CN113337502A - gRNA and its use - Google Patents

Abstract

The invention belongs to the field of nucleic acid editing, and particularly relates to the technical field of regularly clustered spaced short palindromic repeats (CRISPR). In particular, the invention provides a gRNA that can increase the efficiency of Cas enzymes.

Description

gRNA and its use

Technical Field

The present invention relates to the field of nucleic acid editing, in particular to the technical field of regularly clustered interspaced short palindromic repeats (CRISPR). Specifically, the invention relates to a gRNA and application thereof, and particularly relates to a gRNA suitable for a Cas12 protein family and application thereof.

Background

The CRISPR/Cas technology is a widely used gene editing technology, which specifically binds to a target sequence on a genome and cleaves DNA to generate double-strand break through RNA guide, and performs site-directed gene editing by using bionon-homologous end joining or homologous recombination.

The CRISPR/Cas9 system is the most commonly used type II CRISPR system, which recognizes the PAM motif of 3' -NGG, performing blunt-end cleavage of the target sequence. The CRISPR/Cas Type V system is a newly discovered Type of CRISPR system in recent two years, which has a motif of 5' -TTN, with sticky end cleavage of the target sequence, e.g. Cpf1, C2C1, CasX, CasY. However, the different CRISPRs/Cas currently available have different advantages and disadvantages. For example, Cas9, C2C1 and CasX all require two RNAs for guide RNA, whereas Cpf1 requires only one guide RNA and can be used for multiple gene editing. CasX has a size of 980 amino acids, while the common Cas9, C2C1, CasY and Cpf1 are typically around 1300 amino acids in size. In addition, the PAM sequences of Cas9, Cpf1, CasX, and CasY are complex and diverse, while C2C1 recognizes the stringent 5' -TTN, so its target site is easily predicted than other systems to reduce potential off-target effects.

In order to improve the editing efficiency of the Cas enzyme, the inventor of the application optimizes the gRNA, particularly a framework region combining the gRNA and the Cas enzyme, and obtains the gRNA capable of improving the editing efficiency of the Cas enzyme.

Disclosure of Invention

Through a large number of experiments and repeated groping, the inventor of the application discovers the gRNA capable of improving the editing efficiency of the Cas enzyme.

In one aspect, the invention provides a direct repeat sequence for constructing a gRNA, the direct repeat sequence comprising a sequence as set forth in any one of SEQ ID nos. 2-5; preferably, the direct repeat sequence is shown in any one of SEQ ID No. 2-5.

In another aspect, the present invention provides a gRNA that includes a targeting sequence for a targeting nucleic acid and the direct repeat sequence described above.

In another aspect, the invention provides a nucleic acid encoding the gRNA; and nucleic acids encoding the direct repeats.

The invention also provides precursor RNA of the gRNA and nucleic acid encoding the precursor RNA.

In another aspect, the invention provides a composition or CRISPR/Cas system comprising a Cas protein and the above-described gRNA.

In another aspect, the present invention also provides a vector system, which may include one or more vectors, the one or more vectors including:

a) a first regulatory element operably linked to the gRNA,

b) a second regulatory element operably linked to a Cas protein;

wherein components (a) and (b) are on the same or different carriers.

Preferably, the Cas protein is selected from Cas12i.

In another aspect, the invention provides an activated CRISPR complex comprising a gRNA as described above, a Cas protein, and a target nucleic acid bound to the gRNA.

Preferably, the binding is via a targeting sequence of a targeting nucleic acid on the gRNA to the target nucleic acid.

On the other hand, the invention also provides application of the gRNA in improving Cas protein editing efficiency, or application in preparing a reagent for improving Cas protein editing efficiency. In one embodiment, the editing is intracellular and/or extracellular editing of a gene or genome by a Cas protein.

On the other hand, the invention also provides application of the gRNA in improving the cleavage activity of the Cas protein trans, or application in preparing a reagent for improving the cleavage activity of the Cas protein trans.

On the other hand, the invention also provides application of the gRNA in improving the efficiency of nonspecific single-stranded nucleic acid cleavage of the Cas protein, or application in preparing a reagent for improving the efficiency of nonspecific single-stranded nucleic acid cleavage of the Cas protein.

On the other hand, the invention also provides application of the gRNA in improving the efficiency of the target nucleic acid specific cleavage by the Cas protein, or application in preparing a reagent for improving the efficiency of the target nucleic acid specific cleavage by the Cas protein.

In another aspect, the invention also provides a method of increasing the efficiency of Cas protein-specific cleavage of a target nucleic acid, comprising cleaving the target nucleic acid using the Cas protein and the gRNA described above.

In another aspect, the invention also provides a method of increasing efficiency of Cas protein gene editing, comprising gene editing using the Cas protein and the gRNA. In one embodiment, the gene editing is the editing of a gene or genome within a cell and/or outside of a cell.

The invention also provides application of the gRNA, the composition, the CIRCR/Cas system, the vector system or the activated CRISPR complex in gene editing, gene targeting or gene cutting. In one embodiment, the gene editing and/or gene targeting is gene editing, gene targeting or gene cleavage inside and/or outside the cell.

The invention also provides a method of editing, targeting, or cleaving a target nucleic acid, comprising contacting the target nucleic acid with the gRNA, the composition, the CIRSPR/Cas system, the vector system, or the activated CRISPR complex. In one embodiment, the method is editing, targeting, or cleaving a target nucleic acid inside or outside the cell.

The gene editing or editing target nucleic acids include modifying genes, knocking out genes, altering expression of gene products, repairing mutations, and/or inserting polynucleotides, gene mutations.

The editing can be performed in prokaryotic cells and/or eukaryotic cells.

In another aspect, the invention also provides the application of the gRNA, the composition, the CIRSPR/Cas system, the vector system, or the activated CRISPR complex in nucleic acid detection.

In another aspect, the invention also provides a method of cleaving single-stranded nucleic acid, the method comprising contacting a nucleic acid population with the Cas protein and the grnas described above, wherein the nucleic acid population comprises a target nucleic acid and a plurality of non-target single-stranded nucleic acids, the Cas protein cleaving the plurality of non-target single-stranded nucleic acids.

The contacting may be in vitro, ex vivo, or inside a cell in vivo.

Preferably, the cleaved single-stranded nucleic acid is non-specific cleavage.

In another aspect, the invention also provides the use of the gRNA, the composition, the CIRSPR/Cas system, the vector system, or the activated CRISPR complex for non-specific cleavage of single-stranded nucleic acids.

In another aspect, the present invention also provides a kit for gene editing, which includes the above gRNA and Cas protein.

In another aspect, the present invention also provides a kit for detecting a target nucleic acid in a sample, the kit comprising: (a) a guide RNA, or a nucleic acid encoding the guide RNA, or a precursor RNA comprising the guide RNA, or a nucleic acid encoding the precursor RNA; (b) a Cas protein, or a nucleic acid encoding the Cas protein; and (c) a single-stranded nucleic acid detector that is single-stranded and does not hybridize to the guide RNA.

It is known in the art that precursor RNAs can be cleaved or processed into mature guide RNAs as described above.

In another aspect, the invention provides the use of the gRNA described above, the composition described above, the CIRSPR/Cas system described above, the vector system described above, or the activated CRISPR complex described above, in the preparation of a formulation for:

(i) gene or genome editing;

(ii) target nucleic acid detection and/or diagnosis;

(iii) editing a target sequence in a target locus to modify an organism or non-human organism;

(iv) treatment of diseases;

(iv) target genes are targeted.

Preferably, the gene or genome editing is carried out intracellularly or extracellularly.

Preferably, the target nucleic acid detection and/or diagnosis is in vitro.

Preferably, the treatment of the disease is the treatment of a condition caused by a defect in the target sequence in the target locus.

In another aspect, the invention provides a method of detecting a target nucleic acid in a sample, the method comprising contacting the sample with the Cas protein, a gRNA (guide RNA) comprising a region that binds to the Cas protein and a guide sequence that hybridizes to the target nucleic acid, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein-cleaved single-stranded nucleic acid detector, thereby detecting a target nucleic acid; the single-stranded nucleic acid detector does not hybridize to the gRNA.

Detailed Description

Guide RNA (guide RNA, gRNA)

In one aspect, the present invention provides a gRNA comprising a first segment and a second segment; the first segment is also referred to as "framework region", "protein binding segment", "protein binding sequence", or "Direct Repeat (Direct Repeat) sequence"; the second segment is also referred to as a "targeting sequence for a targeting nucleic acid" or a "targeting segment for a targeting nucleic acid".

The targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid of the invention comprises a nucleotide sequence that is complementary to a sequence in the target nucleic acid. In other words, the targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid of the present invention interacts in a sequence-specific manner with the target nucleic acid upon hybridization (i.e., base pairing). Thus, the targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid may be altered or modified to hybridize to any desired sequence within the target nucleic acid. The nucleic acid is selected from DNA or RNA.

The percent complementarity between the targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid and the target sequence of the target nucleic acid can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%).

The "framework region", "protein-binding segment", "protein-binding sequence", or "direct repeat" of a gRNA of the invention can interact with a CRISPR protein (or, Cas protein). The gRNA of the invention directs its interacting Cas protein to a specific nucleotide sequence within a target nucleic acid through the action of a targeting sequence of the targeting nucleic acid.

Preferably, the guide RNA comprises a first segment and a second segment in the 5 'to 3' direction.

In the context of the present invention, the second segment is also understood to be a leader sequence which hybridizes to the target sequence.

In another aspect, the present invention provides a direct repeat sequence; the direct repeat sequence can interact with a Cas protein; connecting the direct repeated sequence and the guide sequence to form gRNA; the guide RNA composed of the direct repeat sequence improves the editing efficiency of the Cas protein of the present invention.

In the present invention, the targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid is preferably a targeting sequence of the targeting DNA or a targeting segment of the targeting DNA.

Cas effector protein

The Cas protein of the present invention is an effector protein in a CRISPR/Cas system; the Cas protein is preferably a V-type Cas protein, including, but not limited to, Cas12i, Cas12j, Cas12a, Cas12 b; preferably, the Cas protein is Cas12i.

In one embodiment, the Cas protein amino acid sequence has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID No.1 and substantially retains the biological function of SEQ ID No. 1.

The biological functions of the sequences include, but are not limited to, the activity of binding to a guide RNA, the activity of an endonuclease, the activity of binding to a specific site of a target sequence under the guidance of a guide RNA and cleavage.

Biological functions of the sequences include, but are not limited to, Cis cleavage activity and Trans cleavage activity.

The biological functions of the sequences include, but are not limited to, endonucleases that bind to and cleave at specific sites of the target sequence under the guidance of a guide RNA, while possessing both DNA and RNA endonuclease activity.

In one embodiment, the Cas protein contains SEQ ID NO: 1.

In one embodiment, the Cas protein sequence is SEQ ID NO: 1.

In one embodiment, the Cas protein is a protein that hybridizes to a polypeptide having the sequence of SEQ ID NO: 1, and a derivative protein having the same biological function as the protein having the sequence shown in 1.

CRISPR/Cas system

In another aspect, the invention provides a CRISPR/Cas system comprising a Cas protein and one or more guide RNAs; the one or more guide RNAs may target one or more target sequences.

The present invention also provides a vector system, which may include one or more vectors, the one or more vectors including:

a) a first regulatory element operably linked to a guide RNA,

b) a second regulatory element operably linked to a Cas protein;

wherein components (a) and (b) are on the same or different carriers.

In one embodiment, the first and second regulatory elements are promoters, e.g., inducible promoters.

In one embodiment, the Cas protein has one or more NLS sequences attached thereto. In one embodiment, the NLS sequence is linked to the N-terminus or C-terminus of the protein. In other embodiments, the NLS sequence is fused to the N-terminus or C-terminus of the protein.

Composition comprising a metal oxide and a metal oxide

In another aspect, the invention also provides a composition comprising a Cas protein of the invention and a gRNA.

The Cas protein and gRNA associate with each other to form a complex.

In another aspect, the invention also provides an activated CRISPR complex comprising a gRNA as described above, a Cas protein, and a target nucleic acid bound on the gRNA.

The binding is through the binding of a targeting sequence of a targeting nucleic acid on the gRNA to the target nucleic acid.

The activated CRISPR complex, the gRNA, once bound to the target nucleic acid, can activate the trans cleavage activity of the Cas protein, thereby non-specifically cleaving any single-stranded nucleic acid.

The single-stranded nucleic acid may be single-stranded DNA, single-stranded RNA, a single-stranded DNA-RNA hybrid, or the single-stranded nucleic acid may further comprise a nucleic acid analog.

Use of

On the other hand, the invention also provides application of the gRNA in improving Cas protein editing efficiency, or application in preparing a reagent for improving Cas protein editing efficiency. In one embodiment, the editing is that the Cas protein edits a gene or genome within the cell.

On the other hand, the invention also provides application of the gRNA in improving the cleavage activity of the Cas protein trans, or application in preparing a reagent for improving the cleavage activity of the Cas protein trans.

On the other hand, the invention also provides application of the gRNA in improving the efficiency of nonspecific single-stranded nucleic acid cleavage of the Cas protein, or application in preparing a reagent for improving the efficiency of nonspecific single-stranded nucleic acid cleavage of the Cas protein.

In another aspect, the invention also provides a method of increasing the efficiency of gene editing of a Cas protein in a cell, the method comprising gene editing the Cas protein and the gRNA in a cell.

The invention also provides application of the gRNA, the composition, the CIRCR SPR/Cas system, the vector system or the activated CRISPR complex in gene editing and/or gene targeting.

The present invention also provides a method of editing and/or targeting a target nucleic acid comprising contacting the target nucleic acid with the gRNA described above, the composition described above, the CIRSPR/Cas system described above, the vector system described above, or the activated CRISPR complex described above.

The gene editing or editing target nucleic acids include modifying genes, knocking out genes, altering expression of gene products, repairing mutations, and/or inserting polynucleotides, gene mutations.

The editing can be performed in prokaryotic cells and/or eukaryotic cells.

In another aspect, the invention also provides the application of the gRNA, the composition, the CIRSPR/Cas system, the vector system, or the activated CRISPR complex in nucleic acid detection.

In another aspect, the invention also provides a method of cleaving single-stranded nucleic acid, the method comprising contacting a nucleic acid population with the Cas protein and the grnas described above, wherein the nucleic acid population comprises a target nucleic acid and a plurality of non-target single-stranded nucleic acids, the Cas protein cleaving the plurality of non-target single-stranded nucleic acids.

The contacting may be in vitro, ex vivo, or inside a cell in vivo.

Preferably, the cleaved single-stranded nucleic acid is non-specific cleavage.

In another aspect, the invention also provides the use of the gRNA, the composition, the CIRSPR/Cas system, the vector system, or the activated CRISPR complex for non-specific cleavage of single-stranded nucleic acids.

In another aspect, the present invention also provides a kit for gene editing, which includes the above gRNA and Cas protein.

In another aspect, the present invention also provides a kit for detecting a target nucleic acid in a sample, the kit comprising: (a) a guide RNA, or a nucleic acid encoding the guide RNA, or a precursor RNA comprising the guide RNA, or a nucleic acid encoding the precursor RNA; (b) a Cas protein, or a nucleic acid encoding the Cas protein; and (c) a single-stranded nucleic acid detector that is single-stranded and does not hybridize to the guide RNA.

In another aspect, the invention provides the use of the gRNA described above, the composition described above, the CIRSPR/Cas system described above, the vector system described above, or the activated CRISPR complex described above, in the preparation of a formulation for:

(i) gene or genome editing;

(ii) target nucleic acid detection and/or diagnosis;

(iii) editing a target sequence in a target locus to modify an organism or non-human organism;

(iv) treatment of diseases;

(iv) target genes are targeted.

Preferably, the gene or genome editing is gene or genome editing in a cell.

Preferably, the target nucleic acid detection and/or diagnosis is in vitro.

Preferably, the treatment of the disease is the treatment of a condition caused by a defect in the target sequence in the target locus.

In some embodiments, the disorder or disease is cancer or an infectious disease. For example, the cancer may be selected from Wilms 'tumor, Ewing's sarcoma, neuroendocrine tumor, glioblastoma, neuroblastoma, melanoma, skin cancer, breast cancer, colon cancer, rectal cancer, prostate cancer, liver cancer, kidney cancer, pancreatic cancer, lung cancer, biliary tract cancer, cervical cancer, endometrial cancer, esophageal cancer, gastric cancer, head and neck cancer, medullary thyroid cancer, ovarian cancer, glioma, lymphoma, leukemia, myeloma, acute lymphocytic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, hodgkin's lymphoma, non-hodgkin's lymphoma, and bladder cancer.

In another aspect, the invention provides a method of detecting a target nucleic acid in a sample, the method comprising contacting the sample with the Cas protein, a gRNA (guide RNA) comprising a region that binds to the Cas protein and a guide sequence that hybridizes to the target nucleic acid, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein-cleaved single-stranded nucleic acid detector, thereby detecting a target nucleic acid; the single-stranded nucleic acid detector does not hybridize to the gRNA.

In the present invention, the detectable signal is realized by: vision-based detection, fluorescence signal-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase transition/dispersion, electrochemical detection, and semiconductor-based detection.

In some embodiments, the methods of the invention further comprise the step of measuring a detectable signal produced by the CRISPR/CAS effector protein (CAS protein). The Cas protein, upon recognition or hybridization to the target nucleic acid, can activate the cleavage activity of single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector and thereby generating a detectable signal.

In the present invention, the detectable signal may be any signal generated when the single-stranded nucleic acid detector is cleaved. For example, detection based on gold nanoparticles, fluorescence polarization, colloidal phase transition/dispersion, electrochemical detection, semiconductor-based sensing. The detectable signal may be read by any suitable means, including but not limited to: measurement of a detectable fluorescent signal, gel electrophoresis detection (by detecting a change in a band on the gel), detection of the presence or absence of a color based on vision or a sensor, or a difference in the presence of a color (e.g., based on gold nanoparticles) and a difference in an electrical signal.

In a preferred embodiment, the detectable signal is achieved by: the 5 'end and the 3' end of the single-stranded nucleic acid detector are respectively provided with different reporter groups, and when the single-stranded nucleic acid detector is cut, a detectable reporter signal can be shown; for example, a single-stranded nucleic acid detector having a fluorophore and a quencher disposed at opposite ends thereof, when cleaved, can exhibit a detectable fluorescent signal.

In one embodiment, the fluorescent group is selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC Red 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

In other embodiments, the detectable signal may also be achieved by: the 5 'end and the 3' end of the single-stranded nucleic acid detector are respectively provided with different marker molecules, and a reaction signal is detected in a colloidal gold detection mode.

In one embodiment, the target nucleic acid comprises DNA, RNA, preferably single-stranded nucleic acid or double-stranded nucleic acid or nucleic acid modification.

In one embodiment, the target nucleic acid is derived from a sample of a virus, bacterium, microorganism, soil, water source, human, animal, plant, or the like. Preferably, the target nucleic acid is a product enriched or amplified by PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM and the like.

In one embodiment, the method further comprises the step of obtaining the target nucleic acid from the sample.

In one embodiment, the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a specific nucleic acid associated with a disease, such as a specific mutation site or SNP site or a nucleic acid that is different from a control; preferably, the virus is a plant virus or an animal virus, e.g., papilloma virus, hepatic DNA virus, herpes virus, adenovirus, poxvirus, parvovirus, coronavirus; preferably, the virus is a coronavirus, preferably SARS, SARS-CoV2(COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, Mers-CoV.

In some embodiments, the target nucleic acid is derived from a cell, e.g., from a cell lysate.

In some embodiments, the measurement of the detectable signal may be quantitative, and in other embodiments, the measurement of the detectable signal may be qualitative.

Preferably, the single stranded nucleic acid detector produces a first detectable signal prior to cleavage by the Cas protein and produces a second detectable signal different from the first detectable signal after cleavage.

In other embodiments, the single-stranded nucleic acid detector comprises one or more modifications, such as base modifications, backbone modifications, sugar modifications, and the like, to provide new or enhanced features (e.g., improved stability) to the nucleic acid. Examples of suitable modifications include modified nucleic acid backbones and non-natural internucleoside linkages, and nucleic acids having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Suitable modified oligonucleotide backbones containing phosphorus atoms therein include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates. In some embodiments, the single stranded nucleic acid detector comprises one or more phosphorothioate and/or heteroatomic nucleotide linkages. In other embodiments, the single stranded nucleic acid detector can be a nucleic acid mimetic; in certain embodiments, the nucleic acid mimetics are Peptide Nucleic Acids (PNAs), another class of nucleic acid mimetics is based on linked morpholino units having a heterocyclic base attached to a morpholino ring (morpholino nucleic acids), and other nucleic acid mimetics further include cyclohexenyl nucleic acids (CENAs), further including ribose or deoxyribose chains.

The cells of the invention are selected from the group consisting of: prokaryotic or eukaryotic cells, for example, archaeal cells, bacterial cells, eukaryotic unicellular organisms, somatic cells, germ cells, stem cells, plant cells, algal cells, animal cells, invertebrate cells, vertebrate cells, fish cells, frog cells, bird cells, mammalian cells, pig cells, cow cells, goat cells, sheep cells, rodent cells, rat cells, mouse cells, non-human primate cells, and human cells.

In some cases, the gene or genome may be modified by introduction of the gene editing methods of the invention into a cell, such that the cell and its progeny are altered. Preferably, the cell or progeny thereof obtained by the method described above, wherein said cell contains a modification not present in its wild type.

In one embodiment, the cell is a prokaryotic cell.

In one embodiment, the cell is a eukaryotic cell.

In one embodiment, the cell is a mammalian cell.

In one embodiment, the cell is a human cell. In certain embodiments, the cell is a non-human mammalian cell, e.g., a cell of a non-human primate, bovine, ovine, porcine, canine, monkey, rabbit, rodent (e.g., rat or mouse).

In one embodiment, the cell is a non-mammalian eukaryotic cell, such as a cell of a poultry bird (e.g., chicken), fish, or crustacean (e.g., clam, shrimp).

In one embodiment, the cell is a plant cell; preferably, the plant is a monocotyledon or dicotyledon; including but not limited to arabidopsis, tobacco, rice, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, canola, cabbage, strawberry.

In one embodiment, the cell is a stem cell or stem cell line.

Definition of terms

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings that are commonly understood by those skilled in the art. Also, the procedures of molecular genetics, nucleic acid chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics, and recombinant DNA, etc., used herein, are all conventional procedures widely used in the corresponding field. Meanwhile, in order to better understand the present invention, the definitions and explanations of related terms are provided below.

Cas protein

In the present invention, the expression "Cas protein" refers to a CRISPR protein; in a preferred embodiment, it has an amino acid sequence selected from the group consisting of:

(i) SEQ ID NO: 1;

(ii) and SEQ ID NO: 1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, deletions, or additions) compared to the sequence of (a); or

(iii) And SEQ ID NO: 1, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity.

As used herein, the terms "Cas effector protein", "Cas protein" are used interchangeably.

CRISPR system

As used herein, the terms "regularly clustered short palindromic repeats (CRISPR) -CRISPR-associated (Cas) (CRISPR-Cas) system" or "CRISPR system" are used interchangeably and have the meaning generally understood by those skilled in the art, which generally comprise a transcript or other element that is associated with the expression of a CRISPR-associated ("Cas") gene, or a transcript or other element that is capable of directing the activity of said Cas gene.

Guide RNA (guide RNA, gRNA)

As used herein, the terms "guide rna (guide rna)", "mature crRNA", "guide sequence" are used interchangeably and have the meaning commonly understood by those skilled in the art. In general, the guide RNA may comprise, consist essentially of, or consist of a direct repeat (direct repeat) and a guide sequence (also referred to as a spacer (spacer) in the context of an endogenous CRISPR system).

In certain instances, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence to hybridize to the target sequence and direct specific binding of the CRISPR/Cas complex to the target sequence. In one embodiment, the degree of complementarity between a guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%, when optimally aligned. Determining the optimal alignment is within the ability of one of ordinary skill in the art. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, the Smith-Waterman algorithm in matlab (Smith-Waterman), Bowtie, Geneius, Biopython, and SeqMan.

In the context of forming a CRISPR/Cas complex, a "target sequence" refers to a polynucleotide targeted by a guide sequence that is designed to be targeted, e.g., a sequence that is complementary to the guide sequence, wherein hybridization between the target sequence and the guide sequence will promote formation of the CRISPR/Cas complex. Complete complementarity is not necessary as long as there is sufficient complementarity to cause hybridization and promote formation of a CRISPR/Cas complex. The target sequence may comprise any polynucleotide, such as DNA or RNA. In some cases, the target sequence is located intracellularly or extracellularly. In some cases, the target sequence is located in the nucleus or cytoplasm of the cell. In some cases, the target sequence may be located within an organelle of the eukaryotic cell, such as a mitochondrion or chloroplast. Sequences or templates that can be used for recombination into a target locus containing the target sequence are referred to as "editing templates" or "editing polynucleotides" or "editing sequences". In one embodiment, the editing template is an exogenous nucleic acid. In one embodiment, the recombination is homologous recombination.

Single-stranded nucleic acid detector

The single-stranded nucleic acid detector of the present invention refers to a sequence containing 2 to 200 nucleotides, preferably, 2 to 150 nucleotides, preferably, 3 to 100 nucleotides, preferably, 3 to 30 nucleotides, preferably, 4 to 20 nucleotides, and more preferably, 5 to 15 nucleotides. Preferably a single-stranded DNA molecule, a single-stranded RNA molecule or a single-stranded DNA-RNA hybrid.

The single-stranded nucleic acid detector comprises different reporter groups or marker molecules at both ends, and does not present a reporter signal when in an initial state (i.e., an uncleaved state), and presents a detectable signal when the single-stranded nucleic acid detector is cleaved, i.e., presents a detectable difference after cleavage from before cleavage. In the present invention, if a detectable difference can be detected, it is reflected that the target nucleic acid contains a characteristic sequence to be detected; alternatively, if the detectable difference is not detectable, it indicates that the target nucleic acid does not contain the signature sequence to be detected.

Wild type

As used herein, the term "wild-type" has the meaning commonly understood by those skilled in the art to mean a typical form of an organism, strain, gene, or characteristic that, when it exists in nature, is distinguished from a mutant or variant form, which may be isolated from a source in nature and which has not been intentionally modified by man.

Carrier

The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid molecule to which it is linked. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules comprising one or more free ends, free ends (e.g., circular); nucleic acid molecules comprising DNA, RNA, or both; and other various polynucleotides known in the art. The vector may be introduced into a host cell by transformation, transduction, or transfection, and the genetic material elements carried thereby are expressed in the host cell. A vector can be introduced into a host cell to thereby produce a transcript, protein, or peptide, including from a protein, fusion protein, isolated nucleic acid molecule, etc. (e.g., a CRISPR transcript, such as a nucleic acid transcript, protein, or enzyme) as described herein. A vector may contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may contain a replication initiation site.

One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, for example, by standard molecular cloning techniques.

Another type of vector is a viral vector, in which the virus-derived DNA or RNA sequences are present in a vector for packaging of viruses (e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno-associated viruses). Viral vectors also comprise polynucleotides carried by viruses for transfection into a host cell. Certain vectors (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors) are capable of autonomous replication in a host cell into which they are introduced.

Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors".

Host cell

As used herein, the term "host cell" refers to a cell that can be used to introduce a vector, and includes, but is not limited to, prokaryotic cells such as Escherichia coli or Bacillus subtilis, eukaryotic cells such as microbial cells, fungal cells, animal cells, and plant cells.

One skilled in the art will appreciate that the design of an expression vector may depend on factors such as the choice of host cell to be transformed, the level of expression desired, and the like.

Regulatory element

As used herein, the term "regulatory element" is intended to include promoters, enhancers, Internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences), which are described in detail with reference to gordel (Goeddel), "gene expression technology: METHODS IN ENZYMOLOGY (GENE EXPRESSION TECHNOLOGY: METHOD IN ENZYMOLOGY)185, Academic Press, San Diego, Calif. (1990). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells as well as those sequences that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters may primarily direct expression in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, a particular organ (e.g., liver, pancreas), or a particular cell type (e.g., lymphocyte). In certain instances, the regulatory element may also direct expression in a time-dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue or cell type specific. In certain instances, the term "regulatory element" encompasses enhancer elements, such as WPRE; a CMV enhancer; the R-U5' fragment in the LTR of HTLV-I ((mol. cell. biol., Vol.8 (1), pp.466-472, 1988); the SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β -globin (Proc. Natl. Acad. Sci. USA., Vol.78 (3), pp.1527-31, 1981).

Promoters

As used herein, the term "promoter" has a meaning well known to those skilled in the art and refers to a non-coding nucleotide sequence located upstream of a gene that promotes expression of a downstream gene. Constitutive (constitutive) promoters are nucleotide sequences that: when operably linked to a polynucleotide that encodes or defines a gene product, it results in the production of the gene product in the cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide that encodes or defines a gene product, causes the gene product to be produced intracellularly substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that: when operably linked to a polynucleotide that encodes or defines a gene product, it results in the production of the gene product in the cell substantially only when the cell is of the tissue type to which the promoter corresponds.

NLS

A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein for introduction into the nucleus by nuclear transport, i.e., a protein with NLS is transported to the nucleus. Typically, NLS contains positively charged Lys or Arg residues exposed at the surface of the protein. Exemplary nuclear localization sequences include, but are not limited to, NLS from: SV40 Large T antigen, EGL-13, c-Myc and TUS protein.

Is operably connected to

As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).

Complementarity

As used herein, the term "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence by means of a conventional watson-crick or other unconventional type. Percent complementarity refers to the percentage of residues (e.g., 5, 6, 7, 8, 9, 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary) in a nucleic acid molecule that can form hydrogen bonds (e.g., watson-crick base pairing) with a second nucleic acid sequence. "completely complementary" means that all consecutive residues of one nucleic acid sequence hydrogen bond with the same number of consecutive residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids that hybridize under stringent conditions.

Stringent conditions

As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes to the target sequence and does not substantially hybridize to non-target sequences. Stringent conditions are generally sequence dependent and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described In Tijssen (1993) Laboratory technology In biochemistry and Molecular Biology-Nucleic Acid Probe Hybridization (Laboratory Techniques In biochemistry-Hybridization With Nucleic Acid Probes), section I, chapter II, "brief description of Hybridization principles and Nucleic Acid Probe analysis strategy" ("Overview of Hybridization and Hybridization analysis of Nucleic Acid probe assay"), Emei (Elissevier), New York.

Hybridization of

As used herein, the term "hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding of bases between the nucleotide residues. Hydrogen bonding can occur by means of watson-crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination of these. The hybridization reaction may constitute a step in a broader process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. Sequences that are capable of hybridizing to a given sequence are referred to as "complements" of the given sequence.

Expression of

As used herein, the term "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcript) and/or the process by which transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. The transcripts and encoded polypeptides may be collectively referred to as "gene products". If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells.

Joint

As used herein, the term "linker" refers to a linear polypeptide formed from a plurality of amino acid residues joined by peptide bonds. The linker of the present invention may be an artificially synthesized amino acid sequence, or a naturally occurring polypeptide sequence, such as a polypeptide having a hinge region function. Such linker polypeptides are well known in the art (see, e.g., Holliger, P. et al (1993) Proc. Natl. Acad. Sci. USA 90: 6444-.

Animal(s) production

For example, a mammal, such as a bovine, equine, ovine, porcine, canine, feline, lagomorph, rodent (e.g., mouse or rat), non-human primate (e.g., macaque or cynomolgus monkey), or human. In certain embodiments, the subject (e.g., human) has a disorder (e.g., a disorder resulting from a deficiency in a disease-associated gene).

Plant and method for producing the same

The term "plant" is to be understood as including any differentiated multicellular organism capable of photosynthesis, in including crop plants at any stage of maturity or development, in particular monocotyledonous or dicotyledonous plants, vegetable crops, including artichokes, corm cabbages, sesames, leeks, asparagus, lettuce (e.g. head lettuce, leaf lettuce), bok choy, yellow croaker, melons (e.g. melons, watermelons, crow's melon, honeydew melon, cantaloupe), rape crops (e.g. brussels sprouts, cabbage, cauliflower, broccoli, collards, headless cabbages, chinese cabbages, cephalanoplos, carrots, cabbage (napa), okra, onions, celery, chickpea, parsnip, endive, potato, cucurbits (e.g. zucchini, cucurbits, etc, Squash, pumpkin), radish, dried onion, turnip cabbage, purple eggplant (also called eggplant), salsify, endive, shallot, endive, garlic, spinach, green onion, squash, leafy vegetables (greens), beets (sugar and feed beets), sweet potato, lettuce, horseradish, tomato, turnip, and spices; fruit and/or vintage crops such as apple, apricot, cherry, nectarine, peach, pear, plum, prune, cherry, quince, almond, chestnut, hazelnut, pecan, pistachio, walnut, citrus, blueberry, boysenberry (boysenberry), raspberry, currant, loganberry, raspberry, strawberry, blackberry, grape, avocado, banana, kiwi, persimmon, pomegranate, pineapple, tropical fruit, pome, melon, mango, papaya, and lychee; field crops, such as clover, alfalfa, evening primrose, meadowfoam, corn/maize (fodder corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain crops (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, legumes (beans, lentils, peas, soybeans), oleaginous plants (oilseed rape, mustard, poppy, olives, sunflowers, coconut, castor oil plants, cocoa beans, groundnuts), arabidopsis, fibrous plants (cotton, flax, hemp, jute), lauraceae (cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plants; and/or bedding plants, such as flowering plants, cactus, fleshy plants and/or ornamental plants, and trees, such as forests (broad leaf and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other plantlets.

Advantageous effects of the invention

Compared with the prior art, the gRNA provided by the invention can improve the editing efficiency of Cas enzyme.

Embodiments of the present invention will be described in detail below with reference to the drawings and examples, but those skilled in the art will understand that the following drawings and examples are only for illustrating the present invention and do not limit the scope of the present invention. Various objects and advantageous aspects of the present invention will become apparent to those skilled in the art from the accompanying drawings and the following detailed description of the preferred embodiments.

Drawings

Figure 1 cleavage activity of Cas12i was detected using different grnas.

FIG. 2 shows the working principle of the YFP transient fluorescence detection system.

FIG. 3. efficiency of editing of different gRNAs in rice protoplasts; the leftmost picture is a positive control GFP expression vector, the middle picture is a gRNA-origin result, and the rightmost picture is a gRNA-optimized result.

FIG. 4 shows the structure of expression vector pCas12i.3.

Fig. 5 detection efficiency of different grnas in vitro nucleic acid detection with Cas12i.

Sequence information

SEQ ID NO:	Description of the invention
		1	Amino acid sequence of Cas12i protein
2	Direct repeat sequence of gRNA-A
		3	Direct repeat sequence of gRNA-U
4	Direct repeat sequence of gRNA-C
		5	Direct repeat sequence of gRNA-G
6	PCR amplification product
		7	Target nucleic acid for nucleic acid detection

Detailed Description

The invention will now be described with reference to the following examples, which are intended to illustrate the invention, but not to limit it.

Unless otherwise indicated, the experiments and procedures described in the examples were performed essentially according to conventional methods well known in the art and described in various references. For example, conventional techniques in immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA used in the present invention can be found in Sambrook (Sambrook), friesch (Fritsch), and manitis (manitis), molecular cloning: a LABORATORY Manual (Molecular CLONING: A Laboratory Manual), 2 nd edition (1989); a Current Manual of MOLECULAR BIOLOGY experiments (Current PROTOCOLS IN MOLECULAR BIOLOGY BIOLOGY) (edited by F.M. Otsubel et al, (1987)); METHODS IN ENZYMOLOGY (METHODS IN Enzymology) series (academic Press): PCR 2: practical methods (PCR 2: A PRACTICAL APPROACH) (m.j. macpherson, b.d. heims (b.d. hames) and g.r. taylor (g.r. taylor) editions (1995)), Harlow (Harlow) and la nei (Lane) editions (1988) antibodies: a LABORATORY Manual (ANTIBODIES, A LABORATORY MANUAL), and animal cell CULTURE (ANIMAL CELL CURTURE) (edited by R.I. Freyrnib (R.I. Freshney) (1987)).

In addition, those whose specific conditions are not specified in the examples are conducted under the conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available. The examples are given by way of illustration and are not intended to limit the scope of the invention as claimed. All publications and other references mentioned herein are incorporated by reference in their entirety.

Example 1 optimization of gRNA against Cas12 protein

In this embodiment, the gRNA for Cas12i (amino acid sequence shown in SEQ ID No. 1) was optimized; the above Cas12i protein is also described in patent application document WO2020088450a1 (the protein in this patent is numbered cas12f.4). WO2020088450A1 describes that the gRNA of Cas12f.4 has a direct repeat sequence of AGAGAAUGUGUGCAUAGUCACAC, and that Cas12f.4 exhibits cleavage activity in both human cell lines and maize protoplasts (as described in patent examples 4 to 5). In this example, in order to improve the editing efficiency of Cas12i, the sequences of grnas were optimized, and the optimized direct repeat sequences of different grnas are shown in the following table:

TABLE 1 direct repeat sequences of different types of gRNAs

gRNA type	Direct repeat sequence
		WT	AGAGAAUGUGUGCAUAGUCACAC (in same way as WO2020088450A1)
gRNA-A	AGAGAAUGUGUGCAUAGUCAACAC
		gRNA-U	AGAGAAUGUGUGCAUAGUCUACAC
gRNA-C	AGAGAAUGUGUGCAUAGUCCACAC
		gRNA-G	AGAGAAUGUGUGCAUAGUCGACAC

1. Design of target sequences

Amplifying a sequence shown as SEQ ID No.6 by PCR to obtain a PCR product; and selecting a target sequence of gRNA on the PCR product as follows: AUGCAGAGUUCACUUUUG, respectively; the gRNAs in Table 1 were used, and their direct repeats were ligated to the above-mentioned target sequence to obtain different gRNAs, and the direct repeats were placed at the 5' end of the target sequence.

2. Detection of cleavage efficiency of Cas12i by different gRNAs

Samples were loaded as follows except that different grnas in table 1 were added to each of 5 samples.

After the completion of the sample addition, the reaction was carried out at 37 ℃ for 30min, and then the protein was inactivated at 80 ℃ for 20 min.

After completion of the reaction, run the gel on a 2% PAGE gel, and the results are shown in FIG. 1: the top band is the PCR product that is not cleaved by Cas (as shown by CK), the full length is 613bp, the middle band and the bottom band are the products of the PCR product cleaved by Cas protein, about 400bp and about 210bp, respectively, which are expected in the design of target sequence. The rightmost lane is the PCR product control, only the top band, and very dark, no other miscellaneous bands, can prove the middle band and the lowest band is PCR product cutting and formation.

Comparing different lanes corresponding to different gRNAs, and performing cleavage reaction at the same time to obtain a final product with a deepest WT residual PCR product color of 19%; only 2% of PCR product of gRNA-A remained, 3% of PCR product of gRNA-U remained, 6% of PCR product of gRNA-C remained, and 9% of PCR product of gRNA-G remained. That is, optimized grnas-A, gRNA-U, gRNA-C and gRNA-G, when used with Cas12i for gene editing, can cause the entire CRISPR system to exhibit higher cleavage activity compared to WT-type grnas.

Example 2 Activity assay in Rice protoplasts Using gRNA-A

1. Construction of detection vectors

Constructing a fluorescence detection vector of the YFP transient expression system, wherein the detection principle is shown in figure 2, and after the gRNA position is edited, a fluorescence signal can be detected; if no double strand break and repair by homologous recombination occurs at the gRNA, there is no fluorescence.

2. Protoplast detection

Designing gRNA aiming at the YFP detection vector, and respectively synthesizing gRNA-origin and gRNA-optimized; wherein the sequences of the gRNA-origin and the gRNA-optimized are respectively as follows:

AGAGAAUGUGUGCAUAGUCACACCAGGCCTCCCTTTATCTCTATTA(gRNA-original)；

AGAGAAUGUGUGCAUAGUCAACACCAGGCCTCCCTTTATCTCTATTA

(gRNA-optimized)；

in this case, the direct repeats of the gRNA are underlined.

Constructing a knockout vector by using the two gRNAs, respectively extracting plasmids from the knockout vector, transferring the plasmids into rice protoplast cells, and performing dark culture at 37 ℃ for 24 hours. After the culture is finished, the supernatant is removed by centrifugation, and the protoplasts are collected.

3. Detecting fluorescence

The results are shown in FIG. 3, observed under fluorescence: the leftmost picture is a positive control GFP expression vector, and fluorescence signals indicate that fluorescence can be normally detected; the middle panel shows gRNA-origin as the signal of gRNA; the right-most picture gRNA-optimized is taken as a signal of the gRNA; the fluorescence signal in the rightmost panel was significantly stronger than in the middle panel, indicating that the improved gRNA-optimized can increase the efficiency of Cas12i protein editing in rice protoplasts compared to the gRNA-original.

Example 3 editing in Rice Using gRNA-A and Cas12i proteins

1. Vector construction

A binary knockout vector pCas12i.3 suitable for rice expression is constructed as shown in figure 4, wherein OsU6 is a rice U6 promoter, crRNA is a crRNA skeleton of Cas12i, ZmUbi is a maize ubiquitin promoter, Cas12i is started, two ends of a Cas12i gene are SV40 and VirD2 nuclear localization signals, NOS is a terminator, and the sequence of Cas12i is shown as SEQ ID No. 1.

Sequences of grnas (sequences shown in table 2) were artificially synthesized and inserted into pcas12i.3 vector. All vectors were confirmed for accuracy by Sanger sequencing.

TABLE 2 sequences of different gRNAs and corresponding Gene numbering

In this case, the underlined sequences represent direct repeats of the gRNA.

2. Transformation of rice

All binary vectors were transferred into conventional Agrobacterium EHA105 by freeze-thaw methods. The rice transformation receptor is Kitakaa. Specific experimental procedures were performed as reported in (Nishimura et al, 2007) et al. The callus was transferred to a selection medium containing 50mg/L hygromycin for selection two days after Agrobacterium infection. After 2 weeks of selection, the resistant calli were transferred directly to differentiation medium for differentiation. When the plantlet grows to 4-5cm long, transferring to rooting culture medium to induce rooting. After 10 days, opening the rooting box, hardening seedlings for 3 days, transferring the seedlings to nutrient soil, putting the nutrient soil into a greenhouse for growth, wherein the greenhouse condition is 28 ℃, the illumination is 12 hours, and the darkness is 12 hours at 22 ℃.

3. Target site genotype detection

Leaf DNA of all transgenic rice plants was extracted by CTAB method. Primers are designed at about 250bp of the upstream and downstream of the target site respectively, and the target site is amplified through PCR. The PCR product is recovered and directly sent to the company for sequencing. Sequencing results were analyzed by Sequencher software. Calculation of editing efficiency the editing efficiency at each locus is shown in table 3, as the number of plants producing base edits divided by the total number of transgenes.

TABLE 3 editing efficiency of gRNA1 and gRNA2

As can be seen from the above table, 11 independent transgenic lines were obtained at two sites for gRNA1 and gRNA2 designed for OsYSA and OsNAL1, respectively. The target region is amplified through PCR, and genotype identification is carried out through Sanger sequencing, so that 6 transgenic strains and 8 transgenic strains respectively have mutation at corresponding target sites, and the mutation efficiency is 54.55 percent and 72.73 percent respectively; that is, the gRNA1 and the gRNA2 can achieve high editing efficiency when performing gene editing of a plant with Cas12i.

In addition, corresponding gRNAs are designed by utilizing the homologous repetitive sequences (shown in table 1) of the gRNAs-A, gRNA-U, gRNA-C and the gRNA-G, and the genes of other targets of rice and maize and soybean are edited by utilizing Cas12i shown in SEQ ID No.1, so that the high editing efficiency is achieved.

Example 4 utilization of gRNA-A, gRNA-U, gRNA-C and gRNA-G to increase the trans cleavage activity of Cas12i and the efficiency of in vitro nucleic acid detection

Cas12i can exhibit non-specific, nicking activity (trans cleavage activity) for single-stranded nucleic acids in addition to Cis cleavage activity, and the trans cleavage activity of Cas12i can be used for detection or diagnosis of a target nucleic acid. For example, nucleic acid of a sample to be tested is obtained (target nucleic acid can be obtained by an amplification method), and then the gRNA paired with the target nucleic acid is used for guiding the Cas12i protein to recognize and bind on the target nucleic acid; subsequently, the Cas12i protein activates the nicking activity of the single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector in the system; the two ends of the single-stranded nucleic acid detector are respectively provided with a fluorescent group and a quenching group, and if the single-stranded nucleic acid detector is cut, fluorescence can be excited; in other embodiments, both ends of the single-stranded nucleic acid detector may be provided with a label capable of being detected by colloidal gold. In this embodiment, the efficiency of in vitro nucleic acid detection was compared between optimized grnas and wild-type grnas when used in combination with Cas12i.

In this example, the sequence of the target nucleic acid is shown in SEQ ID No. 7;

the amino acid sequence of the Cas12i utilized is shown in SEQ ID No. 1;

the single-stranded nucleic acid detector is FAM-TTCTT-BHQ 1;

the sequences of grnas are shown in the table below:

gRNA	sequence of
		WT	AGAGAAUGUGUGCAUAGUCACACAUGCAGAGUUCACUUUUG
A	AGAGAAUGUGUGCAUAGUCAACACAUGCAGAGUUCACUUUUG
		U	AGAGAAUGUGUGCAUAGUCUACACAUGCAGAGUUCACUUUUG
C	AGAGAAUGUGUGCAUAGUCCACACAUGCAGAGUUCACUUUUG
		G	AGAGAAUGUGUGCAUAGUCGACACAUGCAGAGUUCACUUUUG

In this case, the underlined sequences represent direct repeats of the gRNA.

The final concentration of Cas12i in the detection system is 50nM, the final concentration of gRNA is 50nM, the concentration of target nucleic acid is 50nM, and the final concentration of Reporter (single-stranded nucleic acid detector) is 200 nM; the reaction is carried out at 37 ℃, and fluorescence detection is carried out once every 1 min. As shown in FIG. 5, the results of using the optimized gRNA (A/U/C/G) showed higher detection efficiency in vitro nucleic acid detection than that of WT gRNA, especially A and U, and fluorescence was reported more rapidly than that of WT.

While specific embodiments of the invention have been described in detail, those skilled in the art will understand that: various modifications and changes in detail can be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. A full appreciation of the invention is gained by taking the entire specification as a whole in the light of the appended claims and any equivalents thereof.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Shunheng Biotech Co., Ltd

<120> a gRNA and uses thereof

<130> P2020-1975

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1045

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 1

Met Lys Lys Val Glu Val Ser Arg Pro Tyr Gln Ser Leu Leu Leu Pro

1 5 10 15

Asn His Arg Lys Phe Lys Tyr Leu Asp Glu Thr Trp Asn Ala Tyr Lys

20 25 30

Ser Val Lys Ser Leu Leu His Arg Phe Leu Val Cys Ala Tyr Gly Ala

35 40 45

Val Pro Phe Asn Lys Phe Val Glu Val Val Glu Lys Val Asp Asn Asp

50 55 60

Gln Leu Val Leu Ala Phe Ala Val Arg Leu Phe Arg Leu Val Pro Val

65 70 75 80

Glu Ser Thr Ser Phe Ala Lys Val Asp Lys Ala Asn Leu Ala Lys Ser

85 90 95

Leu Ala Asn His Leu Pro Val Gly Thr Ala Ile Pro Ala Asn Val Gln

100 105 110

Ser Tyr Phe Asp Ser Asn Phe Asp Pro Lys Lys Tyr Met Trp Ile Asp

115 120 125

Cys Ala Trp Glu Ala Asp Arg Leu Ala Arg Glu Met Gly Leu Ser Ala

130 135 140

Ser Gln Phe Ser Glu Tyr Ala Thr Thr Met Leu Trp Glu Asp Trp Leu

145 150 155 160

Pro Leu Asn Lys Asp Asp Val Asn Gly Trp Gly Ser Val Ser Gly Leu

165 170 175

Phe Gly Glu Gly Lys Lys Glu Asp Arg Gln Gln Lys Val Lys Met Leu

180 185 190

Asn Asn Leu Leu Asn Gly Ile Lys Lys Asn Pro Pro Lys Asp Tyr Thr

195 200 205

Gln Tyr Leu Lys Ile Leu Leu Asn Ala Phe Asp Ala Lys Ser His Lys

210 215 220

Glu Ala Val Lys Asn Tyr Lys Gly Asp Ser Thr Gly Arg Thr Ala Ser

225 230 235 240

Tyr Leu Ser Glu Lys Ser Gly Glu Ile Thr Glu Leu Met Leu Glu Gln

245 250 255

Leu Met Ser Asn Ile Gln Arg Asp Ile Gly Asp Lys Gln Lys Glu Ile

260 265 270

Ser Leu Pro Lys Lys Asp Val Val Lys Lys Tyr Leu Glu Ser Glu Ser

275 280 285

Gly Val Pro Tyr Asp Gln Asn Leu Trp Ser Gln Ala Tyr Arg Asn Ala

290 295 300

Ala Ser Ser Ile Lys Lys Thr Asp Thr Arg Asn Phe Asn Ser Thr Leu

305 310 315 320

Glu Lys Phe Lys Asn Glu Val Glu Leu Arg Gly Leu Leu Ser Glu Gly

325 330 335

Asp Asp Val Glu Ile Leu Arg Ser Lys Phe Phe Ser Ser Glu Phe His

340 345 350

Lys Thr Pro Asp Lys Phe Val Ile Lys Pro Glu His Ile Gly Phe Asn

355 360 365

Asn Lys Tyr Asn Val Val Ala Glu Leu Tyr Lys Leu Lys Ala Glu Ala

370 375 380

Thr Asp Phe Glu Ser Ala Phe Ala Thr Val Lys Asp Glu Phe Glu Glu

385 390 395 400

Lys Gly Ile Lys His Pro Ile Lys Asn Ile Leu Glu Tyr Ile Trp Asn

405 410 415

Asn Glu Val Pro Val Glu Lys Trp Gly Arg Val Ala Arg Phe Asn Gln

420 425 430

Ser Glu Glu Lys Leu Leu Arg Ile Lys Ala Asn Pro Thr Val Glu Cys

435 440 445

Asn Gln Gly Met Thr Phe Gly Asn Ser Ala Met Val Gly Glu Val Leu

450 455 460

Arg Ser Asn Tyr Val Ser Lys Lys Gly Ala Leu Val Ser Gly Glu His

465 470 475 480

Gly Gly Arg Leu Ile Gly Gln Asn Asn Met Ile Trp Leu Glu Met Arg

485 490 495

Leu Leu Asn Lys Gly Lys Trp Glu Thr His His Val Pro Thr His Asn

500 505 510

Met Lys Phe Phe Glu Glu Val His Ala Tyr Asn Pro Ser Leu Ala Asp

515 520 525

Ser Val Asn Val Arg Asn Arg Leu Tyr Arg Ser Glu Asp Tyr Thr Gln

530 535 540

Leu Pro Ser Ser Ile Thr Asp Gly Leu Lys Gly Asn Pro Lys Ala Lys

545 550 555 560

Leu Leu Lys Arg Gln His Cys Ala Leu Asn Asn Met Thr Ala Asn Val

565 570 575

Leu Asn Pro Lys Leu Ser Phe Thr Ile Asn Lys Lys Asn Asp Asp Tyr

580 585 590

Thr Val Ile Ile Val His Ser Val Glu Val Ser Lys Pro Arg Arg Glu

595 600 605

Val Leu Val Gly Asp Tyr Leu Val Gly Met Asp Gln Asn Gln Thr Ala

610 615 620

Ser Asn Thr Tyr Ala Val Met Gln Val Val Lys Pro Lys Ser Thr Asp

625 630 635 640

Ala Ile Pro Phe Arg Asn Met Trp Val Arg Phe Val Glu Ser Gly Ser

645 650 655

Ile Glu Ser Arg Thr Leu Asn Ser Arg Gly Glu Tyr Val Asp Gln Leu

660 665 670

Asn His Asp Gly Val Asp Leu Phe Glu Ile Gly Asp Thr Glu Trp Val

675 680 685

Asp Ser Ala Arg Lys Phe Phe Asn Lys Leu Gly Val Lys His Lys Asp

690 695 700

Gly Thr Leu Val Asp Leu Ser Thr Ala Pro Arg Lys Ala Tyr Ala Phe

705 710 715 720

Asn Asn Phe Tyr Phe Lys Thr Met Leu Asn His Leu Arg Ser Asn Glu

725 730 735

Val Asp Leu Thr Leu Leu Arg Asn Glu Ile Leu Arg Val Ala Asn Gly

740 745 750

Arg Phe Ser Pro Met Arg Leu Gly Ser Leu Ser Trp Thr Thr Leu Lys

755 760 765

Ala Leu Gly Ser Phe Lys Ser Leu Val Leu Ser Tyr Phe Asp Arg Leu

770 775 780

Gly Ala Lys Glu Met Val Asp Lys Glu Ala Lys Asp Lys Ser Leu Phe

785 790 795 800

Asp Leu Leu Val Ala Ile Asn Asn Lys Arg Ser Asn Lys Arg Glu Glu

805 810 815

Arg Thr Ser Arg Ile Ala Ser Ser Leu Met Thr Val Ala Gln Lys Tyr

820 825 830

Lys Val Asp Asn Ala Val Val His Val Val Val Glu Gly Asn Leu Ser

835 840 845

Ser Thr Asp Arg Ser Ala Ser Lys Ala His Asn Arg Asn Thr Met Asp

850 855 860

Trp Cys Ser Arg Ala Val Val Lys Lys Leu Glu Asp Met Cys Asn Leu

865 870 875 880

Tyr Gly Phe Asn Ile Lys Gly Val Pro Ala Phe Tyr Thr Ser His Gln

885 890 895

Asp Pro Leu Val His Arg Ala Asp Tyr Asp Asp Pro Lys Pro Ala Leu

900 905 910

Arg Cys Arg Tyr Ser Ser Tyr Ser Arg Ala Asp Phe Ser Lys Trp Gly

915 920 925

Gln Asn Ala Leu Ala Ala Val Val Arg Trp Ala Ser Asn Lys Lys Ser

930 935 940

Asn Thr Cys Tyr Lys Val Gly Ala Val Glu Phe Leu Lys Gln His Gly

945 950 955 960

Leu Phe Ala Asp Lys Lys Leu Thr Val Glu Gln Phe Leu Ser Lys Val

965 970 975

Lys Asp Glu Glu Ile Leu Ile Pro Arg Arg Gly Gly Arg Val Phe Leu

980 985 990

Thr Thr His Arg Leu Leu Ala Glu Ser Thr Phe Val Tyr Leu Asn Gly

995 1000 1005

Val Lys Tyr His Ser Cys Asn Ala Asp Glu Val Ala Ala Val Asn Ile

1010 1015 1020

Cys Leu Asn Asp Trp Val Ile Pro Cys Lys Lys Lys Met Lys Glu Glu

1025 1030 1035 1040

Ser Ser Ala Ser Gly

1045

<210> 2

<211> 24

<212> RNA

<213> Artificial sequence (artificial sequence)

<400> 2

agagaaugug ugcauaguca acac 24

<210> 3

<211> 24

<212> RNA

<213> Artificial sequence (artificial sequence)

<400> 3

agagaaugug ugcauagucu acac 24

<210> 4

<211> 24

<212> RNA

<213> Artificial sequence (artificial sequence)

<400> 4

agagaaugug ugcauagucc acac 24

<210> 5

<211> 24

<212> RNA

<213> Artificial sequence (artificial sequence)

<400> 5

agagaaugug ugcauagucg acac 24

<210> 6

<211> 613

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

gctgtgttct taactcgcac agcacagctg agaccactct tgatagtttc ttcagcaggg 60

cgggattagt tggagagata gacctccccc ttgagggcac aactaaccca aatggttatg 120

ccaactggga catagatata acaggttacg cgcaaatgcg taggaaggtg gagctattca 180

cttacatgcg ctttgatgca gagttcactt ttgttgcgtg cacacccacc ggggaagttg 240

ttccacaatt gctccaatat atgtttgtgc cacctggagc ccctaagcca gattcaaggg 300

aatcccttgc atggcaaact gccactaacc cctcagtttt tgtcaagctg tcagaccctc 360

cagcgcaggt ttcagtgcca ttcatgtcac ctgcgagtgc ttatcaatgg ttttatgacg 420

gatatcccac attcggagaa cacaaacagg agaaggatct tgaatacggg gcatgtccta 480

ataacatgat gggtacgttc tcagtgcgga ctgtggggac ctccaagtcc aagtaccctt 540

tagtggttag gatctacatg agaatgaagc acgtcagggc gtggatacct cgcccgatgc 600

gtaaccagaa cta 613

<210> 7

<211> 40

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

gtgcacgcaa caaaagtgaa ctctgcatca aagcgcatgt 40

Claims (17)

1. An direct repeat sequence for constructing a gRNA, wherein the direct repeat sequence comprises a sequence as set forth in any one of SEQ ID Nos. 2 to 5; preferably, the direct repeat sequence is shown in any one of SEQ ID No. 2-5.

2. A gRNA comprising the direct repeat of claim 1 and a targeting sequence that targets a nucleic acid.

3. A nucleic acid encoding a gRNA according to claim 2, or encoding a precursor of a gRNA according to claim 2, or encoding a direct repeat sequence according to claim 1.

4. A composition or CRISPR system comprising a Cas protein and a gRNA of claim 2.

5. A vector system, wherein the vector system comprises one or more vectors, wherein the one or more vectors comprise:

a) a first regulatory element operably linked to the gRNA of claim 2,

b) a second regulatory element operably linked to a Cas protein;

wherein components (a) and (b) are on the same or different carriers.

6. An activated CRISPR complex comprising a gRNA of claim 2, a Cas protein, and a target nucleic acid bound on the gRNA.

7. The gRNA of claim 2, for use in any one of i-iv:

i. improving Cas protein editing efficiency;

ii. Increasing Cas protein trans cleavage activity;

iii, improving the efficiency of non-specific cleavage of single-stranded nucleic acid by the Cas protein;

iv, improving the efficiency of Cas protein specific cleavage of the target nucleic acid.

8. A method of increasing the efficiency of Cas protein gene editing or gene cleavage, comprising gene editing or gene cleavage using the Cas protein and the gRNA of claim 2.

9. Use of the gRNA of claim 2, the nucleic acid of claim 3, the composition or CRISPR system of claim 4, the vector system of claim 5, or the activated CRISPR complex of claim 6 in gene editing, gene targeting, or gene cleavage.

10. A method of editing, targeting, or cleaving a target nucleic acid, comprising the step of contacting the target nucleic acid with the gRNA of claim 2, the nucleic acid of claim 3, the composition or CRISPR system of claim 4, or the vector system of claim 5.

11. Use of the gRNA of claim 2, the nucleic acid of claim 3, the composition or CRISPR system of claim 4, the vector system of claim 5, or the activated CRISPR complex of claim 6 in nucleic acid detection or diagnosis.

12. A method of cleaving single-stranded nucleic acid, the method comprising contacting a nucleic acid population with a Cas protein and the gRNA of claim 2, wherein the nucleic acid population comprises a target nucleic acid and a plurality of non-target single-stranded nucleic acids, and the Cas protein cleaves the plurality of non-target single-stranded nucleic acids.

13. Use of the gRNA of claim 2, the nucleic acid of claim 3, the composition or CRISPR system of claim 4, the vector system of claim 5, or the activated CRISPR complex of claim 6 to non-specifically cleave single-stranded nucleic acids.

14. A kit for gene editing, comprising a gRNA of claim 2 and a Cas protein.

15. A kit for detecting a target nucleic acid in a sample, the kit comprising: (a) the gRNA of claim 2, or a nucleic acid encoding the gRNA, or a precursor RNA of the gRNA, or a nucleic acid encoding the precursor RNA; (b) a Cas protein, or a nucleic acid encoding the Cas protein; and (c) a single-stranded nucleic acid detector that is single-stranded and does not hybridize to the gRNA.

16. Use of the gRNA of claim 2, the nucleic acid of claim 3, the composition or CRISPR system of claim 4, the vector system of claim 5, or the activated CRISPR complex of claim 6 in the preparation of a formulation for any one or any of the following (i) - (iv):

(i) gene or genome editing;

(ii) target nucleic acid detection and/or diagnosis;

(iii) editing a target sequence in a target locus to modify an organism or non-human organism;

(iv) treatment of diseases;

(iv) target genes are targeted.

17. A method of detecting a target nucleic acid in a sample, comprising contacting the sample with a Cas protein, a gRNA of claim 2 comprising a region that binds to the Cas protein and a guide sequence that hybridizes to the target nucleic acid, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein-cleaved single-stranded nucleic acid detector, thereby detecting a target nucleic acid; the single-stranded nucleic acid detector does not hybridize to the gRNA.

Images