CN114404613B - Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle - Google Patents
Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle Download PDFInfo
- Publication number
- CN114404613B CN114404613B CN202111532267.1A CN202111532267A CN114404613B CN 114404613 B CN114404613 B CN 114404613B CN 202111532267 A CN202111532267 A CN 202111532267A CN 114404613 B CN114404613 B CN 114404613B
- Authority
- CN
- China
- Prior art keywords
- aptamer
- synovial
- cells
- nucleic acid
- chondrocytes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
- A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
- A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
- A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
- A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P39/00—General protective or antinoxious agents
- A61P39/06—Free radical scavengers or antioxidants
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Biochemistry (AREA)
- Rheumatology (AREA)
- Immunology (AREA)
- Physical Education & Sports Medicine (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Molecular Biology (AREA)
- Nanotechnology (AREA)
- Pain & Pain Management (AREA)
- Toxicology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicinal Preparation (AREA)
Abstract
The invention discloses a construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticles, comprising the following steps: s1, respectively constructing culture systems of mouse synovial fibroblasts and chondrocytes for later use; s2, synthesizing a random nucleic acid aptamer library, wherein the sequence of the random nucleic acid aptamer library is shown as SEQ ID NO. 1; s3, screening: the synovial fibroblasts constructed in the step S1 are taken as positive sieve CELLs, the chondrocytes are taken as negative sieve CELLs, the random aptamer library synthesized in the step S2 is repeatedly screened by adopting a CELL-SELEX technology, and nucleic acid aptamer CX3 capable of specifically binding to the synovial fibroblasts and not binding to the chondrocytes is enriched, and the sequence of the nucleic acid aptamer CX3 is shown as SEQ ID CX 3; s4, constructing the liposome nanoparticle modified by the aptamer CX3 screened in the step S3. The aptamer provided by the invention has stronger binding force with target cells, and can realize targeted elimination of aged fibrous synovial cells in the osteoarthritis synovial membrane, thereby inhibiting occurrence and development of osteoarthritis.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to screening and construction of bone joint synovial fibroblast targeting aptamer nanoparticles.
Background
Osteoarthritis (OA) is a degenerative joint disease that accompanies aging, and is a total joint disease in which articular cartilage, synovium and subchondral bone are involved together, mainly causing progressive degeneration of articular cartilage and inflammation of synovium, and is clinically manifested as joint stiffness and pain, ultimately leading to movement disorder of the body. Epidemiological studies have found global prevalence of knee and hip osteoarthritis as high as 3.8% and 0.85%4. Especially in the elderly population over 50 years old, the incidence of osteoarthritis is significantly increased, a common disabling musculoskeletal disease. The global disease burden study report in 2010 indicated that hip and knee OA are 11 th high risk factors leading to global disability, placing a tremendous burden on the healthcare system, economy and society. Factors affecting OA articular cartilage repair are diverse, including local joint factors including joint injury and degree of deformity, and organism overall factors including sex, age, climacteric, gene, nutrition, body weight/body mass index, bone density, etc. The degeneration process of the OA articular cartilage is complicated and is regulated and controlled by various cells and cytokines around the joint, including mesenchymal stem cells, chondrocytes, synovial cells, immune cells, numerous inflammatory cytokines and the like.
OA is an senile disease, and aging of body cells becomes an important cause of OA. It has been found that the elimination of senescent cells is effective in inhibiting the development of diseases. At present, drugs capable of specifically eliminating aging cells are various, but due to various side effects on the body, the drugs are difficult to be widely applied to clinic. In recent years, targeted nano-drug delivery systems have been widely used clinically due to their high efficiency and low side effects. Thus, if targeted clearance for a particular cell or tissue senescent cell could be designed, this would be a good news for future senile disease treatments.
Currently, targeted therapies for OA are still scarce. Because of the complex and various cell types in the joint cavity, the realization of in-situ regulation and control of the aging of the synovial FLS of the joint is always an important difficulty in clinical treatment of OA aiming at personalized treatment of specific pathological cells.
Disclosure of Invention
Aiming at the technical problems, the invention provides a method for constructing a targeting aptamer nanoparticle of a bone joint synovial fibroblast and application thereof, which can realize targeted removal of aged fibrous synovial cells in an OA synovial so as to inhibit the occurrence and development of OA.
In order to solve the problems in the prior art, the invention adopts the following technical scheme:
the method for constructing the bone joint synovial fibroblast targeting aptamer nanoparticle comprises the following steps:
s1, respectively constructing culture systems of mouse synovial fibroblasts and chondrocytes for later use;
s2, synthesizing a random nucleic acid aptamer library, wherein the sequence of the random nucleic acid aptamer library is shown as SEQ ID NO. 2;
s3, screening: the synovial fibroblasts constructed in the step S1 are taken as positive sieve CELLs, the chondrocytes are taken as negative sieve CELLs, the random aptamer library synthesized in the step S2 is repeatedly screened by adopting a CELL-SELEX technology, and nucleic acid aptamer CX3 capable of specifically binding to the synovial fibroblasts and not binding to the chondrocytes is enriched, and the sequence of the nucleic acid aptamer CX3 is shown as SEQ ID NO. 1;
s4, constructing the liposome nanoparticle modified by the aptamer CX3 screened in the step S3.
Preferably, the mouse synovial fibroblasts in step S1 are isolated from mouse synovial tissue, and the mouse chondrocyte cell line is ATDC5 cells.
Preferably, the specific process of step S4 is as follows: synthesizing CX3-PEG2000-DSPE through Michael addition reaction, adding CX3-PEG2000-DSPE into a mixture A consisting of HSPC, DSPE-PEG2000 and cholesterol, uniformly mixing to obtain a mixture B, adding dasatinib and quercetin into the mixture B, and filtering by using a microporous filter membrane after reduced pressure evaporation, hydration and ultrasound to obtain the ligand CX3 modified liposome nanoparticle loaded with dasatinib and quercetin.
Preferably, the mass ratio of the HSPC, the DSPE-PEG2000 and the cholesterol in the mixture A is 80-150:25-50:1, and the addition amount of the CX3-PEG2000-DSPE accounts for 1-3% of the mole ratio of the mixture B.
Preferably, the final concentration of dasatinib is 0.5-2 mg/mL, and the final concentration of quercetin is 2.5-7.5 mg/mL.
The liposome nanoparticle constructed by any construction method is applied to the preparation of a drug carrier for targeted elimination of osteoarthritis synovium.
Preferably, the use targets senescent fibrous synovial cells in the synovial membrane of osteoarthritis for clearance.
Advantageous effects
The invention constructs a medicine which can target synovial fibroblasts and remove senescent fibroblasts, and proves the application of the synovial targeting nanoparticle coated senescent cells removal medicine in osteoarthritis by means of pharmacological experiments. Experiments prove that the invention has better synovial membrane targeting characteristic. In vivo and in vitro experiments prove that: 1. the CX3 aptamer liposome nanoparticle with the surface modified can be specifically combined with synovial fibroblasts, and the nanoparticle can be effectively accumulated in synovial tissues by injecting into joint cavities, and the distribution of the nanoparticle in other organ tissues is reduced. 2. The aptamer nanoparticle is wrapped with the senescent cell removal drug dasatinib and quercetin, so that the senescent synovial fibroblasts can be effectively removed, and the occurrence and development of arthritis can be effectively inhibited.
Drawings
FIG. 1 is a flow chart of synovial fibroblast targeting aptamer screening;
FIG. 2 shows the binding of aptamer to synovial fibroblasts and chondrocytes for different screening times by flow cytometry;
FIG. 3 shows the binding of the nucleic acid aptamers CX1, CX2, CX3 to synovial fibroblasts and chondrocytes, respectively;
FIG. 4 is a two-dimensional structural simulation of nucleic acid aptamers CX1, CX2, CX 3;
FIG. 5 is a synthetic route for the modification of phospholipid DSPE-PEG2000 by nucleic acid aptamer CX 3;
FIG. 6 is a flow cytometry detection of CX 3-modified liposome nanoparticles binding to synovial fibroblasts and chondrocytes, respectively;
FIG. 7 shows fluorescence distribution of different organ tissues after injection of CX 3-modified liposome nanoparticles into knee joint;
FIG. 8 shows fluorescence distribution in knee joint after injection of CX 3-modified liposome nanoparticles;
FIG. 9 shows the detection of CX3 modified liposome nanoparticles coated with DQ drug by CCK8 and SA-beta-Gal method to eliminate aged synovial fibroblasts;
FIG. 10 is a flow chart of a synovial targeting nanomedicine for joint cavity injection;
FIG. 11 is a graph showing cell senescence in synovial tissue after immunofluorescence detection of nanodrug injection into joint cavity;
FIG. 12 is a graph showing the detection of cartilage degeneration after injection of nanomedicine into the joint cavity by safranin fast green staining;
FIG. 13 shows the immunohistochemical detection of expression of inflammatory factors in cartilage apoptotic proteins and synovial tissue after injection of nanomedicine into the articular cavity.
Detailed Description
The invention is described in detail below with reference to the attached drawings and the specific embodiments:
the materials used in the examples of the present invention are all commercially available products.
Wherein, the mouse chondrocyte line ATDC5 cells are purchased from ATCC company;
random aptamer libraries were synthesized in the biological engineering (Shanghai) Co.Ltd.
Example 1
(1) Synovial fibroblast targeted aptamer library screening
Incubating the nucleic acid aptamer random sequence library with synovial fibroblasts for 1h, wherein the sequence of the nucleic acid aptamer random sequence library is shown as SEQ ID NO.2,
SEQ ID NO.2 is:
5'-ATACCAGCTTATTCAATT- (R) n-AGATAGTAAGTGCAATCT-3', wherein R is any base of A, T, C, G, equal to 50,
then 150g of centrifugal cells, after removing the supernatant, heating the cells for 10min at 95 ℃, obtaining the aptamer binding to the synovial fibroblasts in the supernatant; incubating the obtained aptamer combined with synovial fibroblasts with chondrocyte ATDC5 for 1h, centrifuging the cells 150g, and collecting the supernatant to obtain the aptamer combined with synovial fibroblasts specifically and not combined with chondrocytes; repeating the steps, as shown in figure 1, through 14 rounds of enrichment screening, a group of aptamer libraries capable of specifically binding to synovial fibroblasts and not binding to chondrocytes are obtained; using flow cytometry, the screened aptamers were validated as being able to specifically bind to synovial fibroblasts, as shown in fig. 2; the two-dimensional structure simulation of the selected aptamers CX1, CX2, CX3 is shown in FIG. 4.
(2) Synovial fibroblast targeted aptamer sequencing and targeted verification
Sequencing and analyzing the screened aptamer library by adopting a second-generation sequencing technology, obtaining a nucleic acid aptamer CX3 capable of specifically binding synovial fibroblasts, the sequence of which is shown as SEQ ID NO.1,
SEQ ID NO.1 is:
ATACCAGCTTATTCAATTCAGCCGAAGCACGACGGGGTCCGCGAGTTCAGGTCTTTTCAGCTAAGCCAAGATAGTAAGTGCAATCT。
the adaptation was verified to be able to specifically bind to synovial fibroblasts using flow cytometry, as shown in figure 3.
(3) Construction of nucleic acid aptamer CX 3-modified liposome nanoparticles
To prepare targeted aptamer modified liposomes, thiol-modified CX3 is designated as HS-CX3 and DSPE-PEG2000-MAL are reacted by nucleophilic substitution to give the target compound CX3-PEG2000-DSPE as shown in FIG. 5.
The experimental procedure is as follows, HS-CX3 and DSPE-PEG2000-MAL are dissolved in freshly distilled chloroform and methanol in a molar ratio of 1:1.2, wherein the volume ratio of chloroform to methanol is 4:1, and the pH is adjusted to 10 using triethylamine. After stirring at room temperature for 48 hours, the reaction mixture was dialyzed against deionized water for 48 hours using a dialysis bag (MW) of 3000 molecular weight cut-off to remove unreacted aptamer. After lyophilization by a lyophilizer, the cells were stored at-20 ℃. Then, weighing HSPC, DSPE-PEG2000, cholesterol and CX3-PEG2000-DSPE with the mass ratio of 100:30:10:3, and dasatinib (Dasatinib Tablets, D) and Quercetin (Quercetin, Q) with the mass ratio of 1:10, and dissolving in a mixed solvent after weighing. The mixed solvent consists of chloroform and methanol, and is prepared according to a volume ratio of 2:1. After the solution was evaporated to film under reduced pressure at 30℃and hydrated with 5 mL phosphate buffer (Phosphate Buffer Saline, PBS), it was then sonicated in an ice-water bath with an ultrasonic cytobreaker (10 min, 10%). Then, the mixture is filtered by a microporous filter membrane with the diameter of 0.45 μm and a microporous filter membrane with the diameter of 0.22 μm in sequence, and the aptamer modified Liposome (LS) nanoparticle CX3-LS-DQ loaded with D and Q is obtained.
Example 2
Determining whether the aptamer CX3 modified liposome nanoparticle CX3-LS-DQ has synovial fibroblast targeting specificity.
First, the liposome nanoparticle CX3-LS-DQ constructed in example 1 is coated with a fluorescent dye Coumarin 6, abbreviated as C6, and incubated with synovial fibroblasts and chondrocytes respectively, and the fluorescence intensity in the cells is detected by a flow cytometry technique to determine whether the synovial fibroblast-targeted nanoparticle can specifically bind to the synovial fibroblasts, as shown in FIG. 6. The results show that the amount of the liposome nanoparticle C6-CX3-LS of the surface modified aptamer CX3 entering the synovial fibroblasts is significantly higher than that of the liposome nanoparticle C6-LS of the unmodified aptamer CX3. And after the chondrocytes are treated by the two liposome nanoparticles, the amount of the chondrocytes entering the chondrocytes is not obviously different.
Secondly, injecting nanoparticle Dir dye-CX 3-LS coated with fluorescent dye Dir dye into the joint cavity of the mouse by a joint cavity injection technology, and detecting the fluorescence intensity in the knee joint and synovium tissues of the mouse by adopting a living body imaging and laser confocal technology, wherein the fluorescence intensity is shown in fig. 7 and 8. The result shows that the fluorescence intensity in the Dir dye-CX 3-LS group mouse joint cavity synovial tissue is obviously higher than that of the Dir dye group and the Dir dye-LS group, and the liposome nanoparticle CX3-LS can specifically bind to the synovial tissue.
Example 3
To further clarify whether the targeted nanoparticles encapsulating senescent cell-clearing drugs are more effective in clearing senescent cells.
The chondrocytes, synovial fibroblasts and senescent synovial fibroblasts were treated with nanoparticles loaded with senescent cell-clearing drugs (dasatinib and quercetin) at different concentrations, respectively.
As shown in fig. 9, according to the cell viability detection result, the CX3 modified nanoparticle coated with the senolytic drug can more effectively eliminate senescent cells, and reduce the toxic and side effects of the drug on normal chondrocytes and synovial fibroblasts.
Example 4
To confirm whether the targeted nanoparticles encapsulating the senolytic drug have an effect of inhibiting osteoarthritis. By isolating the inner meniscus of the mouse, a model of knee arthritis of the mouse is constructed, the nanoparticle is injected into the joint cavity after molding for 28 days, as shown in figure 10, and after molding for 8 weeks, the results of safranin-solid green and immunohistochemical staining of the joint tissue sections of the mouse are detected to show whether the mouse has the effect of treating osteoarthritis or not.
The results showed that the intra-articular injection of CX3-LS-DQ was effective in inhibiting cartilage wear as shown in FIG. 12, inhibiting the expression of validation factors and the number of aged cells in synovial tissue as shown in FIGS. 11 and 13. Therefore, the invention has the functions of targeted elimination of aging synovial cells and inhibition of occurrence and development of osteoarthritis.
According to the invention, through screening the aptamer targeting the synovial fibroblasts and constructing the liposome nanoparticle modified by the aptamer, the aging cell removal medicament is delivered into the synovial tissue in a targeted manner, and the aging cells in the synovial tissue are removed, so that the anti-osteoarthritis effect is achieved.
The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the invention.
Sequence listing
<110> university of Nanjing
<120> bone joint synovial membrane fibroblast targeting aptamer nanoparticle construction method and application
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 86
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
ataccagctt attcaattca gccgaagcac gacggggtcc gcgagttcag gtcttttcag 60
ctaagccaag atagtaagtg caatct 86
Claims (4)
1. A bone joint synovial fibroblast targeting aptamer CX3, characterized by: the sequence of the aptamer CX3 is shown as SEQ ID NO.1, and the aptamer CX3 specifically binds mouse synovial fibroblasts and does not bind chondrocytes.
2. The osteoarticular synovial fibroblast targeting aptamer CX3 according to claim 1, characterized in that said aptamer CX3 has been chemically modified by the following specific procedures: synthesizing CX3-PEG2000-DSPE through Michael addition reaction, adding CX3-PEG2000-DSPE into a mixture A consisting of HSPC, DSPE-PEG2000 and cholesterol, uniformly mixing to obtain a mixture B, adding dasatinib and quercetin into the mixture B, and filtering by using a microporous filter membrane after reduced pressure evaporation, hydration and ultrasound to obtain the ligand CX3 modified liposome nanoparticle loaded with dasatinib and quercetin.
3. A liposome nanoparticle characterized by: a bone joint synovial fibroblast targeting aptamer CX3 comprising the bone joint synovial cell according to claim 1 or 2.
4. Use of the liposome nanoparticle of claim 3 for preparing an anti-osteoarthritis drug carrier.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111532267.1A CN114404613B (en) | 2021-12-15 | 2021-12-15 | Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle |
| PCT/CN2022/134004 WO2023109456A1 (en) | 2021-12-15 | 2022-11-24 | Construction method and application for osteoarticular synovial fibroblast targeting aptamer nanoparticles |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111532267.1A CN114404613B (en) | 2021-12-15 | 2021-12-15 | Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114404613A CN114404613A (en) | 2022-04-29 |
| CN114404613B true CN114404613B (en) | 2023-10-13 |
Family
ID=81267148
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111532267.1A Active CN114404613B (en) | 2021-12-15 | 2021-12-15 | Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN114404613B (en) |
| WO (1) | WO2023109456A1 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114404613B (en) * | 2021-12-15 | 2023-10-13 | 南京大学 | Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle |
| CN114317545B (en) * | 2022-01-19 | 2023-12-15 | 南京大学 | Aptamer and application thereof |
| CN117860754A (en) * | 2024-03-08 | 2024-04-12 | 鹏澄健康(北京)科技有限公司 | Application of anti-cell aging medicine in treating lysosomal storage disease musculoskeletal lesions |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112094846A (en) * | 2020-05-20 | 2020-12-18 | 中山大学孙逸仙纪念医院 | Modified base aptamer of specific targeting osteoarthritic synovial cell and application thereof |
| CN112522388A (en) * | 2020-12-18 | 2021-03-19 | 上海市东方医院（同济大学附属东方医院） | Application of fibroblast activation protein as drug target in treating osteoarthritis |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2912181B1 (en) * | 2012-10-29 | 2017-11-29 | Yeda Research and Development Co., Ltd. | Aptamers, multimeric aptamers and uses thereof |
| CN105985962B (en) * | 2015-02-09 | 2019-02-01 | 中国中医科学院中医临床基础医学研究所 | The aptamer of the selectively targeted inflammatory synovial cell of rheumatoid arthrosis and its application |
| RU2652952C1 (en) * | 2016-07-05 | 2018-05-03 | Федеральное государственное бюджетное учреждение науки институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской академии наук (ИБХ РАН) | Method for creation and selection of the library of modified aptamers |
| CN114404613B (en) * | 2021-12-15 | 2023-10-13 | 南京大学 | Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle |
-
2021
- 2021-12-15 CN CN202111532267.1A patent/CN114404613B/en active Active
-
2022
- 2022-11-24 WO PCT/CN2022/134004 patent/WO2023109456A1/en unknown
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112094846A (en) * | 2020-05-20 | 2020-12-18 | 中山大学孙逸仙纪念医院 | Modified base aptamer of specific targeting osteoarthritic synovial cell and application thereof |
| CN112522388A (en) * | 2020-12-18 | 2021-03-19 | 上海市东方医院（同济大学附属东方医院） | Application of fibroblast activation protein as drug target in treating osteoarthritis |
Non-Patent Citations (1)
| Title |
|---|
| Kendal McCulloch等.Cellular senescence in osteoarthritis pathology.Aging Cell.2017,(第16期),第210–218页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2023109456A1 (en) | 2023-06-22 |
| CN114404613A (en) | 2022-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114404613B (en) | Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle | |
| KR100794449B1 (en) | Composition of cationic phospho lipid nanoparticles for effective delivery of nucleic acids | |
| JP2017520549A (en) | Liposome formulation for delivery of nucleic acids | |
| Han et al. | Biomimetic and bioinspired intervention strategies for the treatment of rheumatoid arthritis | |
| WO2010013836A1 (en) | Active targeting type polymeric micelle carrying drug enclosed therein and medicinal composition | |
| JP2016511747A (en) | Drug delivery to tissues based on nanoparticle surface binding | |
| CN108904468A (en) | A method of building targets extracellular vesica | |
| CN113332442A (en) | Targeted delivery molecule, particle, preparation method and application thereof | |
| US20030125302A1 (en) | Folic acid-polysaccharide complex, its preparation method and pharmaceutical composition containing the same as active component | |
| CN110772645A (en) | Functionalized cell-penetrating peptide modified drug delivery system | |
| CN111617036A (en) | Targeted controlled-release anti-arthritis medicinal preparation and preparation method thereof | |
| Song et al. | Biomimetic synthesis and optimization of extracellular vesicles for bone regeneration | |
| Deng et al. | Chondrocyte membrane–coated nanoparticles promote drug retention and halt cartilage damage in rat and canine osteoarthritis | |
| CN103626846A (en) | Ligand polypeptide specifically combined with MDSCs (Myeloid-Derived Suppressor Cells) and drug delivery system | |
| US20220226499A1 (en) | Metabolite Delivery for Modulating Metabolic Pathways of Cells | |
| Xiao et al. | Bone‐Targeted Nanoparticle Drug Delivery System‐Mediated Macrophage Modulation for Enhanced Fracture Healing | |
| CN110801519B (en) | High-tumor-enrichment-permeation nano-drug carrier and preparation method and application thereof | |
| CN117205152B (en) | Pharmaceutical carrier, preparation method thereof and application thereof in disease treatment | |
| CN114276390B (en) | Dithiocarbamate derivative nano-drug for anti-tumor drug delivery, and preparation method and application thereof | |
| CN115645369B (en) | Lung-precisely-targeted liposome nanoparticle compound and preparation method and application thereof | |
| CN103239405A (en) | Preparation method of propranolol stealth liposome modified by vascular endothelial growth factor receptor-2 (VEGFR-2) monoclonal antibody and casein phosphopeptides (CPP) jointly, and products thereof | |
| CN118059266A (en) | Nanometer targeting medicine for treating chronic kidney disease and its prepn and application | |
| CN117919205A (en) | Bionic medicine carrying nano particle for expressing CXCR4 and preparation method and application thereof | |
| Wang et al. | Biomimetic nanoparticles for effective Celastrol delivery to targeted treatment of rheumatoid arthritis through the ROS-NF-κB inflammasome axis | |
| Guo | RNA Nanoparticle as A Safe and Effective Drug Delivery Platform for Cancer Therapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |