CN114404613A - Bone joint synovial fibroblast targeted aptamer nanoparticle construction method and application - Google Patents

Bone joint synovial fibroblast targeted aptamer nanoparticle construction method and application Download PDF

Info

Publication number
CN114404613A
CN114404613A CN202111532267.1A CN202111532267A CN114404613A CN 114404613 A CN114404613 A CN 114404613A CN 202111532267 A CN202111532267 A CN 202111532267A CN 114404613 A CN114404613 A CN 114404613A
Authority
CN
China
Prior art keywords
aptamer
synovial
synovial fibroblasts
nanoparticle
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111532267.1A
Other languages
Chinese (zh)
Other versions
CN114404613B (en
Inventor
郭保生
陈响
张蕾
蒋青
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing University
Original Assignee
Nanjing University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing University filed Critical Nanjing University
Priority to CN202111532267.1A priority Critical patent/CN114404613B/en
Publication of CN114404613A publication Critical patent/CN114404613A/en
Priority to PCT/CN2022/134004 priority patent/WO2023109456A1/en
Application granted granted Critical
Publication of CN114404613B publication Critical patent/CN114404613B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • A61P39/06—Free radical scavengers or antioxidants

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Rheumatology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Molecular Biology (AREA)
  • Pain & Pain Management (AREA)
  • Toxicology (AREA)
  • Nanotechnology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)

Abstract

The invention discloses a construction method and application of targeted aptamer nanoparticles for bone joint synovial fibroblasts, wherein the construction method comprises the following steps: s1, respectively constructing a culture system of mouse synovial fibroblasts and chondrocytes for later use; s2, synthesizing a random aptamer library, wherein the sequence of the random aptamer library is shown as SEQ ID NO. 1; s3, screening: taking the synovial fibroblasts constructed in the step S1 as positive sieve CELLs and the chondrocytes as negative sieve CELLs, repeatedly screening the random aptamer library synthesized in the step S2 by adopting a CELL-SELEX technology, enriching the aptamer CX3 which can specifically bind to the synovial fibroblasts and not to the chondrocytes, wherein the sequence of the aptamer CX3 is shown in SEQ ID CX 3; s4, constructing the aptamer CX3 modified liposome nanoparticle screened in the step S3. The aptamer has stronger binding force with target cells, can realize targeted removal of aged fibrous synovial cells in synovium of osteoarthritis, and further inhibits the generation and development of osteoarthritis.

Description

Bone joint synovial fibroblast targeted aptamer nanoparticle construction method and application
Technical Field
The invention belongs to the technical field of biology, and particularly relates to screening and construction of bone joint synovial fibroblast targeted aptamer nanoparticles.
Background
Osteoarthritis (OA) is a degenerative disease of joints accompanied by aging, and is a total joint disease in which articular cartilage, synovial membrane and subchondral bone are involved together, mainly causing progressive degeneration of articular cartilage and inflammation of synovial membrane, and clinically manifested as joint stiffness and pain, which finally results in dyskinesia of the body. Epidemiological studies have found that the prevalence of knee and hip osteoarthritis worldwide is as high as 3.8% and 0.85% 4. Particularly in the elderly over 50 years of age, the incidence of osteoarthritis is significantly increased, a common disabling musculoskeletal disease. 2010 global disease burden research reports indicate that OA of the hip joint and knee joint is the 11 th highest risk factor causing global disability, and causes huge burden on the health care system, the economy and the society. Various factors affect the repair of OA articular cartilage, including local articular factors including joint injury and deformity degree, and whole organism factors including sex, age, climacterium, gene, nutrition, body weight/body mass index, bone density, etc. The degeneration process of OA joint cartilage is complicated and complicated, and is regulated by various cells and cytokines around joints, including bone marrow mesenchymal stem cells, chondrocytes, synoviocytes, immunocytes, various inflammatory cytokines and the like.
As an aging disease, OA is a disease in the elderly, and aging of body cells is a major cause of the development of OA. Research shows that the elimination of senescent cells can effectively inhibit the occurrence and development of diseases. At present, various drugs capable of specifically eliminating senescent cells are available, but these drugs are difficult to be widely used in clinical applications due to various side effects on the body. In recent years, the targeted nano-drug delivery system is widely applied clinically due to high efficiency and low side effect. Thus, if targeted clearance of senescent cells to specific cells or tissues could be designed, it would be beneficial to future treatment of geriatric diseases.
Currently, targeted therapeutic research for OA is still deficient. Because the cell types in the joint cavity are complex and various, aiming at the personalized treatment of specific pathological cells, realizing the in-situ regulation and control of joint synovial FLS (tissue specific activating syndrome) aging is always an important difficulty in the clinical treatment of OA.
Disclosure of Invention
Aiming at the technical problems, the invention provides a construction method and application of bone joint synovial fibroblast targeted aptamer nanoparticles, so that aged fibrous synovial cells in OA synovium can be removed in a targeted manner, and further the generation and development of OA can be inhibited.
In order to solve the problems of the prior art, the invention adopts the technical scheme that:
the construction method of the bone joint synovial fibroblast targeting aptamer nanoparticle comprises the following steps:
s1, respectively constructing a culture system of mouse synovial fibroblasts and chondrocytes for later use;
s2, synthesizing a random aptamer library, wherein the sequence of the random aptamer library is shown as SEQ ID NO. 1;
s3, screening: taking the synovial fibroblasts constructed in the step S1 as positive sieve CELLs and the chondrocytes as negative sieve CELLs, repeatedly screening the random aptamer library synthesized in the step S2 by adopting a CELL-SELEX technology, enriching the aptamer CX3 which can specifically bind to the synovial fibroblasts and not to the chondrocytes, wherein the sequence of the aptamer CX3 is shown in SEQ ID CX 3;
s4, constructing the aptamer CX3 modified liposome nanoparticle screened in the step S3.
Preferably, in step S1, mouse synovial fibroblasts are isolated from mouse synovial tissue, and the mouse chondrocyte line is ATDC5 cells.
Preferably, the specific process of step S4 is: synthesizing CX3-PEG2000-DSPE through Michael addition reaction, then adding CX3-PEG2000-DSPE into a mixture A consisting of HSPC, DSPE-PEG2000 and cholesterol, uniformly mixing to obtain a mixture B, then adding dasatinib and quercetin into the mixture B, and filtering by using a microporous filter membrane after reduced pressure evaporation to dryness, hydration and ultrasound to obtain the aptamer CX3 modified liposome nanoparticle CX3-LS-DQ loaded with dasatinib and quercetin.
Preferably, the mass ratio of the HSPC, the DSPE-PEG2000 and the cholesterol in the mixture A is 80-150: 25-50: 1, and the addition amount of the CX3-PEG2000-DSPE accounts for 1-3% of the molar ratio of the mixture B.
Preferably, the final concentration of the dasatinib is 0.5-2 mg/mL, and the final concentration of the quercetin is 2.5-7.5 mg/mL.
The liposome nanoparticle constructed by any one of the construction methods is applied to the preparation of a drug carrier for targeted removal of synovium of osteoarthritis.
Preferably, the application targets the clearance of aged, fibrillar synovial cells in synovium of osteoarthritis.
Has the advantages that:
the invention constructs a fibroblast which can target synovial membrane fibroblasts and remove senescence, and proves the application of a medicament for removing the senescence cells by coating synovial membrane targeting nanoparticles in osteoarthritis resistance by virtue of pharmacological experiments. Experiments prove that the synovial membrane targeting agent shows better synovial membrane targeting characteristics. In vivo and in vitro experiments prove that: 1. the surface-modified CX3 aptamer liposome nanoparticle can be specifically combined with synovial fibroblasts, and the nanoparticle can be effectively accumulated in synovial tissues by articular cavity injection and reduce the distribution of the nanoparticle in other organ tissues. 2. The anti-aging cell clearing medicaments Dasatinib and quercetin are wrapped in the aptamer nanoparticle, so that the anti-aging synovial fibroblasts can be effectively cleared, and the generation and development of arthritis are effectively inhibited.
Drawings
FIG. 1 is a flow chart of synovial fibroblast targeting aptamer screening;
FIG. 2 is a diagram showing the binding of aptamers to synovial fibroblasts and chondrocytes at different screening times in flow cytometry;
FIG. 3 is a diagram showing the binding of flow cytometry detection aptamers CX1, CX2, CX3 to synovial fibroblasts and chondrocytes, respectively;
FIG. 4 is a two-dimensional structural simulation of the aptamers CX1, CX2, CX 3;
FIG. 5 is a synthetic route of aptamer CX3 modified phospholipid DSPE-PEG 2000;
FIG. 6 is the binding of CX3 modified liposome nanoparticles to synovial fibroblasts and chondrocytes by flow cytometry;
FIG. 7 shows the fluorescence distribution of different organ tissues after injecting CX3 modified liposome nanoparticles into knee joint;
FIG. 8 shows the fluorescence distribution in the knee joint after injecting CX3 modified liposome nanoparticles into the knee joint;
FIG. 9 shows CCK8 and SA-beta-Gal method for detecting CX3 modified liposome nanoparticle coated with DQ drug for eliminating senescent synovial fibroblasts;
FIG. 10 is a flow chart for synovial targeted nanomedicine injection into the joint cavity;
FIG. 11 is a graph showing the immunofluorescence detection of cellular senescence in synovial tissue following the joint cavity injection of a nano-drug;
FIG. 12 is a graph showing the fast-green staining of safranin to detect cartilage degeneration after the nano-drug is injected into the joint cavity;
FIG. 13 shows the immunohistochemical detection of the expression of chondrocyte apoptotic proteins and inflammatory factors in synovial tissues after the nanoparticles were injected into the joint cavity.
Detailed Description
The invention is described in detail below with reference to the following figures and specific examples:
the materials used in the examples of the present invention are all commercially available products.
Among them, mouse chondrocyte line ATDC5 cells were purchased from ATCC company;
random aptamer libraries were synthesized by Biotechnology (Shanghai) Inc.
Example 1
(1) Synovial fibroblast targeted aptamer library screening
Incubating the aptamer random sequence library and synovial fibroblasts for 1h, wherein the sequence of the aptamer random sequence library is shown as SEQ ID NO.1,
SEQ ID NO.1 is:
5 '-ATACCAGCTTATTCAATT- (R) n-AGATAGTAAGTGCAATCT-3', wherein R is any base of A, T, C, G, n is 50,
then 150g of centrifugal cells, after removing the supernatant, heating the cells at 95 ℃ for 10min, and obtaining the aptamer combined with synovial fibroblasts in the supernatant; incubating the obtained aptamer combined with synovial fibroblasts with chondrocyte ATDC5 for 1h, centrifuging 150g of cells, and collecting supernatant to obtain the aptamer specifically combined with synovial fibroblasts and not combined with chondrocytes; repeating the steps, and obtaining a group of nucleic acid aptamer libraries which can specifically bind to synovial fibroblasts and not to chondrocytes through 14 rounds of enrichment screening as shown in figure 1; verifying that the screened aptamers are capable of specifically binding to synovial fibroblasts using flow cytometry, as shown in figure 2; the two-dimensional structural simulation of the screened aptamers CX1, CX2, CX3 is shown in fig. 4.
(2) Sequencing and targeting verification of synovial fibroblast targeting aptamer
Adopting next generation sequencing technology to carry out sequencing analysis on the screened aptamer library and obtain a nucleic acid aptamer CX3 which can be specifically combined with synovial fibroblast and has a sequence shown as SEQ ID CX3,
SEQ ID CX3 is:
ATACCAGCTTATTCAATTCAGCCGAAGCACGACGGGGTCCGCGAGTTCAGGTCTTTTCAGCTAAGCCAAGATAGTAAGTGCAATCT。
the aptamers were verified to be able to specifically bind synovial fibroblasts using flow cytometry, as shown in figure 3.
(3) Construction of aptamer CX3 modified liposome nanoparticles
In order to prepare the targeted aptamer modified liposome, sulfhydryl modified CX3 is marked as HS-CX3 and DSPE-PEG2000-MAL, and a target compound CX3-PEG2000-DSPE is obtained through nucleophilic substitution reaction, as shown in FIG. 5.
The experimental procedure was as follows, HS-CX3 and DSPE-PEG2000-MAL were dissolved in freshly distilled chloroform and methanol at a molar ratio of 1:1.2, wherein the volume ratio of chloroform to methanol was 4:1, and the pH was adjusted to 10 using triethylamine. After stirring at room temperature for 48 hours, the reaction mixture was dialyzed with a dialysis bag (MW) having a molecular weight cut-off of 3000 in deionized water for 48 hours to remove the unreacted aptamer. After lyophilization by a lyophilizer, stored at-20 ℃. Then, HSPC, DSPE-PEG2000, cholesterol and CX3-PEG2000-DSPE in a mass ratio of 100:30:10:3, and Dasatinib Tablets (D) and Quercetin (Quercetin, Q) in a mass ratio of 1:10 are weighed and dissolved in a mixed solvent. The mixed solvent consists of chloroform and methanol and is prepared according to the volume ratio of 2: 1. After the solution was evaporated to dryness under reduced pressure at 30 ℃ to form a film, it was hydrated with 5 mL of Phosphate Buffer Solution (PBS), and then sonicated with a sonicator in an ice water bath (10 min, 10%). Then, filtering with 0.45 μm and 0.22 μm microporous filter membranes in sequence to obtain the aptamer modified Liposome (LS) nanoparticle CX3-LS-DQ carrying D and Q.
Example 2
And (3) determining whether the aptamer CX3 modified liposome nanoparticle CX3-LS-DQ has the targeting specificity of synovial fibroblasts.
Firstly, a fluorescent dye Coumarin 6, abbreviated as C6, is wrapped in the liposome nanoparticle CX3-LS-DQ constructed in example 1 and is respectively incubated in synovial fibroblasts and chondrocytes, and the fluorescence intensity in the cells is detected by a flow cytometry technique to determine whether the synovial fibroblast targeting nanoparticle can be specifically combined with the synovial fibroblasts, as shown in FIG. 6. The results show that the amount of the liposome nanoparticle C6-CX3-LS of the surface modified aptamer CX3 entering synovial fibroblasts is obviously higher than that of the liposome nanoparticle C6-LS of the unmodified aptamer CX 3. After the chondrocytes are treated by the two liposome nanoparticles, the quantity of the chondrocytes entering the chondrocytes is not obviously different.
Secondly, injecting the fluorescent dye Dir dye-CX 3-LS coated nanoparticles into the mouse joint cavity by the joint cavity injection technology, and detecting the fluorescence intensity in the knee joint and synovial tissue of the mouse by using the living body imaging and laser confocal technology as shown in figures 7 and 8. The result shows that the fluorescence intensity of mouse joint cavity synovial tissue of the Dir dye-CX 3-LS group is obviously higher than that of the Dir dye group and the Dir dye-LS group, and the liposome nanoparticle CX3-LS can be specifically combined with the synovial tissue.
Example 3
In order to further determine whether the targeted nanoparticles wrapping the senescent cell scavenging medicament can more effectively scavenge the senescent cells.
Nanoparticles loaded with senescent cell scavenging drugs (dasatinib and quercetin) at different concentrations were used to treat chondrocytes, synovial fibroblasts and senescent synovial fibroblasts, respectively.
As shown in fig. 9, according to the cell viability detection result, the CX 3-modified nanoparticle coated senolytic drug can more effectively eliminate senescent cells, and reduce the toxic and side effects of the drug on normal chondrocytes and synovial fibroblasts.
Example 4
In order to confirm whether the targeted nanoparticles wrapping the senescence elimination medicament have the effect of inhibiting osteoarthritis or not. A mouse knee arthritis model is constructed by separating the mouse medial meniscus, the nanoparticle is injected into the joint cavity 28 days after the model is made, and as shown in figure 10, the results of safranin fast green and immunohistochemical staining of mouse joint tissue slices are detected 8 weeks after the model is made, so that whether the mouse knee arthritis model has the effect of treating osteoarthritis is determined.
The results showed that the articular cavity injection of CX3-LS-DQ was effective in inhibiting cartilage abrasion, as shown in FIG. 12, the expression of validation factor and the number of aged cells in synovial tissue, as shown in FIGS. 11 and 13. Therefore, the invention has the functions of targeted clearing of aged synovial cells and inhibiting the occurrence and development of osteoarthritis.
The invention screens the aptamer targeting synovial fibroblasts, constructs the aptamer-modified liposome nanoparticle, delivers the senescent cell clearance drug to the synovial tissue in a targeted manner, and clears the senescent cells in the synovial tissue, thereby having the effect of resisting osteoarthritis.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Sequence listing
<110> Nanjing university
<120> bone joint synovial fibroblast targeted aptamer nanoparticle construction method and application
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 86
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ataccagctt attcaattca gccgaagcac gacggggtcc gcgagttcag gtcttttcag 60
ctaagccaag atagtaagtg caatct 86

Claims (7)

1. The construction method of the bone joint synovial fibroblast targeted aptamer nanoparticle is characterized by comprising the following steps of:
s1, respectively constructing a culture system of mouse synovial fibroblasts and chondrocytes for later use;
s2, synthesizing a random aptamer library, wherein the sequence of the random aptamer library is shown as SEQ ID NO. 1;
s3, screening: taking the synovial fibroblasts constructed in the step S1 as positive sieve CELLs and the chondrocytes as negative sieve CELLs, repeatedly screening the random aptamer library synthesized in the step S2 by adopting a CELL-SELEX technology, enriching the aptamer CX3 which can specifically bind to the synovial fibroblasts and not to the chondrocytes, wherein the sequence of the aptamer CX3 is shown in SEQ ID CX 3;
s4, constructing the aptamer CX3 modified liposome nanoparticle screened in the step S3.
2. The method for constructing the aptamer nanoparticle for targeting synovial fibroblasts of bone joints according to claim 1, wherein the aptamer comprises the following steps: in the step S1, mouse synovial fibroblasts are separated from mouse synovial tissue, and the mouse chondrocyte line is ATDC5 cells.
3. The method for constructing the aptamer nanoparticle for targeting synovial fibroblasts of bone joints according to claim 1, wherein the aptamer comprises the following steps: the specific process of step S4 is: synthesizing CX3-PEG2000-DSPE through Michael addition reaction, then adding CX3-PEG2000-DSPE into a mixture A consisting of HSPC, DSPE-PEG2000 and cholesterol, uniformly mixing to obtain a mixture B, then adding dasatinib and quercetin into the mixture B, and filtering by using a microporous filter membrane after reduced pressure evaporation to dryness, hydration and ultrasound to obtain the aptamer CX3 modified liposome nanoparticle CX3-LS-DQ loaded with dasatinib and quercetin.
4. The method for constructing the aptamer nanoparticle for targeting synovial fibroblasts of bone joints according to claim 3, wherein the aptamer comprises the following steps: the mass ratio of HSPC, DSPE-PEG2000 and cholesterol in the mixture A is 80-150: 25-50: 1, and the addition amount of CX3-PEG2000-DSPE accounts for 1-3% of the molar ratio of the mixture B.
5. The method for constructing the aptamer nanoparticle for targeting synovial fibroblasts of bone joints according to claim 3, wherein the aptamer comprises the following steps: the final concentration of the dasatinib is 0.5-2 mg/mL, and the final concentration of the quercetin is 2.5-7.5 mg/mL.
6. The application of the liposome nanoparticle constructed based on the construction method of any one of claims 1 to 5 in preparing a drug carrier for targeted removal of synovium of osteoarthritis.
7. The use of claim 6, wherein the targeted clearance is of aged fibrous synovial cells in synovium of osteoarthritis.
CN202111532267.1A 2021-12-15 2021-12-15 Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle Active CN114404613B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202111532267.1A CN114404613B (en) 2021-12-15 2021-12-15 Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle
PCT/CN2022/134004 WO2023109456A1 (en) 2021-12-15 2022-11-24 Construction method and application for osteoarticular synovial fibroblast targeting aptamer nanoparticles

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111532267.1A CN114404613B (en) 2021-12-15 2021-12-15 Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle

Publications (2)

Publication Number Publication Date
CN114404613A true CN114404613A (en) 2022-04-29
CN114404613B CN114404613B (en) 2023-10-13

Family

ID=81267148

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111532267.1A Active CN114404613B (en) 2021-12-15 2021-12-15 Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle

Country Status (2)

Country Link
CN (1) CN114404613B (en)
WO (1) WO2023109456A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114317545A (en) * 2022-01-19 2022-04-12 南京大学 Aptamer and application thereof
WO2023109456A1 (en) * 2021-12-15 2023-06-22 南京大学 Construction method and application for osteoarticular synovial fibroblast targeting aptamer nanoparticles
CN117860754A (en) * 2024-03-08 2024-04-12 鹏澄健康(北京)科技有限公司 Application of anti-cell aging medicine in treating lysosomal storage disease musculoskeletal lesions

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150307883A1 (en) * 2012-10-29 2015-10-29 Yeda Research And Development Co. Ltd. At Weizmann Institute Of Science Aptamers, multimeric aptamers and uses thereof
CN112094846A (en) * 2020-05-20 2020-12-18 中山大学孙逸仙纪念医院 Modified base aptamer of specific targeting osteoarthritic synovial cell and application thereof
CN112522388A (en) * 2020-12-18 2021-03-19 上海市东方医院（同济大学附属东方医院） Application of fibroblast activation protein as drug target in treating osteoarthritis

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105985962B (en) * 2015-02-09 2019-02-01 中国中医科学院中医临床基础医学研究所 The aptamer of the selectively targeted inflammatory synovial cell of rheumatoid arthrosis and its application
RU2652952C1 (en) * 2016-07-05 2018-05-03 Федеральное государственное бюджетное учреждение науки институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской академии наук (ИБХ РАН) Method for creation and selection of the library of modified aptamers
CN114404613B (en) * 2021-12-15 2023-10-13 南京大学 Construction method and application of bone joint synovial fibroblast targeting aptamer nanoparticle

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150307883A1 (en) * 2012-10-29 2015-10-29 Yeda Research And Development Co. Ltd. At Weizmann Institute Of Science Aptamers, multimeric aptamers and uses thereof
CN112094846A (en) * 2020-05-20 2020-12-18 中山大学孙逸仙纪念医院 Modified base aptamer of specific targeting osteoarthritic synovial cell and application thereof
CN112522388A (en) * 2020-12-18 2021-03-19 上海市东方医院（同济大学附属东方医院） Application of fibroblast activation protein as drug target in treating osteoarthritis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KENDAL MCCULLOCH等: "Cellular senescence in osteoarthritis pathology", no. 16, pages 210 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023109456A1 (en) * 2021-12-15 2023-06-22 南京大学 Construction method and application for osteoarticular synovial fibroblast targeting aptamer nanoparticles
CN114317545A (en) * 2022-01-19 2022-04-12 南京大学 Aptamer and application thereof
CN114317545B (en) * 2022-01-19 2023-12-15 南京大学 Aptamer and application thereof
CN117860754A (en) * 2024-03-08 2024-04-12 鹏澄健康(北京)科技有限公司 Application of anti-cell aging medicine in treating lysosomal storage disease musculoskeletal lesions

Also Published As

Publication number Publication date
WO2023109456A1 (en) 2023-06-22
CN114404613B (en) 2023-10-13

Similar Documents

Publication Publication Date Title
CN114404613A (en) Bone joint synovial fibroblast targeted aptamer nanoparticle construction method and application
Zhao et al. Exosome-mediated siRNA delivery to suppress postoperative breast cancer metastasis
KR20190038851A (en) Alpha and gamma-D polyglutamated anti-folate and uses thereof
KR100794449B1 (en) Composition of cationic phospho lipid nanoparticles for effective delivery of nucleic acids
FR2715847A1 (en) Composition containing nucleic acids, preparation and uses
Deng et al. Biotin–avidin system-based delivery enhances the therapeutic performance of MSC-derived exosomes
Heirani-Tabasi et al. Cartilage tissue engineering by co-transplantation of chondrocyte extracellular vesicles and mesenchymal stem cells, entrapped in chitosan–hyaluronic acid hydrogel
CN106619515A (en) Liposomal compositions and uses of same
JP2016511747A (en) Drug delivery to tissues based on nanoparticle surface binding
CN113304119A (en) Construction method of exosome-associated sorafenib liposome
Tang et al. A simple self-assembly nanomicelle based on brain tumor-targeting peptide-mediated siRNA delivery for glioma immunotherapy via intranasal administration
JP4081436B2 (en) Method for promoting nucleic acid introduction
CN114948959B (en) Nanometer medicine for regulating and controlling lactic acid metabolism of tumor and preparation method and application thereof
CN113388122A (en) Electropositive surface exosome and preparation method and application thereof
CN102784398B (en) Composition comprising endostatin adopted as delivery system and chemically-synthesized RNA interference molecule, and application thereof
Tamura et al. Extracellular vesicles in bone homeostasis: key roles of physiological and pathological conditions
CN103626846A (en) Ligand polypeptide specifically combined with MDSCs (Myeloid-Derived Suppressor Cells) and drug delivery system
Cui et al. Nanomedicines promote cartilage regeneration in osteoarthritis by synergistically enhancing chondrogenesis of mesenchymal stem cells and regulating inflammatory environment
US20220226499A1 (en) Metabolite Delivery for Modulating Metabolic Pathways of Cells
CN117357466A (en) Preparation method and application of polypeptide dendrimer nanogel microcarrier with engineered MSCs cell membrane encapsulation and loading siRNAs
CN115820865B (en) Application of PNPO gene in preparation of multiple myeloma markers
CN108451907B (en) Application of polymersome in preparation of medicine for treating multiple myeloma
CN116327700A (en) Methotrexate nano-drug-carrying system, preparation method thereof and application thereof in treating rheumatoid arthritis
CN115990273A (en) Neutrophil extracellular vesicle gene delivery system and application thereof in osteoarthritis treatment
Zhang et al. Charge‐Reversed Exosomes for Targeted Gene Delivery to Cartilage for Osteoarthritis Treatment

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant