CN114410807B - Haplotype molecular marker related to duck egg yield and application thereof - Google Patents
Haplotype molecular marker related to duck egg yield and application thereof Download PDFInfo
- Publication number
- CN114410807B CN114410807B CN202210272221.9A CN202210272221A CN114410807B CN 114410807 B CN114410807 B CN 114410807B CN 202210272221 A CN202210272221 A CN 202210272221A CN 114410807 B CN114410807 B CN 114410807B
- Authority
- CN
- China
- Prior art keywords
- seq
- duck
- egg laying
- base
- snp1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Abstract
The invention discloses a haplotype molecular marker related to duck egg laying number and application thereof, belonging to the field of molecular genetics, wherein the haplotype molecular marker comprises 5 SNP loci including SNP1-SNP5, and relates to 5 segments of TRPM3 gene fragments related to the egg laying number, and the nucleotide sequences of the haplotype molecular marker are respectively shown as sequence tables SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO. 5. The haplotype molecular marker related to the duck egg laying characteristics is used for distinguishing high-laying duck individuals from low-laying duck individuals, and the method for detecting the haplotype molecular marker can be used for predicting the duck egg laying characteristics early, quickly and effectively with low cost, provides an effective means for auxiliary selection breeding of the duck molecular marker, has wide application prospect in the aspect of improvement of duck species, and can obtain excellent economic value.
Description
Technical Field
The invention relates to the field of molecular genetics, in particular to a haplotype molecular marker related to duck egg laying number and application thereof.
Background
Ducks are one of the most important agricultural livestock animals. The duck meat and the duck egg provide important animal protein sources for human beings, and meanwhile, due to improvement of human health concepts, the red meat consumption requirements represented by pigs, cattle and sheep tend to be stable, and the duck egg consumption requirements are steadily improved. Therefore, the genetic improvement of the high-quality laying duck variety is quickened, and great economic benefit is achieved.
SNP has been widely used as a genetic marker in research fields such as gene localization, cloning, genetic breeding, and genetic diversity. However, due to the genetic background differences of different experimental groups, the interference of factors such as founder effect, polygene interaction effect, gene-environment interaction effect, incomplete selection/balance selection effect, quantitative restriction of genetic markers, linkage disequilibrium and the like, the molecular markers with definite functions and remarkable effects still lack in the current molecular breeding practice of the laying ducks. Therefore, the mining of powerful, accurate molecular markers that are common in the middle and outer population is the current focus of research.
Transient receptor potential ion channel 3 (TRPM 3) is a member of the transient receptor potential ion channel (TRP) cation channel family that mediates the entry of calcium, magnesium, zinc, etc. ions into cells. Studies have shown that TRPM3 expression is significantly increased in epithelial ovarian cancer tissue compared to normal ovarian tissue. In the detection of TRPM3 gene expression in ovarian tissues of ducks with different egg-laying levels, the expression level of TRPM3 in high egg-laying groups is higher than that in low egg-laying groups. TRPM3 is suggested to play an important role in regulating duck egg laying. However, the relation between the mutation and the gene is not reported yet. If SNP molecular markers related to the duck egg laying number traits can be found, the genetic improvement of ducks is greatly promoted, and breakthrough progress is brought to the field of poultry breeding.
Disclosure of Invention
The invention aims to provide a haplotype molecular marker related to the egg laying number of ducks and application thereof, so as to solve the problems in the prior art, and the molecular marker can provide a rapid, simple and low-cost gene analysis method for early egg laying character detection of ducks, is beneficial to screening out individuals with high egg laying characters and guides early molecular marker auxiliary breeding of the ducks.
In order to achieve the above object, the present invention provides the following solutions:
the invention provides a haplotype molecular marker related to duck egg laying performance, which comprises 5 SNP loci in total of SNP1-SNP 5;
wherein, the gene position of SNP1 is 171bp of the sequence shown in SEQ ID NO.1, and the base at the position is G or A;
the gene position of SNP2 is 53bp of the sequence shown in SEQ ID NO.2, and the base at the position is A or G;
the gene position of SNP3 is 102bp of the sequence shown in SEQ ID NO.3, and the base at the position is C or T;
the gene position of SNP4 is 80bp of the sequence shown in SEQ ID NO.4, and the base at the position is G or A;
the SNP5 is located at a gene position of 70bp of a sequence shown as SEQ ID NO.5, and the base at the position is A or C.
Further, when the haplotype molecular markers are GACGA homozygous genotypes according to SNP1-SNP5, the corresponding ducks have high egg laying properties; when the haplotype molecular markers are AGTAC homozygous genotypes according to SNP1-SNP5, the corresponding ducks have low egg laying properties.
The invention also provides a primer combination for amplifying the haplotype molecular marker related to the duck egg laying character, which comprises 5 pairs of primers for amplifying SNP1-SNP5, wherein the sequences of the primers are as follows:
SNP1：
upstream primer sequence 1:5'-cacactagttcattgtgagtacag-3' the number of the individual pieces of the plastic,
downstream primer sequence 1:5'-attttgtttacttgaggactggtc-3' the number of the individual pieces of the plastic,
SNP2：
upstream primer sequence 2:5'-tatccattcatagctactgaaggc-3' the number of the individual pieces of the plastic,
downstream primer sequence 2:5'-cgatatcttagcacagctgttaag-3' the number of the individual pieces of the plastic,
SNP3：
upstream primer sequence 3:5'-agagtaggtcattgcaattcattg-3' the number of the individual pieces of the plastic,
upstream primer sequence 3:5'-tttgtcagataactcaaacaccag-3' the number of the individual pieces of the plastic,
SNP4：
upstream primer sequence 4:5'-aaagacctttttaaagttcccctc-3' the number of the individual pieces of the plastic,
downstream primer sequence 4:5'-tatctctgctaccccttttaagtc-3' the number of the individual pieces of the plastic,
SNP5：
upstream primer sequence 5:5'-tattccacctgaattgctaacaag-3' the number of the individual pieces of the plastic,
upstream primer sequence 5:5'-catcattaaattccttgacactgc-3'.
The invention also provides a detection reagent or a kit containing the primer combination.
The invention also provides application of the haplotype molecular marker, the primer combination or the detection reagent or the kit in identification and early screening of duck egg laying traits.
The invention also provides a method for identifying or early predicting duck egg laying characteristics by utilizing the haplotype molecular markers, which comprises the following steps:
1) Extracting genome DNA of a duck to be detected;
2) Taking genomic DNA of a duck to be detected as a template, designing a primer combination for amplifying the haplotype molecular marker, and performing PCR amplification reaction;
3) The PCR amplification products were analyzed.
Further, the primer combination used in step 2) is the primer combination as described above.
The invention also provides application of the haplotype molecular marker, the primer combination or the detection reagent or the kit in duck molecular marker assisted breeding.
The invention discloses the following technical effects:
the invention discloses a haplotype molecular marker related to duck egg laying number and application thereof. Amplifying sex chromosome Z from female duck genome, sequencing to obtain 5 SNP of TRPM3 gene related to duck egg laying number, and referring to 5 sections of gene fragments related to egg laying number, wherein the nucleotide sequences of the gene fragments are respectively shown in sequence tables SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, the molecular markers are that the 171 th bp of SEQ ID NO.1 is subjected to G171A base mutation, the 53 th bp of SEQ ID NO.2 is subjected to A53G base mutation, the 102 th bp of SEQ ID NO.3 is subjected to C102T base mutation, the 80 th bp of SEQ ID NO.4 is subjected to G80A base mutation, and the 70 th bp of SEQ ID NO.5 is subjected to A70C base mutation. The SNPs and haplotypes obtained by the invention can be used as early molecular markers of the duck egg laying number and used for early auxiliary breeding of the duck egg laying number.
The haplotype molecular marker related to the duck egg laying characteristics is used for distinguishing high-laying duck individuals from low-laying duck individuals, and the method for detecting the haplotype molecular marker can be used for predicting the duck egg laying characteristics early, quickly and effectively with low cost, provides an effective means for auxiliary selective breeding of the duck molecular marker, has wide application prospect in the aspect of improvement of duck species, and can obtain excellent economic value.
Detailed Description
Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.
Example 1
The golden female ducks are bred on the ground from 0 days old, and transferred to cages for breeding after 100 days, each duck is bred in one cage position, and the egg laying condition of each duck is observed and recorded. Counting the egg laying number of each duck from the day of laying to 300d, taking blood from the wing vein, and placing the duck into a 2ml EP tube containing anticoagulant for extracting genome DNA. And detecting the sample quality by agarose gel electrophoresis and a biological spectrophotometer. The gel electrophoresis strip is clear, and no tailing phenomenon exists; OD260/280 = 1.8 is about a quality-acceptable sample, which is used for subsequent high-throughput sequencing.
The nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5 are amplified by PCR, and the sequence information of the used primer pairs is as follows:
SEQ NO.1: the length is 229bp, and a g/a mutation is arranged at 171bp of the sequence.
cacactagttcattgtgagtacagggtatgtctatgtgtagcatgtacatttcactaacgataaactgtgaagagctttgatcatgct aacaggactaaaactcttgctatttaattataaaaacagataaaatatcattcaatcattaacatatcttaacaaaaaaaatg/acagagcc caaaactgtcctggttttgtgtcaatgaccagtcctcaagtaaacaaaat
SEQ ID NO.2: 222bp in length, and a g/a mutation at the 53 th bp of the sequence.
tatccattcatagctactgaaggcaggtaaggctacagacagcaatttgttca/gcttgttcaaggcaatggtgacatctagcgat accataacactgaggccacacctcttaaaaaaaaaaaaaaaaaaaaaagcactttgataccctatcaagaattgaaagaaaagattct gcaacctgagaaaaacaaccatttcttaacagctgtgctaagatatcg
SEQ ID NO.3: the length is 229bp, and a g/a mutation is arranged at the 102bp of the sequence.
agagtaggtcattgcaattcattgactgaggactcagcctgtcaaggcctggcagtggcccagctctgcagttatcctcaaata actggatagcagataatc/tcacttcagatagactctagaaatgcattgtgttgggttatagttaagaattcttgtttcatctgtgtgtcagta cttattatgtgcccttagaacaataattctggtgtttgagttatctgacaaa
SEQ ID NO.4: the length is 219bp, and a g/a mutation is arranged at the 80 th bp of the sequence.
aaagacctttttaaagttcccctcataattaccttattcattctctcactagttccatgtttacctgtctggagtcttcg/acacaactgt cttctccaacacattttgagtaaaaactaactttacatgtaatttacttctcaactgaaattctgctctcctccctgctcccctgagccctacg cataagaaagtgacttaaaaggggtagcagagata
SEQ ID NO.5: the length is 204bp, and a g/a mutation is arranged at the 70bp of the sequence.
tattccacctgaattgctaacaagactatgctacagtgtgtaaaaagaaatgcccttgggtatcactgga/caatttgtgtcaaag atgataataaagcatagaataatatcgattcatcaaaaatatctttcatccccaaataatataatgacatgaagcagtctgacaaagtgctt ttagcagtgtcaaggaatttaatgatg
Upstream primer sequence 1:5'-cacactagttcattgtgagtacag-3' (SEQ ID NO. 6)
Downstream primer sequence 1:5'-attttgtttacttgaggactggtc-3' (SEQ ID NO. 7)
Upstream primer sequence 2:5'-tatccattcatagctactgaaggc-3' (SEQ ID NO. 8)
Downstream primer sequence 2:5'-cgatatcttagcacagctgttaag-3' (SEQ ID NO. 9)
Upstream primer sequence 3:5'-agagtaggtcattgcaattcattg-3' (SEQ ID NO. 10)
Upstream primer sequence 3:5'-tttgtcagataactcaaacaccag-3' (SEQ ID NO. 11)
Upstream primer sequence 4:5'-aaagacctttttaaagttcccctc-3' (SEQ ID NO. 12)
Downstream primer sequence 4:5'-tatctctgctaccccttttaagtc-3' (SEQ ID NO. 13)
Upstream primer sequence 5:5'-tattccacctgaattgctaacaag-3' (SEQ ID NO. 14)
Upstream primer sequence 5:5'-catcattaaattccttgacactgc-3'. (SEQ ID NO. 15)
And amplifying the sample by adopting a multiple PCR method, wherein the first round of PCR configuration method is to prepare PCR mix by three pairs of primer working solutions, and split-charging the PCR mix into 96-well plates corresponding to each individual. Sample plates were fully thawed, shaken, centrifuged at 1000rpm for 1s and loaded. 2 wells were reserved per plate during loading, and positive and negative controls were added separately.
One round of amplification system was Primer (50 nM) 2. Mu.L, dNTP (2.5 mM) 08. Mu.L, taq enzyme (5U/. Mu.L) 0.1. Mu.L, 10 Xbuffer 1. Mu.L, genomic DNA (20 ng/. Mu.L) 2. Mu.L, mg 2+ (100 mM) 1. Mu.L, paraffin oil 10. Mu.L, ddH 2 O3.2. Mu.L, total 20. Mu.L.
The first round PCR reaction conditions were as follows: (1) 15min at 95 ℃ and 1cycle; (2) 94 ℃ for 30s,60 ℃ for 10min,4cycles; (3) 94℃30s,60℃1min,72℃30s,20cycles.
The second round PCR amplification system is that ddH is added to each hole of the product of one round 2 O100. Mu.L, and the mixture was centrifuged instantaneously and allowed to stand at room temperature for 10min. The dilution is used as a two-round amplification template, the amplification system is Barcode (2 mu M) 3.6 mu L, dNTP (2.5 mM) 0.8 mu L, taq enzyme (5U/. Mu.L) 0.1 mu L, and one-round product sample is 10 mu L, mg 2+ (100mM)1μL，10X buffer 2μL，ddH 2 O3.6. Mu.L, paraffin oil 20. Mu.L, total system 40. Mu.L.
The second round of PCR amplification reaction conditions were: (1) 15min at 95 ℃ and 1cycle; (2) 94 ℃ for 30s,60 ℃ for 4min and 5cycles; (3) 94℃30s,65℃1min,72℃30s,10cycles.
Mixing the products obtained by the two rounds of amplification, purifying the library after mixing, precisely quantifying the purified products and diluting to the concentration (10 ng/. Mu.L) required by sequencing.
The quantified purified product was subjected to high throughput sequencing by Shanghai wing and biosystems, inc. using an Illumina X-10 sequencing platform.
The method comprises the steps of obtaining 5 mutation sites after sequencing, classifying and summarizing the information of the 5 mutation sites obtained after sequencing by adopting a bioinformatics method, obtaining the information of each mutation site of each sample, obtaining 5 SNP sites which are most obviously related to duck egg laying properties, wherein the 5 SNP sites are all positioned on a Z chromosome of a sex chromosome of a duck, the mutation of nucleotide G-A at 43825, the mutation of nucleotide A-G at 67104, the mutation of nucleotide C-T at 93849bp, the mutation of nucleotide G-A at 245500, the mutation of nucleotide A-C at 282683, and the common detection of haplotypes consisting of 5 SNPs in the golden duck population, namely AGTAC, AATGA and GACGTAC, wherein AGTAC is a complete mutation haplotype, AATGA is a partial mutation haplotype and GACGA is a wild haplotype.
Correlation analysis is carried out on 5 SNPs, 3 haplotypes and 300-day-old Jinding duck egg laying numbers by using a general linear model of SAS 9.0 software, the correlation analysis results are shown in tables 1 and 2, and the data are presented in a mean + -S.D mode.
TABLE 15 correlation analysis of TRPM3 SNPs and egg numbers of 300-day-old Jinding ducks
Note that: the differences between genotypes at the same site are marked by different shoulder marks.
Table 2 3 correlation analysis of TRPM3 haplotypes and egg number of 300-day-old Jinding ducks
Note that: the differences between haplotypes of the same character are obviously represented by different shoulder marks.
As can be seen from Table 1, the genotype frequencies of 5 SNPs of TRPM3 of the Jinding duck are respectively 0.64, 0.71, 0.61, 0.71 and 0.71, which are higher than the genotype frequencies of mutant genes of 0.36, 0.29, 0.39, 0.29 and 0.29, and the average egg numbers 125.98, 124.76, 125.98, 124.76 and 124.76 of the wild type at 300 days are obviously higher than the egg numbers 112.88, 111.73, 113.33, 111.73 and 111.73 (P < 0.05) of the mutant at 300 days, so that the wild genotypes at the sites are dominant genotypes and can be used for breeding of the early egg-laying characteristics of the Jinding duck.
As can be seen from table 2, the GACGA haplotype frequency of the Jinding duck TRPM3 is highest, 0.64, the average egg count at 300 days old is 125.98, and the wild haplotype is the dominant genotype; the frequency of AGTAC haplotypes is 0.250, the number of eggs laid at 300 days old is 110.72, which is obviously lower than that of GACGA haplotypes, which indicates that the complete mutant genotype is not beneficial to the exertion of the egg laying performance of the Jinding ducks.
The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.
Sequence listing
<110> Jiangsu province poultry science institute
<120> a molecular marker of haplotype related to egg number of duck and application thereof
<160> 15
<170> SIPOSequenceListing 1.0
<210> 1
<211> 228
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
cacactagtt cattgtgagt acagggtatg tctatgtgta gcatgtacat ttcactaacg 60
ataaactgtg aagagctttg atcatgctaa caggactaaa actcttgcta tttaattata 120
aaaacagata aaatatcatt caatcattaa catatcttaa caaaaaaaat gcagagccca 180
aaactgtcct ggttttgtgt caatgaccag tcctcaagta aacaaaat 228
<210> 2
<211> 220
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
tatccattca tagctactga aggcaggtaa ggctacagac agcaatttgt tcacttgttc 60
aaggcaatgg tgacatctag cgataccata acactgaggc cacacctctt aaaaaaaaaa 120
aaaaaaaaaa aagcactttg ataccctatc aagaattgaa agaaaagatt ctgcaacctg 180
agaaaaacaa ccatttctta acagctgtgc taagatatcg 220
<210> 3
<211> 228
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
agagtaggtc attgcaattc attgactgag gactcagcct gtcaaggcct ggcagtggcc 60
cagctctgca gttatcctca aataactgga tagcagataa tccacttcag atagactcta 120
gaaatgcatt gtgttgggtt atagttaaga attcttgttt catctgtgtg tcagtactta 180
ttatgtgccc ttagaacaat aattctggtg tttgagttat ctgacaaa 228
<210> 4
<211> 218
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
aaagaccttt ttaaagttcc cctcataatt accttattca ttctctcact agttccatgt 60
ttacctgtct ggagtcttcg cacaactgtc ttctccaaca cattttgagt aaaaactaac 120
tttacatgta atttacttct caactgaaat tctgctctcc tccctgctcc cctgagccct 180
acgcataaga aagtgactta aaaggggtag cagagata 218
<210> 5
<211> 203
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
tattccacct gaattgctaa caagactatg ctacagtgtg taaaaagaaa tgcccttggg 60
tatcactgga aatttgtgtc aaagatgata ataaagcata gaataatatc gattcatcaa 120
aaatatcttt catccccaaa taatataatg acatgaagca gtctgacaaa gtgcttttag 180
cagtgtcaag gaatttaatg atg 203
<210> 6
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
cacactagtt cattgtgagt acag 24
<210> 7
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
attttgttta cttgaggact ggtc 24
<210> 8
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
tatccattca tagctactga aggc 24
<210> 9
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
cgatatctta gcacagctgt taag 24
<210> 10
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
agagtaggtc attgcaattc attg 24
<210> 11
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
tttgtcagat aactcaaaca ccag 24
<210> 12
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
aaagaccttt ttaaagttcc cctc 24
<210> 13
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
tatctctgct acccctttta agtc 24
<210> 14
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
tattccacct gaattgctaa caag 24
<210> 15
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
catcattaaa ttccttgaca ctgc 24
Claims (4)
1. Application of a haplotype molecular marker related to duck egg laying performance in identifying and early screening duck egg laying characteristics, wherein the haplotype molecular marker related to duck egg laying performance comprises 5 SNP loci including SNP1-SNP 5;
wherein, the gene position of SNP1 is 171bp of the sequence shown in SEQ ID NO.1, and the base at the position is G or A;
the gene position of SNP2 is 53bp of the sequence shown in SEQ ID NO.2, and the base at the position is A or G;
the gene position of SNP3 is 102bp of the sequence shown in SEQ ID NO.3, and the base at the position is C or T;
the gene position of SNP4 is 80bp of the sequence shown in SEQ ID NO.4, and the base at the position is G or A;
the gene position of SNP5 is 70bp of the sequence shown in SEQ ID NO.5, and the base at the position is A or C;
when the haplotype molecular markers are GACGA homozygous genotypes according to SNP1-SNP5, the corresponding ducks have high egg laying properties; when the haplotype molecular markers are AGTAC homozygous genotypes according to SNP1-SNP5, the corresponding ducks have low egg laying properties.
2. The method for identifying or early predicting the duck egg laying characteristics by utilizing the haplotype molecular markers related to the duck egg laying performance is characterized by comprising the following steps of:
1) Extracting genome DNA of a duck to be detected;
2) Taking genomic DNA of a duck to be detected as a template, designing a primer combination for amplifying the haplotype molecular marker, and performing PCR amplification reaction;
3) Analyzing the PCR amplification product;
the haplotype molecular marker comprises 5 SNP loci in total of SNP1-SNP 5;
wherein, the gene position of SNP1 is 171bp of the sequence shown in SEQ ID NO.1, and the base at the position is G or A;
the gene position of SNP2 is 53bp of the sequence shown in SEQ ID NO.2, and the base at the position is A or G;
the gene position of SNP3 is 102bp of the sequence shown in SEQ ID NO.3, and the base at the position is C or T;
the gene position of SNP4 is 80bp of the sequence shown in SEQ ID NO.4, and the base at the position is G or A;
the gene position of SNP5 is 70bp of the sequence shown in SEQ ID NO.5, and the base at the position is A or C;
when the haplotype molecular markers are GACGA homozygous genotypes according to SNP1-SNP5, the corresponding ducks have high egg laying properties; when the haplotype molecular markers are AGTAC homozygous genotypes according to SNP1-SNP5, the corresponding ducks have low egg laying properties.
3. The method according to claim 2, wherein the sequence of the primer combination used in step 2) is:
SNP1：
upstream primer sequence 1:5'-cacactagttcattgtgagtacag-3' the number of the individual pieces of the plastic,
downstream primer sequence 1:5'-attttgtttacttgaggactggtc-3' the number of the individual pieces of the plastic,
SNP2：
upstream primer sequence 2:5'-tatccattcatagctactgaaggc-3' the number of the individual pieces of the plastic,
downstream primer sequence 2:5'-cgatatcttagcacagctgttaag-3' the number of the individual pieces of the plastic,
SNP3：
upstream primer sequence 3:5'-agagtaggtcattgcaattcattg-3' the number of the individual pieces of the plastic,
upstream primer sequence 3:5'-tttgtcagataactcaaacaccag-3' the number of the individual pieces of the plastic,
SNP4：
upstream primer sequence 4:5'-aaagacctttttaaagttcccctc-3' the number of the individual pieces of the plastic,
downstream primer sequence 4:5'-tatctctgctaccccttttaagtc-3' the number of the individual pieces of the plastic,
SNP5：
upstream primer sequence 5:5'-tattccacctgaattgctaacaag-3' the number of the individual pieces of the plastic,
upstream primer sequence 5:5'-catcattaaattccttgacactgc-3'.
4. Application of a haplotype molecular marker related to duck egg laying performance in auxiliary breeding of duck molecular markers, wherein the haplotype molecular marker related to duck egg laying performance comprises 5 SNP loci including SNP1-SNP 5;
wherein, the gene position of SNP1 is 171bp of the sequence shown in SEQ ID NO.1, and the base at the position is G or A;
the gene position of SNP2 is 53bp of the sequence shown in SEQ ID NO.2, and the base at the position is A or G;
the gene position of SNP3 is 102bp of the sequence shown in SEQ ID NO.3, and the base at the position is C or T;
the gene position of SNP4 is 80bp of the sequence shown in SEQ ID NO.4, and the base at the position is G or A;
the gene position of SNP5 is 70bp of the sequence shown in SEQ ID NO.5, and the base at the position is A or C;
when the haplotype molecular markers are GACGA homozygous genotypes according to SNP1-SNP5, the corresponding ducks have high egg laying properties; when the haplotype molecular markers are AGTAC homozygous genotypes according to SNP1-SNP5, the corresponding ducks have low egg laying properties.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210272221.9A CN114410807B (en) | 2022-03-18 | 2022-03-18 | Haplotype molecular marker related to duck egg yield and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210272221.9A CN114410807B (en) | 2022-03-18 | 2022-03-18 | Haplotype molecular marker related to duck egg yield and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114410807A CN114410807A (en) | 2022-04-29 |
| CN114410807B true CN114410807B (en) | 2023-08-01 |
Family
ID=81263859
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210272221.9A Active CN114410807B (en) | 2022-03-18 | 2022-03-18 | Haplotype molecular marker related to duck egg yield and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114410807B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109628613B (en) * | 2019-01-18 | 2022-02-11 | 湖北省农业科学院畜牧兽医研究所 | Molecular marker related to egg laying and egg quality traits of laying ducks and application thereof |
-
2022
- 2022-03-18 CN CN202210272221.9A patent/CN114410807B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114410807A (en) | 2022-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fontanesi et al. | Authentication of “mono-breed” pork products: Identification of a coat colour gene marker in Cinta Senese pigs useful to this purpose | |
| CN114457170B (en) | DNAJC30 gene molecular marker related to chicken carcass traits and application thereof | |
| CN109852719B (en) | Molecular marker for detecting gibberellic disease resistant QTL Qfhb. hbaas-5AL and using method | |
| CN109797241B (en) | Molecular marker for detecting gibberellic disease resistant QTL Qfhb. hbaas-5AS and using method | |
| CN114457171B (en) | Haplotype molecular marker related to reproductive performance of laying ducks and application thereof | |
| Kamara et al. | Microsatellite marker-based genetic analysis of relatedness between commercial and heritage turkeys (Meleagris gallopavo) | |
| CN114410807B (en) | Haplotype molecular marker related to duck egg yield and application thereof | |
| KR20200057632A (en) | Marker for discrimination of resistance to tomato yellow leaf curl virus and discrimination method using the same marker | |
| CN106929570B (en) | Method for identifying bull variety by using cattle Y chromosome mononucleotide genetic marker | |
| Jamshidi et al. | Exon 2 Ovar-DRB1 gene polymorphism in the Iranian Sangsari sheep | |
| Shin et al. | Genetic association of phosphodiesterase 1B (PDE1B) with carcass traits in Korean cattle | |
| CN114350818A (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| CN113789395A (en) | Method for identifying source of bull ruminants by utilizing Y chromosome mononucleotide genetic markers | |
| Khobra et al. | Major Histocompatibility class II DRB3 exon 2 polymorphism and resistance to gastrointestinal nematodes in Jamunapari goats | |
| CN113186299A (en) | Trachinotus ovatus cryptocaryon irritans disease associated SNP molecular marker, primer and application thereof | |
| CN112176073A (en) | PROS1 gene molecular marker related to chicken carcass traits and application | |
| CN112210607A (en) | Molecular marker related to buffalo white hair phenotype and application thereof | |
| Hilmia et al. | Single nucleotide polymorphism on exon 2 leptin gene of pasundan cattle | |
| CN116162714B (en) | Haplotype molecular marker related to intramuscular fat traits of pigs in SYK gene and application | |
| CN114561475B (en) | Method for breeding chicken by molecular marker, application and kit thereof | |
| Sultana et al. | Expression of coat colour gene, MC1R in cattle | |
| KR101557407B1 (en) | Method and Kit for identification of Korean cattle | |
| Ulum et al. | A single nucleotide polymorphism of CAPN1 gene region 3’UTR in Bali cattle | |
| CN108277286B (en) | Pig IGF1R gene molecular marker and special primer thereof | |
| KR102061943B1 (en) | Microsatellite Markers for Individualization in Martes flavigula and Individualizing Method Using the Same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |