: a Cas protein, a derivatized protein, or a fusion protein of the invention, and any combination thereof; (2) a gRNA comprising (a) a guide sequence capable of hybridizing to a target sequence; and (b) a direct repeat sequence capable of binding to a Cas protein of the present invention; and (3) a target sequence that binds to the gRNA. Preferably, the binding is via a targeting sequence of a targeting nucleic acid on the gRNA to the target nucleic acid.
The terms "activated CRISPR complex", "activation complex" or "ternary complex" as used herein refer to a complex of a Cas protein, a gRNA, and a target nucleic acid in a CRISPR system after binding or modification.
The Cas protein and gRNA of the invention can form a binary complex that is activated upon binding to a nucleic acid substrate that is complementary to a spacer sequence (or, alternatively referred to as, a guide sequence that hybridizes to a target nucleic acid) in the gRNA to form an activated CRISPR complex. In some embodiments, the spacer sequence of the gRNA completely matches the target substrate. In other embodiments, the spacer sequence of the gRNA matches a portion (continuous or discontinuous) of the target substrate.
Delivery and delivery compositions
The Cas proteins, grnas, fusion proteins, nucleic acid molecules, vectors, systems, complexes, and compositions of the invention can be delivered by any method known in the art. Such methods include, but are not limited to, electroporation, lipofection, nuclear transfection, microinjection, sonoporation, gene gun, calcium phosphate-mediated transfection, cationic transfection, lipofection, dendritic transfection, heat shock transfection, nuclear transfection, magnetic transfection, lipofection, puncture transfection, optical transfection, agent-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, viral particles, artificial virosomes, and the like.
Thus, in another aspect, the present invention provides a delivery composition comprising a delivery vehicle and one or any of the following: the Cas proteins, fusion proteins, nucleic acid molecules, vectors, systems, complexes and compositions of the present invention.
In one embodiment, the delivery vehicle is a particle.
In one embodiment, the delivery vector is selected from a lipid particle, a sugar particle, a metal particle, a protein particle, a liposome, an exosome, a microvesicle, a gene gun, or a viral vector (e.g., a replication defective retrovirus, lentivirus, adenovirus, or adeno-associated virus).
Host cell
The invention also relates to an in vitro, ex vivo or in vivo cell or cell line or progeny thereof comprising: cas proteins, fusion proteins, nucleic acid molecules, protein-nucleic acid complexes, activated CRISPR complexes, vectors, and delivery compositions of the invention described herein.
In certain embodiments, the cell is a prokaryotic cell.
In certain embodiments, the cell is a eukaryotic cell. In certain embodiments, the cell is a mammalian cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a non-human mammalian cell, e.g., a cell of a non-human primate, bovine, ovine, porcine, canine, monkey, rabbit, rodent (e.g., rat or mouse). In certain embodiments, the cell is a non-mammalian eukaryotic cell, such as a cell of a poultry bird (e.g., chicken), fish, or crustacean (e.g., clam, shrimp). In certain embodiments, the cell is a plant cell, e.g., a cell possessed by a monocot or dicot or a cultivated plant or a grain crop such as cassava, corn, sorghum, soybean, wheat, oat, or rice, e.g., an algae, tree or producer, fruit, or vegetable (e.g., trees such as citrus trees, nut trees; solanum, cotton, tobacco, tomato, grape, coffee, cocoa, etc.).
In certain embodiments, the cell is a stem cell or stem cell line.
In certain instances, a host cell of the invention comprises a modification of a gene or genome that is not present in its wild type.
Gene editing method and application
The Cas protein, the nucleic acid, the composition as described above, the CIRSPR/Cas system as described above, the vector system as described above, the delivery composition as described above or the activated CRISPR complex as described above or the host cell as described above may be used for any one or several of the following uses: targeting and/or editing a target nucleic acid; cleaving double-stranded DNA, single-stranded DNA, or single-stranded RNA; specifically editing double-stranded nucleic acids; base-editing double-stranded nucleic acids; base-editing single-stranded nucleic acids. In other embodiments, the kit may also be used to prepare reagents or kits for any one or more of the uses described above.
The invention also provides the application of the Cas protein, the nucleic acid, the composition, the CIRCR SPR/Cas system, the vector system, the delivery composition or the activated CRISPR complex in gene editing, gene targeting or gene cutting; alternatively, use in the manufacture of a reagent or kit for gene editing, gene targeting or gene cleavage.
In one embodiment, the gene editing, gene targeting or gene cleavage is gene editing, gene targeting or gene cleavage inside and/or outside a cell.
The present invention also provides a method of editing, targeting or cleaving a target nucleic acid, comprising contacting the target nucleic acid with the above-described Cas protein, nucleic acid, the above-described composition, the above-described CIRSPR/Cas system, the above-described vector system, the above-described delivery composition or the above-described activated CRISPR complex. In one embodiment, the method is editing, targeting, or cleaving a target nucleic acid inside or outside the cell.
The gene editing or editing target nucleic acids include modifying genes, knocking out genes, altering expression of gene products, repairing mutations, and/or inserting polynucleotides, gene mutations.
The editing can be performed in prokaryotic cells and/or eukaryotic cells.
In another aspect, the invention also provides a kit for gene editing, gene targeting or gene cleavage, comprising the above Cas protein, gRNA, nucleic acid, the above composition, the above CIRSPR/Cas system, the above vector system, the above delivery composition, the above activated CRISPR complex, or the above host cell.
In another aspect, the invention provides the use of the above Cas protein, nucleic acid, the above composition, the above CIRSPR/Cas system, the above vector system, the above delivery composition, the above activated CRISPR complex or the above host cell in the preparation of a formulation or kit for:
(i) gene or genome editing;
(ii) target nucleic acid detection and/or diagnosis;
(iii) editing a target sequence in a target locus to modify an organism or non-human organism;
(iv) treatment of diseases;
(iv) target genes are targeted.
Preferably, the gene or genome editing is carried out intracellularly or extracellularly.
Preferably, the target nucleic acid detection and/or diagnosis is in vitro.
Preferably, the treatment of the disease is the treatment of a condition caused by a defect in the target sequence in the target locus.
Method for specifically modifying target nucleic acid
In another aspect, the present invention also provides a method of specifically modifying a target nucleic acid, the method comprising: contacting the target nucleic acid with the Cas protein, the nucleic acid, the composition, the CIRSPR/Cas system, the vector system, the delivery composition, or the activated CRISPR complex.
The specific modification may occur in vivo or in vitro.
The specific modification may occur intracellularly or extracellularly.
In some cases, the cell is selected from a prokaryotic cell or a eukaryotic cell, e.g., an animal cell, a plant cell, or a microbial cell.
In one embodiment, the modification refers to a break in the target sequence, e.g., a single/double strand break in DNA, or a single strand break in RNA.
In some cases, the method further comprises contacting the target nucleic acid with a donor polynucleotide, wherein the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of the copy of the donor polynucleotide is integrated into the target nucleic acid.
In one embodiment, the modification further comprises inserting an editing template (e.g., an exogenous nucleic acid) into the break.
In one embodiment, the method further comprises: contacting the editing template with the target nucleic acid, or delivering into a cell comprising the target nucleic acid. In this embodiment, the method repairs the disrupted target gene by homologous recombination with an exogenous template polynucleotide; in some embodiments, the repair results in a mutation, including an insertion, deletion, or substitution of one or more nucleotides of the target gene, and in other embodiments, the mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence.
Definition of terms
In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings that are commonly understood by those skilled in the art. Also, the procedures of molecular genetics, nucleic acid chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics, and recombinant DNA, etc., used herein, are all conventional procedures widely used in the corresponding field. Meanwhile, in order to better understand the present invention, the definitions and explanations of related terms are provided below.
Cas protein
In the present invention, Cas protein, Cas enzyme, Cas effector protein may be used interchangeably; the present inventors have for the first time discovered and identified a Cas effector protein having an amino acid sequence selected from the group consisting of:
(i)SEQ ID No.1；
(ii) a sequence having substitution, deletion or addition of one or more amino acids (e.g., substitution, deletion or addition of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids) as compared with the sequence represented by SEQ ID No. 1; or
(iii) A sequence having at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID No. 1.
Nucleic acid cleavage or cleavage of nucleic acids herein includes DNA or RNA fragmentation in a target nucleic acid (Cis cleavage), DNA or RNA fragmentation in a side-branch nucleic acid substrate (single-stranded nucleic acid substrate) (i.e., non-specific or non-targeting, Trans cleavage) produced by a Cas enzyme as described herein. In some embodiments, the cleavage is a double-stranded DNA break. In some embodiments, the cleavage is a single-stranded DNA break or a single-stranded RNA break.
CRISPR system
As used herein, the terms "regularly clustered short palindromic repeats (CRISPR) -CRISPR-associated (Cas) (CRISPR-Cas) system" or "CRISPR system" are used interchangeably and have the meaning generally understood by those skilled in the art, which generally comprise a transcript or other element that is associated with the expression of a CRISPR-associated ("Cas") gene, or a transcript or other element that is capable of directing the activity of said Cas gene.
CRISPR/Cas complexes
As used herein, the term "CRISPR/Cas complex" refers to a complex formed by the binding of a guide RNA (guide RNA) or mature crRNA to a Cas protein, which comprises a direct repeat that hybridizes to a guide sequence of a target sequence and binds to a Cas protein, which complex is capable of recognizing and cleaving a polynucleotide that is capable of hybridizing to the guide RNA or mature crRNA.
Guide RNA (guide RNA, gRNA)
As used herein, the terms "guide RNA", "gRNA", "mature crRNA", "guide sequence" are used interchangeably and have the meaning commonly understood by those skilled in the art. In general, the guide RNA may comprise, consist essentially of, or consist of a direct repeat (direct repeat) and a guide sequence.
In certain instances, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence to hybridize to the target sequence and direct specific binding of the CRISPR/Cas complex to the target sequence. In one embodiment, the degree of complementarity between a guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%, when optimally aligned. Determining the optimal alignment is within the ability of one of ordinary skill in the art. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, the Smith-Waterman algorithm in matlab (Smith-Waterman), Bowtie, Geneius, Biopython, and SeqMan.
Target sequence
By "target sequence" is meant a polynucleotide that is targeted by a guide sequence in the gRNA, e.g., a sequence that is complementary to the guide sequence, wherein hybridization between the target sequence and the guide sequence will promote formation of a CRISPR/Cas complex (including Cas protein and gRNA). Complete complementarity is not necessary as long as there is sufficient complementarity to cause hybridization and promote formation of a CRISPR/Cas complex.
The target sequence may comprise any polynucleotide, such as DNA or RNA. In some cases, the target sequence is located intracellularly or extracellularly. In some cases, the target sequence is located in the nucleus or cytoplasm of the cell. In some cases, the target sequence may be located within an organelle of the eukaryotic cell, such as a mitochondrion or chloroplast. Sequences or templates that can be used for recombination into a target locus containing the target sequence are referred to as "editing templates" or "editing polynucleotides" or "editing sequences". In one embodiment, the editing template is an exogenous nucleic acid. In one embodiment, the recombination is homologous recombination.
In the present invention, a "target sequence" or "target polynucleotide" or "target nucleic acid" can be any polynucleotide endogenous or exogenous to a cell (e.g., a eukaryotic cell). For example, the target polynucleotide may be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide may be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or non-useful DNA). In some cases, the target sequence should be related to the Protospacer Adjacent Motif (PAM).
Wild type
As used herein, the term "wild-type" has the meaning commonly understood by those skilled in the art to mean a typical form of an organism, strain, gene, or characteristic that, when it exists in nature, is distinguished from a mutant or variant form, which may be isolated from a source in nature and which has not been intentionally modified by man.
DerivatisationTransforming
As used herein, the term "derivatize" refers to a chemical modification of an amino acid, polypeptide, or protein to which one or more substituents have been covalently attached. The substituents may also be referred to as side chains.
The derivatized protein is a derivative of the protein, and generally, derivatization of the protein does not adversely affect the desired activity of the protein (e.g., activity in binding to a guide RNA, endonuclease activity, activity in binding to a specific site of a target sequence under the guidance of a guide RNA and cleavage), i.e., the derivative of the protein has the same activity as the protein.
Derivatized proteins
Also referred to as "protein derivatives" refer to modified forms of proteins, for example, wherein one or more amino acids of the protein may be deleted, inserted, modified and/or substituted.
Not naturally occurring
As used herein, the terms "non-naturally occurring" or "engineered" are used interchangeably and represent artificial participation. When these terms are used to describe a nucleic acid molecule or polypeptide, it means that the nucleic acid molecule or polypeptide is at least substantially free from at least one other component with which it is associated in nature or as found in nature.
Orthologues (orthologues)
As used herein, the term "ortholog" has the meaning commonly understood by those skilled in the art. By way of further guidance, an "ortholog" of a protein as described herein refers to a protein belonging to a different species that performs the same or similar function as the protein being its ortholog.
Identity (identity)
As used herein, the term "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both of the sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared x 100. For example, if 6 of 10 positions of two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (3 of the total 6 positions match). Typically, the comparison is made when the two sequences are aligned to yield maximum identity. Such alignments can be performed by using, for example, Needleman et al (1970) j.mol.biol.48: 443-453. The algorithm of E.Meyers and W.Miller (Compout.appl biosci., 4:11-17(1988)) which has been incorporated into the ALIGN program (version 2.0) can also be used to determine percent identity between two amino acid sequences using a PAM120 weight residue table (weight residue table), a gap length penalty of 12, and a gap penalty of 4. Furthermore, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J MoI biol.48:444-453(1970)) algorithms that have been incorporated into the GAP program of the GCG software package (available on www.gcg.com), using either the Blossum 62 matrix or the PAM250 matrix, and the GAP weights (GAP weight) of 16, 14, 12, 10, 8, 6, or 4 and the length weights of 1, 2, 3, 4, 5, or 6.
Carrier
The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid molecule to which it is linked. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules comprising one or more free ends, free ends (e.g., circular); nucleic acid molecules comprising DNA, RNA, or both; and other various polynucleotides known in the art. The vector may be introduced into a host cell by transformation, transduction, or transfection, and the genetic material elements carried thereby are expressed in the host cell. A vector can be introduced into a host cell to thereby produce a transcript, protein, or peptide, including from a protein, fusion protein, isolated nucleic acid molecule, etc. (e.g., a CRISPR transcript, such as a nucleic acid transcript, protein, or enzyme) as described herein. A vector may contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may contain a replication initiation site.
One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, for example, by standard molecular cloning techniques.
Another type of vector is a viral vector, in which the virus-derived DNA or RNA sequences are present in a vector for packaging of viruses (e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno-associated viruses). Viral vectors also comprise polynucleotides carried by viruses for transfection into a host cell. Certain vectors (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors) are capable of autonomous replication in a host cell into which they are introduced.
Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors".
Host cell
As used herein, the term "host cell" refers to a cell that can be used to introduce a vector, and includes, but is not limited to, prokaryotic cells such as Escherichia coli or Bacillus subtilis, eukaryotic cells such as microbial cells, fungal cells, animal cells, and plant cells.
One skilled in the art will appreciate that the design of an expression vector may depend on factors such as the choice of host cell to be transformed, the level of expression desired, and the like.
Regulatory element
As used herein, the term "regulatory element" is intended to include promoters, enhancers, Internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences), which are described in detail with reference to gordel (Goeddel), "gene expression technology: METHODS IN ENZYMOLOGY (GENE EXPRESSION TECHNOLOGY: METHOD IN ENZYMOLOGY)185, Academic Press, San Diego, Calif. (1990). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells as well as those sequences that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters may primarily direct expression in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, a particular organ (e.g., liver, pancreas), or a particular cell type (e.g., lymphocyte). In certain instances, the regulatory element may also direct expression in a time-dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue or cell type specific. In certain instances, the term "regulatory element" encompasses enhancer elements, such as WPRE; a CMV enhancer; the R-U5' fragment in the LTR of HTLV-I ((mol. cell. biol., Vol.8 (1), pp.466-472, 1988); the SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β -globin (Proc. Natl. Acad. Sci. USA., Vol.78 (3), pp.1527-31, 1981).
Promoters
As used herein, the term "promoter" has a meaning well known to those skilled in the art and refers to a non-coding nucleotide sequence located upstream of a gene that promotes expression of a downstream gene. Constitutive (constitutive) promoters are nucleotide sequences that: when operably linked to a polynucleotide that encodes or defines a gene product, it results in the production of the gene product in the cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide that encodes or defines a gene product, causes the gene product to be produced intracellularly substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that: when operably linked to a polynucleotide that encodes or defines a gene product, it results in the production of the gene product in the cell substantially only when the cell is of the tissue type to which the promoter corresponds.
NLS
A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein for introduction into the nucleus by nuclear transport, i.e., a protein with NLS is transported to the nucleus. Typically, NLS contains positively charged Lys or Arg residues exposed at the surface of the protein. Exemplary nuclear localization sequences include, but are not limited to, NLS from: SV40 Large T antigen, EGL-13, c-Myc and TUS protein. In some embodiments, the NLS comprises a PKKKRKV sequence. In some embodiments, the NLS comprises an AVKRPAATKKAGQAKKKKLD sequence. In some embodiments, the NLS comprises an PAAKRVKLD sequence. In some embodiments, the NLS comprises an MSRRRKANPTKLSENAKKLAKEVEN sequence. In some embodiments, the NLS comprises an KLKIKRPVK sequence. Other nuclear localization sequences include, but are not limited to, the acidic M9 domain of hnRNP A1, the sequence KIPIK and PY-NLS in the yeast transcriptional repressor Mat α 2.
Is operably connected to
As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
Complementarity
As used herein, the term "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence by means of a conventional watson-crick or other unconventional type. Percent complementarity refers to the percentage of residues (e.g., 5, 6, 7, 8, 9, 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary) in a nucleic acid molecule that can form hydrogen bonds (e.g., watson-crick base pairing) with a second nucleic acid sequence. "completely complementary" means that all consecutive residues of one nucleic acid sequence hydrogen bond with the same number of consecutive residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids that hybridize under stringent conditions.
Stringent conditions
As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes to the target sequence and does not substantially hybridize to non-target sequences. Stringent conditions are generally sequence dependent and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence.
Hybridization of
The terms "hybridize" or "complementary" or "substantially complementary" refer to a nucleic acid (e.g., RNA, DNA) comprising a nucleotide sequence that enables it to bind non-covalently, i.e., to form base pairs and/or G/U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to the complementary nucleic acid), "anneal" or "hybridize".
Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. Suitable conditions for hybridization between two nucleic acids depend on the length and degree of complementarity of the nucleic acids, variables well known in the art. Typically, the length of the hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).
It is understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or a target region that hybridizes thereto has 100% sequence complementarity of the target region.
Hybridization of a target sequence to a gRNA represents that at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the target sequence and the nucleic acid sequence of the gRNA can hybridize to form a complex; or at least 12, 15, 16, 17, 18, 19, 20, 21, 22 or more bases of nucleic acid sequences representing the target sequence and the gRNA can be complementarily paired to hybridize to form a complex.
Expression of
As used herein, the term "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcript) and/or the process by which transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. The transcripts and encoded polypeptides may be collectively referred to as "gene products". If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells.
Joint
As used herein, the term "linker" refers to a linear polypeptide formed from a plurality of amino acid residues joined by peptide bonds. The linker of the present invention may be an artificially synthesized amino acid sequence, or a naturally occurring polypeptide sequence, such as a polypeptide having a hinge region function. Such linker polypeptides are well known in the art (see, e.g., Holliger, P. et al (1993) Proc. Natl. Acad. Sci. USA 90: 6444-.
Treatment of
As used herein, the term "treating" refers to treating or curing a disorder, delaying the onset of symptoms of a disorder, and/or delaying the development of a disorder.
Test subject
As used herein, the term "subject" includes, but is not limited to, various animals, plants, and microorganisms.
Animal(s) production
For example, a mammal, such as a bovine, equine, ovine, porcine, canine, feline, lagomorph, rodent (e.g., mouse or rat), non-human primate (e.g., macaque or cynomolgus monkey), or human. In certain embodiments, the subject (e.g., human) has a disorder (e.g., a disorder resulting from a deficiency in a disease-associated gene).
Plant and method for producing the same
The term "plant" is to be understood as including any differentiated multicellular organism capable of photosynthesis, in including crop plants at any stage of maturity or development, in particular monocotyledonous or dicotyledonous plants, vegetable crops, including artichokes, corm cabbages, sesames, leeks, asparagus, lettuce (e.g. head lettuce, leaf lettuce), bok choy, yellow croaker, melons (e.g. melons, watermelons, crow's melon, honeydew melon, cantaloupe), rape crops (e.g. brussels sprouts, cabbage, cauliflower, broccoli, collards, headless cabbages, chinese cabbages, cephalanoplos, carrots, cabbage (napa), okra, onions, celery, chickpea, parsnip, endive, potato, cucurbits (e.g. zucchini, cucurbits, etc, Squash, pumpkin), radish, dried onion, turnip cabbage, purple eggplant (also called eggplant), salsify, endive, shallot, endive, garlic, spinach, green onion, squash, leafy vegetables (greens), beets (sugar and feed beets), sweet potato, lettuce, horseradish, tomato, turnip, and spices; fruit and/or vintage crops such as apple, apricot, cherry, nectarine, peach, pear, plum, prune, cherry, quince, almond, chestnut, hazelnut, pecan, pistachio, walnut, citrus, blueberry, boysenberry (boysenberry), raspberry, currant, loganberry, raspberry, strawberry, blackberry, grape, avocado, banana, kiwi, persimmon, pomegranate, pineapple, tropical fruit, pome, melon, mango, papaya, and lychee; field crops, such as clover, alfalfa, evening primrose, meadowfoam, corn/maize (fodder corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain crops (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, legumes (beans, lentils, peas, soybeans), oleaginous plants (oilseed rape, mustard, poppy, olives, sunflowers, coconut, castor oil plants, cocoa beans, groundnuts), arabidopsis, fibrous plants (cotton, flax, hemp, jute), lauraceae (cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plants; and/or bedding plants, such as flowering plants, cactus, fleshy plants and/or ornamental plants, and trees, such as forests (broad leaf and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other plantlets.
Advantageous effects of the invention
The invention discovers a novel Cas enzyme, and Blast results show that the Cas enzyme has low consistency with the reported Cas enzyme, can show the activity of nuclease in vivo and in vitro, and has wide application prospect.
Embodiments of the present invention will be described in detail below with reference to the drawings and examples, but those skilled in the art will understand that the following drawings and examples are only for illustrating the present invention and do not limit the scope of the present invention. Various objects and advantageous aspects of the present invention will become apparent to those skilled in the art from the accompanying drawings and the following detailed description of the preferred embodiments.
Drawings
FIG. 1 PAM structure of Cas-sf 0005.
FIG. 2 cleavage of double-stranded nucleic acid by Cas-sf 0005.
FIG. 3 sequencing of target gene by Cas-sf0005 after editing eukaryotic cells.
Sequence information
SEQ ID No. Description of the preferred embodiment
1 Amino acid sequence of Cas-sf0005
2 Nucleic acid sequence encoding Cas-sf0005
3 Nucleic acid sequence of humanized Cas-sf0005
4 DR region of gRNA of Cas-sf0005
5 DR region of gRNA of Cas-sf0005
Detailed Description
The following examples are intended to illustrate the invention only and are not intended to limit the invention. Unless otherwise indicated, the experiments and procedures described in the examples were performed essentially according to conventional methods well known in the art and described in various references. For example, conventional techniques in immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA used in the present invention can be found in Sambrook (Sambrook), friesch (Fritsch), and manitis (manitis), molecular cloning: a LABORATORY Manual (Molecular CLONING: A Laboratory Manual), 2 nd edition (1989); a Current Manual of MOLECULAR BIOLOGY experiments (Current PROTOCOLS IN MOLECULAR BIOLOGY BIOLOGY) (edited by F.M. Otsubel et al, (1987)); METHODS IN ENZYMOLOGY (METHODS IN Enzymology) series (academic Press): PCR 2: practical methods (PCR 2: A PRACTICAL APPROACH) (m.j. macpherson, b.d. heims (b.d. hames) and g.r. taylor (g.r. taylor) editions (1995)), Harlow (Harlow) and la nei (Lane) editions (1988) antibodies: a LABORATORY Manual (ANTIBODIES, A LABORATORY MANUAL), and animal cell CULTURE (ANIMAL CELL CURTURE) (edited by R.I. Freyrnib (R.I. Freshney) (1987)).
In addition, those whose specific conditions are not specified in the examples are conducted under the conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available. The examples are given by way of illustration and are not intended to limit the scope of the invention as claimed. All publications and other references mentioned herein are incorporated by reference in their entirety.
Example 1 acquisition of Cas protein
The inventors analyzed the metagenome of the unculture, and identified 1 new Cas enzyme by redundancy removal and protein clustering analysis. Blast results show that the sequence consistency of the Cas protein and the reported Cas protein is low, and the Cas protein is named as Cas-sf0005 in the invention.
The amino acid sequence, the coding nucleic acid sequence and the nucleic acid sequence after the human source codon optimization of the protein are as follows:
SEQ ID No. description of the invention
1 Amino acid sequence of Cas-sf0005
2 Nucleic acid sequence encoding Cas-sf0005
3 Nucleic acid sequence of humanized Cas-sf0005
The results of analyzing the direct repeat sequences of gRNAs corresponding to the proteins show that:
the direct repeat sequence of gRNA corresponding to Cas-sf0005 protein is CCGUCAACGUUCAACGCUUGCUCGGUUCGCCGAGAC (SEQ ID No.4) or CCGUCAACGUUCAACGCUUGCUCGGUACGCCGAGAC (SEQ ID No. 5).
Example 2 identification of the PAM Domain of Cas-sf0005 protein
Construction of a PAM library, Synthesis of sequence CGTGTTTCGTAAAGTCTGGAAACGCGGAAGCCCCCAGCGCTTCAGCGTTCNNNNNNTCCCCTACGTGCTGCTGAAGTTGCCCGCAA, N is random deoxynucleotide, underlined is target sequence. After filling in with Klenow enzyme, the pacyc184 vector was ligated. After transforming the Escherichia coli, extracting plasmids to form a PAM library. The gRNA Cas-sf0005-5' spacer 120 bp sequence is: CCGUCAACGUUCAACGCUUGCUCGGUUCGCCGAGACUCCCCUACGUGC UGCUGAAG(the underlined region is the targeting region);
the primer sequence is as follows: TK-117: CGGCATTCCTGCTGAACCGCTCTTCCGATCT, respectively;
TK-111：GATCGGAAGAGCGGTTCAGCAGGAATGCCG；
PAM-after-F：ACTCAGGGGTCTTCGGTTTCCGTGTT；
S6-PAM-after：ACTCAGCTGAACCGCTCTTCCG；
acquisition of Cas-sf0005 protein biased PAM library: 50nM Cas-sf0005 protein, 50nM gRNA in buffer 25 ℃, incubated for 10 min. Adding PAM library plasmid (10 ng/. mu.L), and incubating at 37 ℃ for 1 h; incubate at 85 ℃ for 20 min. 2.5U of DreamTaq DNA Polymerase (5U/. mu.L) (Thermo Fisher Scientific) and 4. mu.L of 2.5mM dNTP Mix (all gold) were added to the system, incubated at 72 ℃ for 30min, and blunt-ended cleaved ends and A added to the 3' end were performed. The product was purified by using a Kit (Omega Gel Extraction Kit D2500). The primers TK-117 and TK-111 are annealed and then connected with the product through T4 ligase. The obtained ligation product was subjected to PCR reaction using primers PAM-after-F and S6-PAM-after to obtain a Cas-sf0005 protein-biased PAM library, the PCR product was subjected to secondary sequencing, a PAM sequence was obtained by analysis, and mapping was performed using Weblogo, with the result shown in fig. 1, where PAM sequence recognized by Cas-sf0005 is 5 'TBN-3', where B is T/C/G and N is a/T/C/G.
Example 3 application of Cas-sf0005 protein to double-stranded nucleic acid editing
This example tests the cleavage activity of Cas-sf0005 protein on double-stranded DNA by in vitro assay. The grnas that can pair with the target nucleic acid are used in this example to guide Cas-protein recognition and binding on double-stranded target nucleic acid; subsequently, the Cas protein stimulates cleavage activity on the double-stranded target nucleic acid, thereby cleaving the double-stranded target nucleic acid in the system. The double-stranded target nucleic acid after cutting is subjected to agarose double-stranded electrophoresis detection.
In this example, the target nucleic acid is selected to be a double-stranded DNA having the sequence: GAACGCTGAAGCGCTGGGGGCATTATCCC CTACGTGCTGCTGAAGTTGC was ligated into the Vector T-Vector-pEASY-Blunt Simple Cloning Vector; the italicized part TTA is the PAM sequence and the underlined region is the targeting region. gRNA-Cas-sf0005-5' spacer 1-20 bp: CCGUCAACGUUCAACGCUUGCUCGGUUCGCCGAGACUCCCCUACGUGCUGCUGAAG(the underlined region is the targeting region); the following reaction system is adopted: cas-sf0005 final concentration is 50nM, gRNA final concentration is 500nM, double stranded target nucleic acid final concentration is 5 ng/. mu.L. A Cas protein, a gRNA,incubating at 25 ℃ for 10 min; double stranded target nucleic acid was added and incubated at 37 ℃ for 1 h. 1.0% agarose electrophoresis detection. The experimental group was supplemented with target nucleic acid and gRNA, while the control group was not supplemented with gRNA.
As shown in FIG. 2, lane 1 is an experimental group, lane 2 is a control group, and lane 3 is Trans2K plus DNA marker. Cas-sf0005 is able to effectively cleave double-stranded nucleic acids in a system in an experimental group containing the target nucleic acid and gRNA, compared to a control without the addition of gRNA. The experimental results show that Cas-sf0005 can be used for cleavage and editing of double stranded target nucleic acids.
Example 4 efficiency of Cas-sf0005 protein editing in animal cells
Cas-sf0005 protein is adopted to verify the activity of gene editing in animal cells, and a target point is designed aiming at Chinese Hamster Ovary (CHO) FUT8 gene. The vector pcDNA3.3 is modified to carry EGFP fluorescent protein and Puror resistance gene. Inserting SV40 NLS-Cas-sf0005 fusion protein through a restriction enzyme site BsmB 1; the U6 promoter and gRNA sequence were inserted via restriction site Mfe 1. The CMV promoter initiates expression of the fusion protein SV40 NLS-Cas-sf 0005-NLS-GFP. The protein Cas-sf0005-NLS is linked to the protein GFP with the linker peptide T2A. The promoter EF-1 alpha initiates puromycin resistance gene expression.
Plate paving: CHO cell confluence to 70-80% was plated and 12-well plates were seeded with 8 x 10^4 cells/well.
Transfection: plating for 6-8h for transfection, adding 3.25 μ l Lipo3000 into 125 μ l opti-MEM, and mixing; to 125. mu.l of opti-MEM were added 3ug of plasmid and 10. mu. l P3000, followed by mixing. The diluted Lipo3000 and the diluted plasmid were mixed well and incubated at room temperature for 5 min. The incubated mixture is added to a medium plated with cells for transfection.
Puromycin screening: puromycin was added for 24h of transfection to a final concentration of 10 ng/ml. The puromycin is treated for 24 hours and is replaced by a normal culture medium for further culture for 24 hours.
Extracting DNA, amplifying the vicinity of an editing area by PCR, sending HITOM for sequencing: cells are collected after being digested by pancreatin, and genome DNA is extracted by a cell/tissue genome DNA extraction kit (Baitaike). The genome DNA is amplified by a primer NAFAT 8-JC-HITOM-1F 1: GGAGTGAGTACGGTGTGCTCCTCCTTACTTACCCTTGG, respectively; NAFAT 8-JC-HITOM-1R 1: GAGTTGGATGCTGGATGGTTGTTCTTTGGTGGGACTATG amplifying the region near the target. PCR products were subjected to hitoM sequencing.
Sequencing data analysis, counting the sequence types and the proportion within the range of 15nt upstream and 10nt downstream of the target position, and counting the sequences with the SNV frequency of more than or equal to 1% or the non-SNV mutation frequency of more than or equal to 0.1% in the sequences to obtain the editing efficiency of the Cas-sf0005 protein on the target position.
CHO cell FUT8 gene target sequence: gR1-FUT 8: TTTGACAAACTGGGATACCCACCACAThe italic part is the PAM sequence and the underlined region is the targeting region. The gRNA sequence is CCGUCAACGUUCAACGCUUGCUCGGUUCGCCGAGACG ACAAACUGGGAUACCCACCACAThe underlined region is the targeting region.
Analysis results show that the editing efficiency of Cas-sf0005 in a target gR1-FUT8 of CHO cells reaches 22.49%, the editing types are InDel, and partial sequencing results of the edited target nucleic acid are shown in FIG. 3.
While specific embodiments of the invention have been described in detail, those skilled in the art will understand that: various modifications and changes in detail can be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention.
SEQUENCE LISTING
<110> Shunheng Biotech Co., Ltd
<120> novel CRISPR enzymes and systems and uses
<130> SF092-1
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 737
<212> PRT
<213> Artificial Sequence
<220>
<223> Cas-sf0005
<400> 1
Met Thr Pro Lys Thr Glu Thr Pro Val Gly Ala Leu Ile Lys Lys Phe
1 5 10 15
Phe Pro Gly Lys Arg Phe Gln Lys Asn Tyr Leu Lys Asp Ala Gly Lys
20 25 30
Lys Leu Lys Arg Glu Gly Glu Ala Ala Ala Val Glu Tyr Leu Ser Gly
35 40 45
Lys Gln Glu Asp His Pro Ala Asn Phe Cys Pro Pro Ala Lys Val Asn
50 55 60
Ile Leu Ala Gln Ser Arg Pro Leu Ser Glu Trp Pro Ile Asn Leu Val
65 70 75 80
Ser Lys Gly Val Gln Glu Tyr Val Tyr Gly Leu Thr Ala Ala Glu Arg
85 90 95
Glu Ala Asn Gly Asp Phe Gly Thr Ser Arg Lys Ser Leu Asp Arg Trp
100 105 110
Phe Ala Arg Thr Gly Val Pro Thr His Gly Tyr Thr Thr Val Gln Gly
115 120 125
Leu Asn Leu Ile Leu Arg His Thr Phe Asn Arg Tyr Asp Gly Val Ile
130 135 140
Lys Lys Val Glu Thr Arg Asn Glu Lys Arg Arg Ser Lys Ala Thr Arg
145 150 155 160
Ile Asn Val Ser Arg Glu Ala Asp Gly Leu Pro Pro Ile Glu Ala Glu
165 170 175
Pro Glu Glu Thr Ala Phe Gly Pro Asp Gly Lys Leu Lys Glu Arg Pro
180 185 190
Gly Ile Asn Pro Ser Ile Tyr Cys Tyr Gln Gln Val Ser Pro Val Pro
195 200 205
Tyr Asn Pro Ala Lys His Pro Ala Leu Pro Phe Ser Gly Val Asp Pro
210 215 220
Gly Ala Pro Leu Pro Leu Gly Thr Pro Asn Arg Leu Ser Ile Pro Lys
225 230 235 240
Gly Gln Pro Gly Tyr Val Pro Glu Trp Gln Arg Pro His Leu Ser Thr
245 250 255
Lys Asn Lys Arg Ile Arg Lys Trp Tyr Ala Arg Ala Asn Trp Arg Arg
260 265 270
Lys Pro Gly Arg Lys Ser Val Leu Asp Glu Ala Lys Leu Lys Glu Ala
275 280 285
Ala Leu Lys Glu Ala Ile Pro Ile Ile Val Thr Ile Gly Lys Asp Trp
290 295 300
Ile Val Met Asp Ala Arg Gly Leu Leu Arg Ala Val Tyr Trp Arg Gly
305 310 315 320
Ile Ala Lys Pro Gly Leu Ser Leu Lys Glu Leu Leu Gly Phe Phe Ser
325 330 335
Gly Asp Pro Val Leu Asp Pro Lys Arg Gly Ile Ala Thr Phe Thr Phe
340 345 350
Lys Leu Gly Ala Val Ala Val His Ser Arg Lys Pro Thr Arg Gly Lys
355 360 365
Lys Ser Lys Glu Leu Leu Leu Ser Met Thr Ala Glu Lys Pro His Val
370 375 380
Gly Leu Val Ala Ile Asp Leu Gly Gln Thr Asn Pro Val Ala Ala Glu
385 390 395 400
Phe Ser Arg Val Lys Arg Glu Gly Glu Thr Leu Gln Ala Glu Pro Leu
405 410 415
Gly Gln Ile Val Leu Pro Asp Asp Leu Val Lys Asp Leu Thr Arg Tyr
420 425 430
Arg Arg Ala Trp Asp Ala Thr Glu Glu Gln Ile Lys Ala Glu Ala Ile
435 440 445
Val Gln Leu Pro Glu Glu Cys Arg Ala Glu Val Val Lys Val Asn Gln
450 455 460
Met Ser Ala Glu Glu Thr Lys His Leu Ile Leu Asp Arg Gly Val Ser
465 470 475 480
Gly Asp Leu Pro Trp Glu Lys Met Thr Ser Asn Thr Thr Phe Ile Ser
485 490 495
Asp His Leu Leu Ala Lys Gly Val Thr Asp Gln Val Phe Phe Glu Lys
500 505 510
Lys Ser Lys Gly Lys Lys Lys Gly Thr Glu Thr Val Lys Arg Lys Asp
515 520 525
Tyr Gly Trp Val Lys Leu Leu Arg Pro Arg Leu Ser Gln Glu Thr Arg
530 535 540
Lys Ala Val Asn Asp Lys Thr Trp Glu Leu Lys Arg Ala Ser Thr Glu
545 550 555 560
Tyr Val Arg Leu Ser Arg Arg Lys Thr Glu Leu Ala Arg Arg Cys Val
565 570 575
Asn Tyr Ile Val Arg Glu Thr Lys Arg Trp Thr Gln Cys Glu Asp Ile
580 585 590
Ala Ile Val Ile Glu Asp Leu Asn Val Arg Phe Phe His Gly Ser Gly
595 600 605
Glu Arg Pro Asp Gly Trp Asp Asn Phe Phe Ile Ser Lys Arg Glu Asn
610 615 620
Arg Trp Phe Ile Gln Val Leu His Lys Ala Phe Ser Asp Leu Ala Leu
625 630 635 640
His Arg Gly Leu Pro Val Ile Glu Ala Asn Pro Ala Arg Thr Ser Ile
645 650 655
Thr Cys Ile Arg Cys Gly His Cys Asp Arg Asn Asn Arg His Gly Glu
660 665 670
Met Phe Leu Cys Leu Ser Cys Asn Asp Leu Arg His Ala Asp Arg Glu
675 680 685
Ile Ala Thr Arg Asn Leu Thr Arg Val Ala Val Thr Gly Glu Met Ile
690 695 700
Pro Arg Arg Ile Glu Pro Gly Glu Gln Ser Gly Asp Thr Lys Lys Ala
705 710 715 720
Arg Ser Ala Arg Lys Gly Lys Lys Ala Val Ile Ser Lys Arg Glu Ala
725 730 735
Ala
<210> 2
<211> 2214
<212> DNA
<213> Artificial Sequence
<220>
<223> Cas-sf0005
<400> 2
atgaccccca aaaccgaaac gccggtgggc gccctcatca agaagttctt ccctggtaag 60
cggttccaga agaactacct gaaggacgca gggaagaagc tgaagaggga gggtgaggct 120
gccgctgtgg agtacctgtc ggggaagcaa gaggaccacc ccgcgaactt ctgccctcct 180
gcgaaggtca acatccttgc gcagagccgc cccctctcgg agtggcccat caacctcgtc 240
tcgaagggcg tgcaggagta cgtctacggg ctcacggccg ctgaacgtga ggcaaacggg 300
gatttcggga cctcccgtaa gagcctcgat cggtggttcg ctcgaacggg cgttcctacc 360
cacgggtaca cgaccgttca agggttgaac ctcatcctgc ggcacacctt caaccgttac 420
gacggcgtga tcaagaaggt cgagacgcgc aacgagaagc gtcgaagcaa ggccacccgc 480
atcaacgtgt cacgggaagc tgacggcctt ccgcctatcg aggcggaacc cgaagaaacg 540
gccttcggcc cggatgggaa gctgaaggag cgccctggga tcaacccctc gatctactgc 600
taccaacagg tgtcgccggt cccttacaac ccggcgaagc atcctgcgct gcctttttct 660
ggcgtcgatc ccggtgcacc tttgcccttg ggcaccccga accgcctgag tattcccaag 720
gggcagccgg ggtacgtccc ggagtggcag cggccccatc tctcgacgaa gaacaagcgt 780
atccgcaagt ggtatgcccg cgccaactgg cgccgtaagc cggggcgcaa gtctgttctg 840
gacgaggcga agctgaagga ggctgccctg aaggaggcga tccccatcat cgtcaccatc 900
ggcaaggatt ggattgtcat ggatgctcgc ggcttgctgc gggctgtcta ctggcgtggc 960
atcgcaaagc cgggcctgtc gctcaaggag cttcttggct tcttctccgg cgaccctgtt 1020
ctcgacccga agcgcggcat cgcaaccttc accttcaagc tgggcgcggt cgcagttcac 1080
tcgcgcaagc cgacgcgggg caagaagtcg aaggagctgc tcctcagcat gactgccgag 1140
aagccgcacg tgggtctggt cgccatcgac cttggacaga cgaaccctgt cgctgcggag 1200
ttctcccgtg tcaagcgcga gggagagacg ttgcaagcgg agcccctcgg gcagatcgtg 1260
ctgccggacg acctggtcaa ggatctcacg cgctatcggc gcgcatggga tgcgaccgag 1320
gagcagatca aggcggaagc catcgtgcag ctccccgaag agtgccgggc cgaggttgtg 1380
aaggtcaatc aaatgtcggc ggaagagacc aagcacctca tcctcgatag gggcgttagt 1440
ggggatctcc cctgggagaa gatgacctcg aacacgacgt tcatctccga ccacttgctc 1500
gccaagggtg tcaccgacca ggtcttcttc gagaagaaga gcaagggcaa gaagaagggc 1560
acggagacgg tcaagcgcaa ggactacgga tgggtgaagc tccttcgccc ccgtttgtcc 1620
caggagactc gcaaggctgt caacgacaag acctgggagt tgaagcgggc cagcacggag 1680
tacgtgcgtc tctcacgccg aaagactgaa ctcgcccgcc gctgtgtcaa ctacatcgtc 1740
cgagagacca agcgctggac gcagtgcgag gacatcgcca tcgtcatcga agatctcaac 1800
gtccgcttct tccacgggtc gggcgagcgc ccggatggat gggacaactt cttcatctcg 1860
aagcgcgaga accgctggtt catccaggta ctacacaagg cattcagtga cctcgccttg 1920
caccgcgggc tgccggtcat cgaggccaac cccgcaagga cgagcatcac atgcatccgg 1980
tgcgggcact gtgatcggaa taaccgccac ggggagatgt tcctgtgcct ctcgtgcaac 2040
gatctacgtc acgctgaccg tgagatcgct acccggaacc tgacccgcgt ggcggtcacg 2100
ggtgagatga taccccggcg catcgagccc ggcgagcagt cgggtgacac caaaaaggcc 2160
aggagtgctc gcaagggcaa aaaggcagtg atttcgaaga gggaggctgc ttag 2214
<210> 3
<211> 2214
<212> DNA
<213> Artificial Sequence
<220>
<223> Cas-sf0005-hu
<400> 3
atgacaccca aaaccgagac acctgtgggc gctctgatta agaaattctt ccccggcaag 60
agattccaga agaactacct gaaggacgcc ggcaagaagc tgaagagaga gggcgaggct 120
gctgccgttg aatatttaag cggaaaacaa gaagatcacc ccgccaactt ctgccccccc 180
gctaaagtga atatcctggc ccaaagcaga cccctgagcg agtggcctat taatctggtg 240
agcaagggcg tgcaggagta cgtgtatggc ctgaccgctg ccgaaagaga ggctaatggc 300
gatttcggaa ccagcagaaa gagcctggac agatggttcg ccagaaccgg cgtgcctacc 360
catggatata caacagtgca aggcctgaac ctgattctga gacacacctt caacagatac 420
gacggcgtga tcaagaaggt ggaaaccaga aacgagaaga gaagaagcaa ggccaccaga 480
atcaacgtga gcagagaggc cgacggcctg cctcctattg aagccgaacc tgaagagaca 540
gcttttggcc ccgatggaaa actgaaagag aggcccggca tcaaccccag catctactgc 600
taccagcagg tgagccccgt gccctataat cccgctaagc atcctgctct gcccttcagc 660
ggagtggacc ccggagctcc tctgcctctg ggaacaccta atagactgag cattcccaag 720
ggccagcccg gctatgttcc tgaatggcaa agaccccacc tgagcacaaa gaacaagaga 780
atcagaaagt ggtacgccag agccaactgg agaagaaagc ccggcagaaa gagcgtgctg 840
gacgaggcta aactgaagga ggccgctctg aaagaggcca tccctattat cgtgaccatc 900
ggcaaggact ggatcgtgat ggacgccaga ggcctgctga gagccgtgta ttggagaggc 960
attgccaagc ccggactgag cctgaaggaa ctgctgggat ttttcagcgg cgatcctgtg 1020
ctggatccta agagaggcat tgccaccttc acctttaagc tgggcgccgt ggctgtgcac 1080
agcagaaaac ctacaagagg caagaagagc aaggagctgc tgctgagcat gaccgccgaa 1140
aaaccccacg tgggcctggt ggctattgat ctgggccaaa caaatcctgt ggccgctgaa 1200
ttcagcagag tgaaaagaga gggcgagaca ctgcaggccg aacccttagg acaaattgtg 1260
ctgcctgatg atctggtgaa ggacctgacc agatacagaa gagcctggga cgccaccgag 1320
gagcaaatta aagccgaagc tatcgtgcag ctgcccgaag agtgtagagc cgaggtggtg 1380
aaagtgaacc agatgagcgc cgaggagaca aagcacctga ttctggatag aggcgtgagc 1440
ggcgatctgc cttgggaaaa aatgaccagc aacaccacct tcatcagcga ccacctgctg 1500
gccaaaggcg tgacagatca agtgtttttc gagaagaaga gcaagggcaa gaagaagggc 1560
accgaaaccg tgaagagaaa ggactacggc tgggtgaagc tgctcagacc cagactgagc 1620
caggagacaa gaaaggccgt gaacgacaag acctgggagc tgaagagagc cagcaccgag 1680
tatgtgagac tgagcagaag aaagaccgag ctggccagaa gatgcgtgaa ctacatcgtg 1740
agagagacaa agagatggac ccagtgcgag gacatcgcca tcgtgattga ggacctgaac 1800
gtgagattct tccacggcag cggcgaaaga cccgatggat gggataattt cttcatcagc 1860
aagagagaga acagatggtt catccaggtg ctgcacaagg ccttcagcga cctggctctg 1920
catagaggac tgcctgtgat tgaagccaat cctgccagaa caagcatcac ctgtatcaga 1980
tgcggccact gcgacagaaa caacagacac ggcgagatgt tcctgtgcct gagctgcaat 2040
gacctgagac acgccgacag agagatcgcc acaagaaacc tgaccagagt ggccgtgacc 2100
ggcgaaatga ttcccagaag aatcgagccc ggcgagcaga gcggagatac aaaaaaagct 2160
agaagcgcca gaaagggcaa gaaggccgtg atcagcaaga gagaggccgc ctaa 2214
<210> 4
<211> 36
<212> RNA
<213> Artificial Sequence
<220>
<223> DR
<400> 4
ccgucaacgu ucaacgcuug cucgguucgc cgagac 36
<210> 5
<211> 36
<212> RNA
<213> Artificial Sequence
<220>
<223> DR
<400> 5
ccgucaacgu ucaacgcuug cucgguacgc cgagac 36

Claims (16)

1. A Cas protein, characterized in that the Cas protein is any one of the following I-III:
I. the amino acid sequence of the Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity as compared to SEQ ID No.1, and substantially retains the biological function of the sequence from which it is derived;
II. The amino acid sequence of the Cas protein has a sequence with one or more amino acid substitutions, deletions or additions compared to SEQ ID No.1, and substantially retains the biological function of the sequence from which it is derived;
III, the Cas protein comprises an amino acid sequence shown as SEQ ID No. 1.
2. A fusion protein comprising the Cas protein of claim 1 and other modifying moieties.
3. An isolated polynucleotide, wherein the polynucleotide is a polynucleotide sequence encoding a Cas protein of claim 1, or a polynucleotide sequence encoding a fusion protein of claim 2.
4. A gRNA comprising a direct repeat sequence capable of binding the Cas protein of claim 1 and a guide sequence capable of targeting a target sequence.
5. An direct repeat comprising the sequence shown as SEQ ID No.4 or 5.
6. A vector comprising the polynucleotide of claim 3 operably linked to a regulatory element.
7. A CRISPR-Cas system, comprising a Cas protein of claim 1 and at least one gRNA of claim 4.
8. A vector system, wherein the vector system comprises one or more vectors comprising:
a) a first regulatory element operably linked to the gRNA of claim 4,
b) a second regulatory element operably linked to the Cas protein of claim 1;
wherein components (a) and (b) are located on the same or different carriers of the system.
9. A composition, characterized in that the composition comprises:
(i) a protein component selected from: a Cas protein according to claim 1 or a fusion protein according to claim 2;
(ii) a nucleic acid component selected from the group consisting of: the gRNA of claim 4, or a nucleic acid encoding the gRNA of claim 4, or a precursor RNA of the gRNA of claim 4, or a precursor RNA nucleic acid encoding the gRNA of claim 4;
the protein component and the nucleic acid component are combined with each other to form a complex.
10. An activated CRISPR complex comprising:
(i) a protein component selected from: a Cas protein according to claim 1 or a fusion protein according to claim 2;
(ii) a nucleic acid component selected from the group consisting of: the gRNA of claim 4, or a nucleic acid encoding the gRNA of claim 4, or a precursor RNA of the gRNA of claim 4, or a precursor RNA nucleic acid encoding the gRNA of claim 4;
(iii) a target sequence that binds on a gRNA of claim 4.
11. An engineered host cell comprising a Cas protein of claim 1, or a fusion protein of claim 2, or a polynucleotide of claim 3, or a vector of claim 6, or a CRISPR-Cas system of claim 7, or a vector system of claim 8, or a composition of claim 9, or an activated CRISPR complex of claim 10.
12. Use of a Cas protein of claim 1, or a fusion protein of claim 2, or a polynucleotide of claim 3, or a vector of claim 6, or a CRISPR-Cas system of claim 7, or a vector system of claim 8, or a composition of claim 9, or an activated CRISPR complex of claim 10, or a host cell of claim 11 in gene editing, gene targeting, or gene cleavage; alternatively, use in the manufacture of a reagent or kit for gene editing, gene targeting or gene cleavage.
13. Use of a Cas protein of claim 1, or a fusion protein of claim 2, or a polynucleotide of claim 3, or a vector of claim 6, or a CRISPR-Cas system of claim 7, or a vector system of claim 8, or a composition of claim 9, or an activated CRISPR complex of claim 10, or a host cell of claim 11 in a cell selected from any one or any of:
targeting and/or editing a target nucleic acid; cleaving double-stranded DNA, single-stranded DNA, or single-stranded RNA; specifically editing double-stranded nucleic acids; base-editing double-stranded nucleic acids; base-editing single-stranded nucleic acids.
14. A method of editing, targeting or cleaving a target nucleic acid, the method comprising contacting the target nucleic acid with the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 6, or the CRISPR-Cas system of claim 7, or the vector system of claim 8, or the composition of claim 9, or the activated CRISPR complex of claim 10, or the host cell of claim 11.
15. A kit for gene editing, gene targeting or gene cleavage comprising the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 6, or the CRISPR-Cas system of claim 7, or the vector system of claim 8, or the composition of claim 9, or the activated CRISPR complex of claim 10, or the host cell of claim 11.
16. Use of a Cas protein of claim 1, or a fusion protein of claim 2, or a polynucleotide of claim 3, or a vector of claim 6, or a CRISPR-Cas system of claim 7, or a vector system of claim 8, or a composition of claim 9, or an activated CRISPR complex of claim 10, or a host cell of claim 11 in the preparation of a formulation or kit for:
(i) gene or genome editing;
(ii) target nucleic acid detection and/or diagnosis;
(iii) editing a target sequence in a target locus to modify an organism or non-human organism;
(iv) treatment of diseases;
(v) targeting a target gene;
(vi) cutting the target gene.
CN202210168270.8A 2021-10-26 2022-02-23 Novel CRISPR enzymes and systems and uses Active CN114438055B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202111244315 2021-10-26
CN2021112443157 2021-10-26

Publications (2)

Publication Number Publication Date
CN114438055A true CN114438055A (en) 2022-05-06
CN114438055B CN114438055B (en) 2022-08-26

Family

ID=81372842

Family Applications (3)

Application Number Title Priority Date Filing Date
CN202210168270.8A Active CN114438055B (en) 2021-10-26 2022-02-23 Novel CRISPR enzymes and systems and uses
CN202211296617.3A Active CN115992115B (en) 2021-10-26 2022-10-21 Novel CRISPR enzymes and systems and uses
CN202310946734.8A Pending CN117050972A (en) 2021-10-26 2022-10-21 Novel CRISPR enzymes and systems and uses

Family Applications After (2)

Application Number Title Priority Date Filing Date
CN202211296617.3A Active CN115992115B (en) 2021-10-26 2022-10-21 Novel CRISPR enzymes and systems and uses
CN202310946734.8A Pending CN117050972A (en) 2021-10-26 2022-10-21 Novel CRISPR enzymes and systems and uses

Country Status (2)

Country Link
CN (3) CN114438055B (en)
WO (1) WO2023071934A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115725543A (en) * 2022-10-25 2023-03-03 山东舜丰生物科技有限公司 CRISPR enzymes and systems
CN115992115A (en) * 2021-10-26 2023-04-21 山东舜丰生物科技有限公司 Novel CRISPR enzymes and systems and uses
WO2024041299A1 (en) * 2022-08-25 2024-02-29 山东舜丰生物科技有限公司 Mutated crispr-cas protein and use thereof

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016205764A1 (en) * 2015-06-18 2016-12-22 The Broad Institute Inc. Novel crispr enzymes and systems
CN111690773A (en) * 2020-06-17 2020-09-22 山东舜丰生物科技有限公司 Method and system for detecting target nucleic acid by using novel Cas enzyme
CN111757889A (en) * 2018-10-29 2020-10-09 中国农业大学 Novel CRISPR/Cas12f enzymes and systems
WO2021067788A1 (en) * 2019-10-03 2021-04-08 Artisan Development Labs, Inc. Crispr systems with engineered dual guide nucleic acids
US20210238567A1 (en) * 2019-03-07 2021-08-05 The Regents Of The University Of California Crispr-cas effector polypeptides and methods of use thereof
CN113337502A (en) * 2020-09-25 2021-09-03 山东舜丰生物科技有限公司 gRNA and its use

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017156764A1 (en) * 2016-03-18 2017-09-21 上海锐翌生物科技有限公司 Isolated nucleic acid application thereof
US11168322B2 (en) * 2017-06-30 2021-11-09 Arbor Biotechnologies, Inc. CRISPR RNA targeting enzymes and systems and uses thereof
JP7460178B2 (en) * 2018-11-15 2024-04-02 中国▲農▼▲業▼大学 CRISPR-Cas12j enzyme and system
WO2020123887A2 (en) * 2018-12-14 2020-06-18 Pioneer Hi-Bred International, Inc. Novel crispr-cas systems for genome editing
JP2022540153A (en) * 2019-07-11 2022-09-14 アーバー バイオテクノロジーズ， インコーポレイテッド Novel CRISPR DNA targeting enzymes and systems
EP4100053A4 (en) * 2020-02-06 2024-03-20 Mammoth Biosciences, Inc. Compositions and methods for detection of coronavirus
CN112301016B (en) * 2020-07-23 2023-09-08 广州美格生物科技有限公司 Application of novel mlCas12a protein in nucleic acid detection
CN112195164B (en) * 2020-12-07 2021-04-23 中国科学院动物研究所 Engineered Cas effector proteins and methods of use thereof
CN113373130B (en) * 2021-05-31 2023-12-22 复旦大学 Cas12 protein, gene editing system containing Cas12 protein and application
CN113717962A (en) * 2021-09-10 2021-11-30 武汉艾迪晶生物科技有限公司 Cas phi-2 protein for rice gene editing and expression cassette and expression vector thereof
CN114438055B (en) * 2021-10-26 2022-08-26 山东舜丰生物科技有限公司 Novel CRISPR enzymes and systems and uses

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016205764A1 (en) * 2015-06-18 2016-12-22 The Broad Institute Inc. Novel crispr enzymes and systems
CN111757889A (en) * 2018-10-29 2020-10-09 中国农业大学 Novel CRISPR/Cas12f enzymes and systems
CN113106081A (en) * 2018-10-29 2021-07-13 中国农业大学 Novel CRISPR/Cas12f enzymes and systems
US20210238567A1 (en) * 2019-03-07 2021-08-05 The Regents Of The University Of California Crispr-cas effector polypeptides and methods of use thereof
WO2021067788A1 (en) * 2019-10-03 2021-04-08 Artisan Development Labs, Inc. Crispr systems with engineered dual guide nucleic acids
CN111690773A (en) * 2020-06-17 2020-09-22 山东舜丰生物科技有限公司 Method and system for detecting target nucleic acid by using novel Cas enzyme
CN113337502A (en) * 2020-09-25 2021-09-03 山东舜丰生物科技有限公司 gRNA and its use

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AARON A SMARGON ET AL.: "RNA-targeting CRISPR systems from metagenomic discovery to transcriptomic engineering", 《NATURE CELL BIOLOGY》 *
DAVID BURSTEIN ET AL.: "New CRISPR-Cas systems from uncultivated microbes", 《NATURE》 *
PAUSCH,P. ET AL.: "ACCESSION NO：7LYS_A，Chain A, CasPhi-2", 《GENBANK》 *
朱晓菲 等: "Class2 CRISPR-Cas系统发掘及分析方法", 《热带生物学报》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115992115A (en) * 2021-10-26 2023-04-21 山东舜丰生物科技有限公司 Novel CRISPR enzymes and systems and uses
CN115992115B (en) * 2021-10-26 2023-09-01 山东舜丰生物科技有限公司 Novel CRISPR enzymes and systems and uses
WO2024041299A1 (en) * 2022-08-25 2024-02-29 山东舜丰生物科技有限公司 Mutated crispr-cas protein and use thereof
CN115725543A (en) * 2022-10-25 2023-03-03 山东舜丰生物科技有限公司 CRISPR enzymes and systems

Also Published As

Publication number Publication date
CN117050972A (en) 2023-11-14
CN114438055B (en) 2022-08-26
WO2023071934A1 (en) 2023-05-04
CN115992115B (en) 2023-09-01
CN115992115A (en) 2023-04-21

Similar Documents

Publication Publication Date Title
CN114672473B (en) Optimized Cas protein and application thereof
CN113881652B (en) Novel Cas enzymes and systems and applications
CN114517190B (en) CRISPR enzymes and systems and uses
CN114410609B (en) Cas protein with improved activity and application thereof
CN114438055B (en) Novel CRISPR enzymes and systems and uses
CN114507654B (en) Cas enzymes and systems and applications
CN116004573B (en) Cas protein with improved editing activity and application thereof
CN117106752A (en) Optimized Cas12 proteins and uses thereof
CN116286739A (en) Mutant Cas proteins and uses thereof
CN114277015A (en) Novel CRISPR enzymes and uses
WO2024041299A1 (en) Mutated crispr-cas protein and use thereof
CN117070498B (en) Mutant CRISPR-Cas proteins and uses thereof
CN116555225B (en) Cas proteins with improved activity and uses thereof
WO2023174249A1 (en) Cas protein having improved activity and use thereof
WO2023173682A1 (en) Optimized cas protein and use thereof
CN117821424B (en) Optimized IscB protein and application thereof
WO2023143150A1 (en) Novel cas enzyme and system and use
WO2023231456A1 (en) Optimized cas protein and use thereof
CN116790559B (en) HNH domain-fused V-type Cas enzyme and application thereof
WO2024008145A1 (en) Cas enzyme and use thereof
WO2024040874A1 (en) Mutated cas12j protein and use thereof
CN115851666A (en) Novel Cas enzymes and systems and uses
CN117286123A (en) Optimized Cas protein and application thereof
CN117050971A (en) Cas muteins and uses thereof
CN118147110A (en) Mutant Cas proteins and uses thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant