CN114438039A - High-throughput construction method of mammal cell disease model - Google Patents
High-throughput construction method of mammal cell disease model Download PDFInfo
- Publication number
- CN114438039A CN114438039A CN202210360423.9A CN202210360423A CN114438039A CN 114438039 A CN114438039 A CN 114438039A CN 202210360423 A CN202210360423 A CN 202210360423A CN 114438039 A CN114438039 A CN 114438039A
- Authority
- CN
- China
- Prior art keywords
- dna
- grna
- artificial sequence
- gene
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0684—Cells of the urinary tract or kidneys
- C12N5/0686—Kidney cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Urology & Nephrology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a high-throughput construction method of a mammal cell disease model, which comprises the following steps: arranging the variation position and gene name information of C-to-T or G-to-A mononucleotide of ClinVar database in NCBI by applying a bioinformatics method, and designing gRNA for constructing a disease cell model according to the screening principle of related gene targets; introducing animal cells by using designed gRNA, and carrying out gene editing on a target gene, wherein the gene editing comprises the steps of constructing gRNA plasmids by using a high-throughput sonar liquid transfer workstation, co-transferring the gRNA plasmids and BE4max plasmids into mammalian cells by using a high-throughput liquid treatment workstation, carrying out high-throughput culture screening, sample collection, sequencing and editing efficiency analysis by adding medicaments, and finally, obtaining a disease cell model with target mutation by using a flow cytometer to sort and clone. The invention can use standardized work flow to produce disease cell model efficiently.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a high-throughput construction method of a mammalian cell disease model.
Background
Single Nucleotide Variations (SNVs) in the human genome can cause changes in amino acid residues in protein sequences, which in turn alter their function, leading to individual disease. According to the ClinVar database at NCBI, over 3.7 million known diseases are associated with pathogenic SNVs. The diseases caused by mononucleotide mutation mainly include rare diseases, leukemia, thalassemia, Leber congenital black hair, etc. A study by the european rare disease organization showed that 4 hundred million people worldwide had rare genetic diseases, of which 95% could not be effectively treated.
At present, base editing technology (base editing) developed based on CRISPR has been reported to be used for efficient gene mutation or repair of genome, disease cell modeling, and gene therapy, and provides hope for future genetic disease treatment. At present, three types of base editing tools, Cytosine Base Editor (CBE), which converts C.G to T.A, Adenine Base Editor (ABE), have been reportedS) It converts A.T to G.C, and glycosylase editor (GBE), it converts C.G to G.C. Approximately 50% of human pathogenic single nucleotide variations are C · G to T · a transitions, which can be corrected by ABEs. However, since problems of editing efficiency and off-target effects have been present, researchers have been working on the improvement and optimization of editors, and it is expected that editors of different types and different characteristics will be obtained, so that the editing efficiency and the editing range will be improved, and efforts will be made for their early application in gene therapy.
The establishment of disease models is necessary for understanding the disease mechanism, developing new gene therapy strategies and researching targeted drugs, so that the establishment of mammalian cell disease models is important to be applied in the research of early gene therapy drug targets, and provides a basis for the development and improvement of the optimization of base editing tools. However, the research on the editing efficiency and accuracy of the novel base editing tool requires large-scale sample data, and the traditional mammalian cell disease model building method is mainly completed by manual operation. For a large number of samples, manual operation is time-consuming and labor-consuming, and is high in cost and error rate. To solve this problem, a common method is to construct a target gene library, integrate the lentivirus into mammalian cells, and analyze the efficiency and preference of each editor by machine learning, so as to provide a basis for designing a novel base editing tool and improving the gene editing capability of the base editor. However, in practice, due to the position effect of lentivirus integration, different from the real chromosomal environment of the target gene, the gene editing efficiency after integration may have a large deviation from the in situ editing efficiency, which cannot completely and truly reflect the editing capability of the editor, and thus a more accurate and high-throughput means is urgently needed.
Disclosure of Invention
Aiming at the defects in the prior art, the invention aims to provide a high-throughput construction method of a mammalian cell disease model. The method comprises the following steps:
firstly, after relevant information such as variation positions of C-to-T or G-to-A mononucleotides in a ClinVar database in NCBI, gene names and the like is collated by applying a bioinformatics method, designing gRNA for constructing a relevant disease cell model according to a self-defined screening principle of relevant gene targets; wherein, the screening principle includes: the PAM area is NGG; 2. c range of mutation selected in the editing window is 3 to 9 bits; 3. surrounding cs, i.e. no other cs than the destination C within the editing window, are excluded.
Secondly, introducing animal cells by using the gRNA designed above and carrying out gene editing on a target gene, wherein the method comprises the following steps:
(1) constructing gRNA plasmid by using a high-throughput nanoliter pipetting workstation method;
(2) co-transferring the gRNA plasmid obtained in the step (1) and a base editor plasmid containing a fluorescent protein gene (such as BE4max with a green fluorescent protein gene) into a mammalian cell by using a high-throughput liquid treatment workstation, performing high-throughput culture screening by adding a medicament, collecting a sample at high throughput, sequencing, and analyzing editing efficiency;
(3) the single clone is sorted by flow cytometry to obtain a disease cell model (which is actually a cell line) with target mutation.
In the first step, 1210 target sites of interest were selected by student's analysis according to the three criteria of customization described above, providing a gRNA for gene editing, the target sequences of which include 100 listed in table 1 as an example. Wherein, the gRNA with the target sequence of 1-100 is obtained by first designing and screening the application, and has better editing effect.
Preferably, in the step (1), the plasmid vector with the ccdb gene sequence and the drug screening marker is digested by BsaI, then T4 DNA ligase connection is carried out on the plasmid vector and a gRNA sequence which has a BsaI digestion site and can target a target gene, and the gRNA plasmid vector is obtained after purification of a ligation product.
Preferably, in step (1), the gold gate system is formulated using a nanoliter pipetting workstation, Echo.
Preferably, in step (1), the gold gate system is 1 ul.
Preferably, the drug screening marker in step (1) is a puromycin drug screening marker, and the externally added drug in step (2) is puromycin.
Preferably, in step (2), the cloning vector obtained in step (1) and BE4max with GFP marker are co-transferred into mammalian cells by PEI, drug screening is added, and sequencing is collected.
Preferably, in step (2), the mammalian cell is a human cell, more preferably, the human cell is Hela or HEK293T, more preferably HEK 293T;
preferably, in step (2), the liquid treatment station i7 is used for cell plating, transfection, liquid exchange and collection.
Analyzing the editing efficiency of the cells obtained in the step (2) according to a sequencing result, sorting the cells with the editing efficiency by using a flow cytometer, screening HEK293T monoclonal cells with green fluorescence, performing amplification culture, and performing sequencing verification to store the C-T mononucleotide mutation disease model cells.
Preferably, in step (3), the monoclonal screening method is flow cytometry sorting. Among them, a cell line having C-to-T editing efficiency close to 100% is considered as a single-base mutant disease cell model to be screened out.
The invention protects the application of the mammalian cell model obtained by the method in drug screening, disease treatment effect evaluation or disease treatment mechanism research.
The invention has the following beneficial effects: an automatic platform is designed, and the platform is an automatic mammal cell editing platform for monoclonal sorting from gRNA design, high-throughput plasmid construction and extraction, high-throughput cell transfection, high-throughput cell culture, high-throughput sequencing sample preparation and high-throughput editing result analysis. On the basis, a standardized work flow can be used for efficiently generating a disease cell model, and the production process of different mammalian cell models is greatly promoted.
Drawings
The accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this application, illustrate embodiment(s) of the application and together with the description serve to explain the application and not to limit the application. In the drawings:
fig. 1 is a ccdB _ gRNA plasmid map;
FIG. 2 is a BE4max plasmid map;
FIG. 3 is a single cell sorting of Clinvar: VCV000011568 base mutation model; wherein, A is arginine (CGA) 1632 of COL7A1 gene of normal cell, and when C is changed into T, a stop codon (TGA) is formed, translation is stopped, and pathogenic mutation is caused; b is that a BE4max base editor edits 293T cells under the guide of gRNA to construct a disease cell model; c is the editing efficiency of 52 percent, D is the disease model cell sorting;
FIG. 4 shows the repair efficiency of Clinvar: VCV000011568 after base mutation. Wherein, A is a disease model cell line (G to A90% mutation); b is that ABE-8e editor restores disease model cell strain into normal cell (T to C) under the guide of gRNA; c is the editing efficiency of the disease cells to repair normal cells, and is 52% +/-1.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail with reference to the accompanying drawings.
Description of disease-related information
In the first step, relevant information such as the mutation position of C-to-T or G-to-A mononucleotide of ClinVar database in NCBI, gene name and the like is downloaded in a tabular form by applying a bioinformatics method.
Access to NCBI's variantdatabase clinvar, website: https:// www.ncbi.nlm.nih.gov/clinvar/, respectively inputting "C > tend genetic" and "G > Aand genetic" in the search box to retrieve information of C to T mutation and G to a mutation, and clicking the Download option on the page to Download the retrieved table including the mutation sites, gene names and clinical importance as candidate targets for the next step of designing grnas to construct disease cell models.
Second, gRNA design for constructing disease-related cell model
Aiming at 1210 target gene targets, the gRNA capable of carrying out gene editing is provided. Each gene of interest was designed as 1 gRNA, with 1210 genes totaling 1210 grnas.
Using the python package seqseek, DNA fragments containing mutation points were retrieved from the nucleotide database of NCBI, against the chromosomal location information in the tabular data and in the nucleotide database of NCBI used as reference. Wherein, a DNA fragment with the length of 20-nt and meeting the following conditions is selected as the gRNA spacer of the target sequence:
1) the mutation site is at positions 3 to 9 of the subsequence;
2) for C to T variation, there is no additional C from positions 4 to 8;
3) for C to G variation, there is no additional G from positions 4 to 8;
4) the 20-nt DNA fragment is followed by a 3-nt NGG (as PAM);
under these conditions, 1210 target sequences were obtained, each consisting of a gRNA spacer followed by 3-nt NGG (as PAM).
Thirdly, constructing a cloning vector:
and constructing a cloning vector by using the gRNA designed in the second step. The specific method comprises the following steps:
the base editing plasmid is pCMV-BE4max-P2A-GFP (Addgene 12099); the construction of gRNA plasmids of 1210 target points is to insert N20 after the U6 promoter of ccdB-gRNA plasmid to replace ccdB gene. The plasmid (Addgene 51133) was constructed using the gold gate method, system 1ul, and reagent addition was performed from a nanoliter liquid handling workstation (Beckman-Echo, USA). The specific operation is as follows: first, gRNA primers were synthesized on 384source plates, and reagent mix I included T4buffer (0.05 ul) and ddH2O (0.35 ul), reagent mixture II comprised ccdB plasmid (0.15 ul), T4 ligase (0.06 ul), T4buffer (0.1 ul), BSA (0.1 ul), BsaI enzyme (0.06 ul) and ddH2O (0.03 ul), respectively installed in the other 384source plate hole. Then, 0.5ul of the reagents required for each annealing reaction (0.05 ul upper and lower) and mixture I (0.4 ul) were transferred from the 384-well source plate to a 96-well PCR plate using an Echo apparatus, and then sealed (180 ℃ C., 4 s) with a sealing plate, centrifuged (5000 rpm, 3 min), and annealed using a PCR instrument (95 ℃ C., 5 min) to obtain dsDNA. Third, 0.5ul of mix II was transferred from 384source plates to dsDNA 96PCR plates using Echo, then sealed (180 ℃ C., 4 s), centrifuged (5000 rpm, 3 min), and the reaction program in the PCR instrument was as follows: 3min at 37 ℃ and 4min at 16 ℃, repeating step 1-2 for 25 cycles, 4min at 50 ℃, 5min at 80 ℃ and 4 ℃ hold. DH 5. alpha. competent cells which did not require heat shock and recovery of culture were added to a 96-well Golden gate reaction product PCR plate using a Beckman i7 liquid treatment station (Beckman-Biomek, USA), incubated for 5min on a 0 ℃ Peltier module, transformants were transferred to a sharp-bottomed 96-well plate using a Beckman i7 liquid treatment station, plated with a full-automatic clone selection System (QP Expression, Genetix, UK), cultured overnight at 37 ℃ and then single-cloned in a 96-well plate, cultured overnight using a magnetic bead method plasmid extraction kit (Biomiga, C) using a 37 ℃ 800rmp high-throughput shaker (Infors, Switzerland)hina), written by a Beckman i7 liquid processing workstation according to the specification of the plasmid, extracting the plasmid with high flux, wherein 384 samples can be extracted at one time, and the plasmid is correctly used for subsequent experiments after Sanger sequencing. According to the high-throughput experimental procedure, one plasmid vector is respectively constructed corresponding to each target gene in 1210 target genes, namely 1210 gRNA plasmid vectors are used for subsequent cell editing experiments.
III, cell culture
HEK293T cells were obtained from American Type Culture Collection (ATCC) at 37 ℃ with 5% CO2The medium was Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum.
Fourth, cell transfection
For cell transfection, the Beckman i7 liquid treatment station was used to accomplish the cell transfection by first trypsinizing the cells, centrifuging them, diluting the cell suspension with media in a separatory tank, and seeding 100ul of 96-well cell culture plates using the Beckman i7 station 96 channel, approximately 1X 10 per well4And (4) cells. After inoculation for 16-24 hours, respectively diluting a certain amount of gRNA plasmid and Cas9 plasmid with a culture medium, putting the diluted gRNA plasmid and the Cas9 plasmid into a liquid separating tank, uniformly mixing the gRNA plasmid and a CBE base editor plasmid (BE 4max with green fluorescent protein and the map is shown in figure 2) in a new 96-well plate by using a Beckman i7 work station 8 channel, wherein the transfection amount of the gRNA in each well is 80ng, the transfection amount of the BE4max plasmid is 160ng, standing for 5min after uniformly mixing, simultaneously diluting PEI by using the culture medium, putting the diluted PEI into the liquid separating tank, adding a PEI-containing culture solution into the 96-well plate by using a Beckman i7 work station 8 channel (0.72 ul per 1mg/ml PEI), mixing the diluted plasmid and the diluted PEI, standing for 20min, adding the uniformly mixed transfection reagent into an inoculated 293T cell culture plate by using a Beckman i7 work station 96 channel, culturing at 37 ℃ and culturing 5% CO2And (5) culturing. After 4-6 h of cell transfection, the medium was changed, and the culture medium in the 96-well plate was aspirated using Beckman i7 workstation 96 channel, and 100ul of fresh medium containing 10% serum was added.
Fifthly, puromycin screening, cell collection and sequencing
On days 3, 5 and 7, Beckm was usedand (3) changing the solution through a 96 channel of an i7 workstation, firstly adding a puromycin solution into a culture solution containing 10% serum to a liquid separating tank, slowly sucking away the cell culture solution in the original 96-well plate, adding the culture solution containing the puromycin solution into the culture solution containing 10% serum to a 96-well cell culture plate by using a Beckman i7 workstation 96 channel, and screening the cells, wherein the puromycin concentration is 4 microgram/mL when the solution is changed on days 3 and 5, and the puromycin concentration is 2 microgram/mL on day 7. On day 9, cell collection was performed using a Beckman i7 workstation, PBS was first placed in one cuvette, cell lysate was placed in the other cuvette, the original culture was pipetted into the waste cuvette using a Beckman i7 workstation 96 channel, surviving cells were washed once with 100ul PBS, then cell suspension was performed by four-corner pipetting using 100ul PBS, suspension was pipetted into a new 96-well PCR plate, centrifugation was performed at 5000rmp for 20min using a Flat Angle centrifuge (Hettich, Germany), supernatant was pipetted out using a Beckman i7 workstation 96 channel, 15 ul cell lysate was added per well using 8 channels and mixed well, and cells were lysed using a PCR instrument (Analytik-jena, Germany) at 65 ℃ 10 min, 98 ℃ 2 min. The PCR amplification system is 30 ul, and the operation steps are as follows: first, 1.5ul of forward and reverse primers for gene amplification were transferred from 384-well source plates to 96-well PCR plates, 2 XSS Taq enzyme and ddH, respectively, by Echo2Placing O premix in a liquid separating tank, adding 22 ul of premix solution into each hole of a Beckman i7 workstation 8 channel in a 96-hole PCR plate added with primers, adding 3ul of lysed cells into each hole of a Beckman i7 workstation 96 channel in a PCR template, and sealing by using a membrane sealing instrument (Miula, China), wherein the PCR reaction conditions are as follows: 94 ℃ 3min, 94 ℃ 30s, 60 ℃ 30s, 72 ℃ 30s, 30 cycles at 2-4 steps, 72 ℃ 2min, 4 ℃ Cscorore. PCR stocks were Sanger sequenced.
Sixthly, sequencing result analysis and statistics
The 1210 sequencing results of the gene editing performed by the automated platform were analyzed using EditR software.
For each disease site, three parallel cell editing experiments were designed, 1210 edited cells were subjected to PCR and Sanger sequencing after editing was completed, and 1210 editing results were analyzed using EditR software.
The results show that: the in-situ editing efficiency of BE4max is verified by using a high-throughput editing platform, most of base editing occurs at 3-9 positions at the upstream of a PAM sequence, 823 gene targets are subjected to c-t conversion editing, the editing efficiency is 10%, the editing efficiency of 248 gene targets is more than or equal to 50%, the editing efficiency of 248 gene targets accounts for 20.33% of all the targets, and the editing efficiency of 136 gene targets is less than or equal to 10%. No editing result is obtained for 76 genes due to poor design of PCR primers, and 175 gene targets are not obviously edited.
Taking the editing of 100 optimal target gene loci as an example, the sequences, disease names and editing efficiency of gRNAs are shown in Table 1. Wherein the italicized C-word in each sequence represents the site for which editing efficiency is directed.
TABLE 1.1-100 gRNA sequences Clinvar Nos
Sorting disease model cells by a flow cytometer: sorting the single cells by Fluorescence Activated Cell Sorting (FACS) by: and (3) subculturing and amplifying the edited cell pool on the 96-well plate to a 24-well plate, collecting cells after about 2-3 days, and sorting according to BE4max Green Fluorescent Protein (GFP) fluorescence. Single cells were flow-sorted into 96-well plates in 100 μ l DMEM medium containing 10% fetal bovine serum and 1% antibiotics (100U/mL penicillin and 0.1 mg/mL streptomycin) per well. After 14 days of culture, the sorted single cells were expanded to 24-well plates, and after about 2-3 days, the single cells were expanded to 12-well plates. Freezing and storing a part of cells, washing a part of cells by PBS, digesting the cells by pancreatin, extracting DNA, amplifying by PCR and sequencing. And finally, performing amplification culture and cryopreservation on the single cell disease model confirmed by sanger sequencing. Analyzing the single-cell strains sorted by a flow cytometer by adopting EditR software and website baseedtr.com, wherein the cell strains with C-to-T editing efficiency close to 100 percent are considered as single-base mutation disease cell models screened, and the cell strains with C-to-T editing efficiency close to 100 percent account for 47.30 +/-7.18 percent of the total sequenced cell strains. For example, Clinvar No.: VCV000011568, gene COL7A1(3p21.31), c.4894C > T (p.Arg1632Ter) single cell sorting of base mutation model, as shown in FIG. 3, wherein A is alpha chain of collagen VII encoded by COL7A1 gene, the 1632 amino acid CGA translates into arginine when the base sequence is normal, and stop codon is formed when C mutates into T, translation is stopped, leading to recessive dystrophic epidermolysis bullosa; b is an N20 sequence obtained according to the gRNA design principle, and a BE4max base editor is applied to edit 293T cells to construct a C-T mutation disease cell model; c shows an editing efficiency of 52%, D is the monoclonal sorting of GFP bearing cells using flow cytometry. After amplification, sanger sequencing verifies that cell strains with C-to-T editing efficiency close to 100 percent account for 47.30 +/-7.18 percent of total sequenced cell strains.
Single cells were flow sorted and Sanger sequencing verified were inoculated into 24-well plates, cells were co-transfected with ABE base editors (e.g. ABE-8 e) and gRNA plasmids targeting gene loci, 3 replicates for each plasmid combination transfection, and 5ug/ml puromycin was added to the medium 24 hours after transfection. Collecting partial cells after 120 hours of transfection, extracting genome DNA by using a rapid extraction DNA extracting solution, carrying out Sanger sequencing on a PCR product by using Taq DNA polymerase PCR on a region of 200 bp-300 bp near an edited site to calculate editing efficiency, collecting the cells, extracting cell genome, carrying out PCR and Sanger sequencing to detect editing efficiency, and verifying base editing repair conditions. For example, when Clinvar No. VCV000011568 and gene COL7A1(3p21.31) C.4894C > T (p.Arg1632Ter) are corrected by using an editor, the correction efficiency of ABE-8e under the guidance of gRNA (N20 sequence TCTCATCCTCGGGGGCCAAC) can reach 52% + -1, as shown in FIG. 4, A is a disease model cell strain (GtoA) determined by Sanger sequencing verification after flow-sorted single cell amplification, and EditR software analysis, B is a diagram of the editing efficiency of the disease model cell strain to be corrected into normal cells (Ato G) under the action of ABE-8e and gRNA, and C is a diagram of the editing efficiency of the disease cells to be corrected into normal cells by using an ABE-8e editor.
Those not described in detail in this specification are within the skill of the art. The above description is only an example of the present application and is not intended to limit the present application. Various modifications and changes may occur to those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.
<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences
<120> high-throughput construction method of mammalian cell disease model
<160> 100
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<400> 7
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence
<400> 8
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence
<400> 10
<210> 11
<211> 20
<212> DNA
<213> Artificial sequence
<400> 11
<210> 12
<211> 20
<212> DNA
<213> Artificial sequence
<400> 12
<210> 13
<211> 20
<212> DNA
<213> Artificial sequence
<400> 13
<210> 14
<211> 20
<212> DNA
<213> Artificial sequence
<400> 14
<210> 15
<211> 20
<212> DNA
<213> Artificial sequence
<400> 15
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence
<400> 16
<210>17
<211> 20
<212> DNA
<213> Artificial sequence
<400> 17
<210> 18
<211> 20
<212> DNA
<213> Artificial sequence
<400> 18
<210> 19
<211> 20
<212> DNA
<213> Artificial sequence
<400> 19
<210> 20
<211> 20
<212> DNA
<213> Artificial sequence
<400> 20
GGAGTACTGTAGGAAGAGGA
<210> 21
<211> 20
<212> DNA
<213> Artificial sequence
<400> 21
<210> 22
<211> 20
<212> DNA
<213> Artificial sequence
<400> 22
<210> 23
<211> 20
<212> DNA
<213> Artificial sequence
<400> 23
<210> 24
<211> 20
<212> DNA
<213> Artificial sequence
<400> 24
<210> 25
<211> 20
<212> DNA
<213> Artificial sequence
<400> 25
<210> 26
<211> 20
<212> DNA
<213> Artificial sequence
<400> 26
<210> 27
<211> 20
<212> DNA
<213> Artificial sequence
<400> 27
<210> 28
<211> 20
<212> DNA
<213> Artificial sequence
<400> 28
<210> 29
<211> 20
<212> DNA
<213> Artificial sequence
<400> 29
<210> 30
<211> 20
<212> DNA
<213> Artificial sequence
<400> 30
<210> 31
<211> 20
<212> DNA
<213> Artificial sequence
<400> 31
<210> 32
<211> 20
<212> DNA
<213> Artificial sequence
<400> 32
<210> 33
<211> 20
<212> DNA
<213> Artificial sequence
<400> 33
CCTGGTCGAAGCCCTTCTCC
<210> 34
<211> 20
<212> DNA
<213> Artificial sequence
<400> 34
<210> 35
<211> 20
<212> DNA
<213> Artificial sequence
<400> 35
<210> 36
<211> 20
<212> DNA
<213> Artificial sequence
<400> 36
<210> 37
<211> 20
<212> DNA
<213> Artificial sequence
<400> 37
<210> 38
<211> 20
<212> DNA
<213> Artificial sequence
<400> 38
<210> 39
<211> 20
<212> DNA
<213> Artificial sequence
<400> 39
<210> 40
<211> 20
<212> DNA
<213> Artificial sequence
<400> 40
<210> 41
<211> 20
<212> DNA
<213> Artificial sequence
<400> 41
<210> 42
<211> 20
<212> DNA
<213> Artificial sequence
<400> 42
<210> 43
<211> 20
<212> DNA
<213> Artificial sequence
<400> 43
TTGGTTCAGGTGAGAAGATA
<210> 44
<211> 20
<212> DNA
<213> Artificial sequence
<400> 44
<210> 45
<211> 20
<212> DNA
<213> Artificial sequence
<400> 45
<210> 46
<211> 20
<212> DNA
<213> Artificial sequence
<400> 46
<210> 47
<211> 20
<212> DNA
<213> Artificial sequence
<400> 47
<210> 48
<211> 20
<212> DNA
<213> Artificial sequence
<400> 48
TTCTGTAAAACATAAAAGTC
<210> 49
<211> 20
<212> DNA
<213> Artificial sequence
<400> 49
<210> 50
<211> 20
<212> DNA
<213> Artificial sequence
<400> 50
<210> 51
<211> 20
<212> DNA
<213> Artificial sequence
<400> 51
<210> 52
<211> 20
<212> DNA
<213> Artificial sequence
<400> 52
<210> 53
<211> 20
<212> DNA
<213> Artificial sequence
<400> 53
<210> 54
<211> 20
<212> DNA
<213> Artificial sequence
<400> 54
<210> 55
<211> 20
<212> DNA
<213> Artificial sequence
<400> 55
<210> 56
<211> 20
<212> DNA
<213> Artificial sequence
<400> 56
<210> 57
<211> 20
<212> DNA
<213> Artificial sequence
<400> 57
<210> 58
<211> 20
<212> DNA
<213> Artificial sequence
<400> 58
<210> 59
<211> 20
<212> DNA
<213> Artificial sequence
<400> 59
<210> 60
<211> 20
<212> DNA
<213> Artificial sequence
<400> 60
<210> 61
<211> 20
<212> DNA
<213> Artificial sequence
<400> 61
<210> 62
<211> 20
<212> DNA
<213> Artificial sequence
<400> 62
<210> 63
<211> 20
<212> DNA
<213> Artificial sequence
<400> 63
<210> 64
<211> 20
<212> DNA
<213> Artificial sequence
<400> 64
<210> 65
<211> 20
<212> DNA
<213> Artificial sequence
<400> 65
<210> 66
<211> 20
<212> DNA
<213> Artificial sequence
<400> 66
<210> 67
<211> 20
<212> DNA
<213> Artificial sequence
<400> 67
<210> 68
<211> 20
<212> DNA
<213> Artificial sequence
<400> 68
<210> 69
<211> 20
<212> DNA
<213> Artificial sequence
<400> 69
<210> 70
<211> 20
<212> DNA
<213> Artificial sequence
<400> 70
<210> 71
<211> 20
<212> DNA
<213> Artificial sequence
<400> 71
<210> 72
<211> 20
<212> DNA
<213> Artificial sequence
<400> 72
<210> 73
<211> 20
<212> DNA
<213> Artificial sequence
<400> 73
<210> 74
<211> 20
<212> DNA
<213> Artificial sequence
<400> 74
<210> 75
<211> 20
<212> DNA
<213> Artificial sequence
<400> 75
<210> 76
<211> 20
<212> DNA
<213> Artificial sequence
<400> 76
<210> 77
<211> 20
<212> DNA
<213> Artificial sequence
<400> 77
<210> 78
<211> 20
<212> DNA
<213> Artificial sequence
<400> 78
<210> 79
<211> 20
<212> DNA
<213> Artificial sequence
<400> 79
<210> 80
<211> 20
<212> DNA
<213> Artificial sequence
<400> 80
<210> 81
<211> 20
<212> DNA
<213> Artificial sequence
<400> 81
<210> 82
<211> 20
<212> DNA
<213> Artificial sequence
<400> 82
<210> 83
<211> 20
<212> DNA
<213> Artificial sequence
<400> 83
<210> 84
<211> 20
<212> DNA
<213> Artificial sequence
<400> 84
<210> 85
<211> 20
<212> DNA
<213> Artificial sequence
<400> 85
<210> 86
<211> 20
<212> DNA
<213> Artificial sequence
<400> 86
<210> 87
<211> 20
<212> DNA
<213> Artificial sequence
<400> 87
<210> 88
<211> 20
<212> DNA
<213> Artificial sequence
<400> 88
<210> 89
<211> 20
<212> DNA
<213> Artificial sequence
<400> 89
<210> 90
<211> 20
<212> DNA
<213> Artificial sequence
<400> 90
<210> 91
<211> 20
<212> DNA
<213> Artificial sequence
<400> 91
<210> 92
<211> 20
<212> DNA
<213> Artificial sequence
<400> 92
<210> 93
<211> 20
<212> DNA
<213> Artificial sequence
<400> 93
<210> 94
<211> 20
<212> DNA
<213> Artificial sequence
<400> 94
<210> 95
<211> 20
<212> DNA
<213> Artificial sequence
<400> 95
<210> 96
<211> 20
<212> DNA
<213> Artificial sequence
<400> 96
<210> 97
<211> 20
<212> DNA
<213> Artificial sequence
<400> 97
<210> 98
<211> 20
<212> DNA
<213> Artificial sequence
<400> 98
<210> 99
<211> 20
<212> DNA
<213> Artificial sequence
<400> 99
<210> 100
<211> 20
<212> DNA
<213> Artificial sequence
<400> 100
Claims (10)
1. A method for constructing a mammalian cell disease model, comprising the steps of:
firstly, arranging the variation position and gene name information of C-to-T or G-to-A mononucleotide of a ClinVar database in NCBI by using a bioinformatics method, and designing gRNA for constructing a related disease cell model according to the screening principle of related gene targets; wherein the screening principle is as follows: a. the PAM area is NGG; b. c range of mutation selected in the editing window is 3 to 9 bits; c. excluding surrounding cs, i.e. cs within the editing window that are other than the mutant have no other cs;
and a second step of introducing the gRNA designed in the first step into animal cells and performing gene editing on a target gene, wherein the second step comprises the following steps:
s1, constructing gRNA plasmids by applying a nanoliter pipetting workstation method;
s2, co-transferring the gRNA plasmid obtained in the step S1 and the base editor plasmid containing the fluorescent protein gene into mammalian cells by using a liquid processing workstation, culturing and screening through an additional medicament, collecting a sample, sequencing, and analyzing editing efficiency;
s3 a disease cell model with the target mutation is obtained using flow cytometry sorting monoclone.
2. The method of claim 1, wherein in step S1, a plasmid vector with ccdb gene sequence and drug selection marker is digested with BsaI, and then ligated with T4 DNA ligase to the gRNA sequence with BsaI cleavage site and targeting the target gene, and the ligation product is purified to obtain the gRNA plasmid vector.
3. The method of claim 1, wherein in step S1, the gold gate system is formulated using a sonar pipetting station Echo.
4. The method of claim 1, wherein in step S1, the gold gate system is 1 ul.
5. The method of claim 1, wherein the drug selection marker in step S1 is a puromycin drug selection marker; the drug added in step S2 is puromycin.
6. The method of claim 1, wherein in step S2, the cloning vector obtained in step S1 and GFP-tagged BE4max are co-transferred into mammalian cells by PEI, followed by additional drug selection and collection of sequencing.
7. The method of claim 1, wherein in step S2, the mammalian cells are human cells.
8. The method of claim 7, wherein the human cell is Hela or HEK 293T.
9. The method of claim 1, wherein in step S2, the liquid treatment workstation i7 is used for cell plating, transfection, liquid exchange and collection.
10. The method of claim 1, wherein the cells obtained in step S2 are analyzed for editing efficiency according to the sequencing results, the cells with editing efficiency are sorted by flow cytometry, HEK293T monoclonal cells with fluorescence are selected, amplified, and sequenced to verify the disease model cells storing C-T single nucleotide mutations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210360423.9A CN114438039A (en) | 2022-04-07 | 2022-04-07 | High-throughput construction method of mammal cell disease model |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210360423.9A CN114438039A (en) | 2022-04-07 | 2022-04-07 | High-throughput construction method of mammal cell disease model |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114438039A true CN114438039A (en) | 2022-05-06 |
Family
ID=81358539
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210360423.9A Pending CN114438039A (en) | 2022-04-07 | 2022-04-07 | High-throughput construction method of mammal cell disease model |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114438039A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020257205A1 (en) * | 2019-06-17 | 2020-12-24 | Cedars-Sinai Medical Center | SYSTEMS AND METHODS FOR IN VIVO DUAL RECOMBINASE-MEDIATED CASSETTE EXCHANGE (dRMCE) AND DISEASE MODELS THEREOF |
| CN112979822A (en) * | 2019-12-18 | 2021-06-18 | 华东师范大学 | Construction method of disease animal model and fusion protein |
| CN113403341A (en) * | 2021-06-21 | 2021-09-17 | 南京医科大学 | TALE assembly-based mitochondrial DNA editing system |
| US20210389303A1 (en) * | 2020-06-12 | 2021-12-16 | David Brafman | Transient reporters and methods for base editing enrichment |
-
2022
- 2022-04-07 CN CN202210360423.9A patent/CN114438039A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020257205A1 (en) * | 2019-06-17 | 2020-12-24 | Cedars-Sinai Medical Center | SYSTEMS AND METHODS FOR IN VIVO DUAL RECOMBINASE-MEDIATED CASSETTE EXCHANGE (dRMCE) AND DISEASE MODELS THEREOF |
| CN112979822A (en) * | 2019-12-18 | 2021-06-18 | 华东师范大学 | Construction method of disease animal model and fusion protein |
| US20210389303A1 (en) * | 2020-06-12 | 2021-12-16 | David Brafman | Transient reporters and methods for base editing enrichment |
| CN113403341A (en) * | 2021-06-21 | 2021-09-17 | 南京医科大学 | TALE assembly-based mitochondrial DNA editing system |
Non-Patent Citations (6)
| Title |
|---|
| GUPTA等: "CRISPR/Cas9-based Targeted Genome Editing for the Development of Monogenic Diseases Models with Human Pluripotent Stem Cells", 《CURR PROTOC STEM CELL BIOL》 * |
| LIU等: "Highly efficient RNA-guided base editing in rabbit", 《NATURE COMMUNICATIONS 》 * |
| SONG等: "Sequence-specific prediction of the efficiencies of adenine and cytosine base editors", 《NAT BIOTECHNOL》 * |
| WANG等: "CRISPR/Cas9-Based Genome Editing for Disease Modeling and Therapy: Challenges and Opportunities for Nonviral Delivery", 《CHEM. REV.》 * |
| 李国玲等: "提高CRISPR/Cas9介导的动物基因组精确插入效率研究进展", 《遗传》 * |
| 雷鸣: "《国家蛋白质科学研究（上海）设施的设计与研制》", 31 December 2018, 上海科学技术出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ravikumar et al. | An orthogonal DNA replication system in yeast | |
| US20180327740A1 (en) | High-throughput crispr-based library screening | |
| US20180258421A1 (en) | Compositions, methods and uses for multiplex protein sequence activity relationship mapping | |
| CN109880851B (en) | Screening report vector and screening method for enriching CRISPR/Cas 9-mediated homologous recombination repair cells | |
| Canaj et al. | Deep profiling reveals substantial heterogeneity of integration outcomes in CRISPR knock-in experiments | |
| CN109321584B (en) | Report system for simply qualitatively/quantitatively detecting working efficiency of single-base gene editing technology | |
| US20230151421A1 (en) | Method for determining cell clonality | |
| CN1399684A (en) | Methods of manipulating and sequencing nucleic acid molecules using transposition and recombination | |
| Robertson et al. | Creating custom synthetic genomes in Escherichia coli with REXER and GENESIS | |
| CN108424907B (en) | High-throughput DNA multi-site accurate base mutation method | |
| Schmieder et al. | A pooled CRISPR/AsCpf1 screen using paired gRNAs to induce genomic deletions in Chinese hamster ovary cells | |
| CN114438039A (en) | High-throughput construction method of mammal cell disease model | |
| Frendewey et al. | The loss-of-allele assay for ES cell screening and mouse genotyping | |
| CN114854723A (en) | Rice uracil DNA glycosidase and application thereof in inducing single base diversity of plants through gene editing | |
| CN111793623B (en) | Genotyping genetic marker composition, kit, identification system and genotyping method for 62 multiallelic SNP-NGS | |
| CN115125295A (en) | Genotyping standard substance for multi-site sustainable use | |
| Hamaker | Development of site-specific integration strategies and characterization of protein expression instability to improve CHO cell line engineering | |
| CN108642203B (en) | SNP (Single nucleotide polymorphism) marker related to millet stem thickness character as well as detection primer and application thereof | |
| CN113667714A (en) | Target area capturing method, kit and sequencing method | |
| KR102538189B1 (en) | A primer set for detecting active transposon PTE-3 in Chinese cabbage transformants | |
| CN117106758B (en) | RiCBE system for realizing C/G to T/A editing on gC motif of DNA | |
| Rudolph | Applications of recombineering and recoded genome construction | |
| WO2023236618A1 (en) | Pe-stop gene editing system, gene knockout method, and use | |
| Wan et al. | High-throughput protein engineering by massively parallel combinatorial mutagenesis | |
| CN116286740A (en) | Base editor, guide editor, construction and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |