CN114404608A

CN114404608A - Embedded siRNA-carrying tetrahedral framework nucleic acid and application thereof

Info

Publication number: CN114404608A
Application number: CN202210197671.6A
Authority: CN
Inventors: 林云锋; 高阳; 蔡潇潇
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2022-03-01
Filing date: 2022-03-01
Publication date: 2022-04-29
Anticipated expiration: 2042-03-01
Also published as: CN114404608B

Abstract

The invention discloses a specially designed tetrahedral framework nucleic acid, which is a tetrahedral framework nucleic acid with siRNA embedded inside. According to the invention, through base complementary pairing, both ends of the target siRNA are connected to the tetrahedral frame nucleic acid, so that the target siRNA is embedded into the carrier frame, protective carrying of the siRNA is realized, and the cell-entering capability of the siRNA is improved. Meanwhile, the pH responsive switch is utilized to further realize the dynamic release of the siRNA in the target cell, and the controllable delivery of the siRNA is realized.

Description

Embedded siRNA-carrying tetrahedral framework nucleic acid and application thereof

Technical Field

The invention particularly relates to an embedded tetrahedral framework nucleic acid carrying siRNA and application thereof.

Background

Oligonucleotide therapy is an oligonucleotide consisting of up to 20 short-chain nucleotides (deoxyribonucleotides or ribonucleotides) that pair with DNA, mRNA or pre-mRNA by Watson-Crick base complementary pairing principles to achieve very high selectivity, precisely inhibit certain genes, and keep the genes encoding the abnormalities "silent", thereby preventing many "erroneous" protein expression. Many types of oligonucleotide drugs are currently being studied, including antisense oligonucleotides (ASOs), small interfering RNAs (sirnas), micrornas (mirnas), aptamers (aptamers), and the like.

Compared with traditional medicines, the oligonucleotide therapy has outstanding advantages of selective targeting, personalized design, high predictability and the like. To date, FDA-approved oligonucleotide treatment regimens have exceeded 10, mainly involving antisense oligonucleotide strands and siRNA, mainly against diseases of the eye, liver and skeletal muscle. The considerable therapeutic effect and the room for improvement that still exists motivate researchers to explore further. The challenge of siRNA therapeutic research remains the efficient delivery of sirnas of interest. Common problems include the difficult entry of target cells, nuclease induced siRNA degradation during delivery, failure of lysosomal escape after entry of material, encapsulation of unrelated proteins, renal clearance, etc.

Tetrahedral framework nucleic acids (tFNA) have an extremely strong and ubiquitous cytostatic capacity, and thus have shown great research potential as drug delivery platforms in recent years, and have taken a unique position in nanoparticle delivery systems by virtue of an efficient self-assembly synthesis approach, high controllability of physicochemical properties, and high customizability and scalability under editability. Patent CN 113736776a discloses a frame nucleic acid material-based microRNA nanocomplex, and its preparation method and use, which carries target RNA or DNA fragments by adding sticky ends at 4 vertices of tetrahedral frame nucleic acid. The tail-like structure of the cohesive end of the tube is simple in design, but in the carrier design, the tFNA only provides a connectable 'seat' for a target cargo chain as a static nano-carrier, and the connection mode of the cohesive end can influence the space structure and the size of the DNA nano-material, further influences the cell-entering capacity of the DNA nano-material, and cannot carry long nucleic acid to pass through a cell membrane, otherwise, additional protection and assistance of a cationic polymer can be required. The direct suspension attachment method cannot further protect and stabilize the carried siRNA.

Disclosure of Invention

To solve the above problems, the present invention provides a tetrahedral framework nucleic acid which is a tetrahedral framework nucleic acid having siRNA embedded therein.

Further, it is a tetrahedral framework nucleic acid in which siRNA is embedded by base complementary pairing.

Further, the four DNA single strands of the tetrahedral framework nucleic acid are 30bp long, wherein one DNA single strand sequence comprises 4 repeated segments of CCCCCCC.

Further, one of the four DNA single strands of the tetrahedral framework nucleic acid comprises ACCCCCTAACCCCCTAACCCCCTAACCCCC, one comprises CGAGAAGGGCATCTC and one comprises GGATCTTCAGACTTA.

Furthermore, four DNA single-stranded sequences of the tetrahedral framework nucleic acid embedded with the siRNA are shown in SEQ ID NO. 1-4.

Furthermore, the sequence of the siRNA is shown in SEQ ID NO. 5-6.

The invention also provides a preparation method of the tetrahedral framework nucleic acid, which comprises the following steps:

taking four DNA single chains and the meaning chain and the antisense chain of the siRNA, adding the four DNA single chains and the antisense chain into a TM buffer solution, maintaining the temperature at 95 ℃ for 10min, and rapidly cooling to 4 ℃ for more than 20min to obtain the siRNA.

Further, the final concentrations of the four single DNA strands and the sense strand and the antisense strand of siRNA were 1000 nM.

The invention finally provides the use of the tetrahedral framework nucleic acid in the preparation of anti-inflammatory drugs.

The invention realizes the protection carrying of the siRNA by complementary pairing of the specific base sequences CGAGAAGGGCATCTC and GGATCTTCAGACTTA on the outer frame of the tetrahedral frame nucleic acid (tFNA) and the target siRNA base, successfully embeds the target siRNA into the tetrahedral frame nucleic acid, and successfully constructs a pH response switch by 4 sections of repeated CCCCCCCCC on the outer frame of the tFNA, so that the tFNA can realize the conversion from a closed structure to an open structure after entering a cell lysosome, thereby releasing the delivered siRNA from a carrier and playing a corresponding gene silencing role.

Compared with the tetrahedral framework nucleic acid in the prior art, the invention has the following specific beneficial effects:

1. realizing protective carrying of siRNA

By embedding the siRNA into the tFNA, the anti-RNA enzyme capability of the coated siRNA is enhanced, the stability of the coated siRNA in serum is enhanced, the carrying stability of the coated siRNA at 37 ℃ (action temperature) is improved, the falling risk of the coated siRNA is reduced, and the effective load of the siRNA is improved.

2. Improving the cell-entering ability of tFNA

The original internal space of tFNA is utilized, and the size of the tFNA is not obviously influenced after siRNA is carried in an embedded siRNA carrying mode, so that the excellent cell entering capability of the tFNA is well reserved.

3. Reducing potential immunogenicity of siRNA

siRNA is potentially immunogenic, since fna has been shown to be biocompatible in earlier studies and is not cytotoxic. After being coated on tFNA, siRNA is not easily identified and taken up by immune cells in the delivery process, so potential immunogenicity is avoided, and the biological safety is good.

4. Diversity of loadable siRNA

The tFNA adopted by the invention has the side length of 30bp, and precursor siRNA with the length of 25bp and capable of silencing TNF alpha mRNA is embedded. For other conventional 21-25bp long siRNAs, the method has universality. The siRNA can be adjusted to the corresponding target siRNA according to the research requirement and the treatment requirement.

5. Realizing the dynamic release of siRNA in target cells

The tFNA can realize the conversion from a closed structure to an open structure after entering a cell lysosome by adjusting the sequence synthesized by the tFNA and adding a pH responsive sequence on a frame, so that the delivered siRNA can be released from a carrier and further enters cytoplasm to play a corresponding gene silencing effect.

Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.

The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1 Atomic Force Microscope (AFM) map of tFNA-SiR

FIG. 2 Transmission Electron Microscopy (TEM) image of tFNA-SiR

FIG. 3 dynamic light Scattering measurement of particle size results for tFNA-SiR

FIG. 4tFNA-SiR scanning results of circular dichroism spectroscopy under the conditions of pH8 and pH5

FIG. 5 fluorescence intensity changes of tFNA-siR measured by microplate reader under different pH conditions

FIG. 6 line graphs showing the visual degradation of free siRNA and tFNA-siR after 1 hour incubation in RNaseA at different concentrations

FIG. 7 is a line graph showing the visual degradation of free siRNA and tFNA-siR after incubation in 1U/mL RNaseA for various periods of time

FIG. 8 is a visual line graph of degradation of free siRNA and tFNA-siR after 24 hours incubation in fetal calf serum at different concentrations

FIG. 9 is a line graph showing the visual degradation of free siRNA and tFNA-siR after incubation in 10% concentration serum for various periods of time

FIG. 10 is a 5% PAGE electrophoresis of tFNA, tFNA-siR, tFNA(s) and tFNA(s) -siR obtained in a conventional pH8 buffer at room temperature

FIG. 11 5% PAGE of tFNA, tFNA-siR, tFNA(s) and tFNA(s) -siR obtained in conventional pH8 buffer at 37 deg.C

FIG. 12 5% PAGE of tFNA, tFNA-siR, tFNA(s) and tFNA(s) -siR in acid buffer pH5 at 37 ℃

FIG. 13 confocal fluorescence microscope examination of co-localization of tFNA-siR and lysosomes (Green fluorescence signal: Lyso Tracker labeled lysosomes; purple fluorescence signal: Cy5 labeled tFNA-siR; blue fluorescence signal: Hochst labeled nuclei; Green arrow in Merge graph indicates Cy5 fluorescence signal of tFNA-siR escaping from lysosomes, and Red arrow indicates a situation where lysosomes overlap with the signal of tFNA-siR, i.e., tFNA-siR that has not escaped from lysosomes yet)

FIG. 14 qPCR analysis of mRNA levels following macrophage stimulation transfected with free siRNA, tFNA-siR, tFNA(s) -siR, and lipo 3000-siR.

FIG. 15 ELISA analysis of secreted TNF α proteins following macrophage stimulation transfected with free siRNA, tFNA-siR, tFNA(s) -siR, and lipo 3000-siR.

Detailed Description

Example 1 preparation, characterization and application of Embedded siRNA-Loading tetrahedral framework nucleic acid of the invention

1. Synthesis of tFNA-siRNA (tFNA-siR):

1) tFNA forms an outer frame with an edge length of 30bp from 4 DNA single strands, wherein

S1(SEQ ID NO.1)：

TACGGGTAGGCCGAGACTACTATGGCGTGCAGCAGCTGGTGATAAAACCCCCTAACCCCCTAACCCCCTAACCCCC

S2(SEQ ID NO.2)：

CTCGGCCTACCCGTACGAGAAGGGCATCTCATAGTACGGTATTGGACCGAGTCCTCGCATGAGAGTTGACGGAGTCTGCCTGTCCACTATGC

S3(SEQ ID NO.3)：

TTTATCACCAGCTGCTGCACGCCATAGTAGAGCATAGTGGACAGGCAGACTCCGTCAACTCAGATCTCGAACATTCC

S4(SEQ ID NO.4)：

CATGCGAGGACTCGGTCCAATACCGTACTAAAGGGAATTAGGGAATTAAGGGGTTAAAGGGAGGATCTTCAGACTTAGGAATGTTCGAGATC

2) siRNA consists of 2 strands, where the two ends of the antisense strand are augmented by an extended DNA strand:

sense strand (also known as cargo strand, a sequence that truly plays a role in gene silencing, SEQ ID No. 5): gucucagccucuucucauuccugCT, respectively;

antisense strand (also known as vector strand, whose subsequent transition into the cell is classified as degraded, SEQ ID No. 6):

GAGATGCCCTTCTCGAagcaggaaugagaagaggcugagacauATAAGTCTGAAGATCC。

wherein, lower case letters represent RNA base sequences, and upper case letters represent DNA base sequences.

3) Synthesis procedure

4 DNA single strands (S1, S2, S3 and S4) and 2 strands of siRNA were dissolved in TM Buffer (10mM Tris-HCl, 50mM MgCl2, pH 8.0), and the final concentration of 6 oligonucleotide strands was 1000nM, and after mixing, the mixture was rapidly heated to 95 ℃ for 10 minutes, and then rapidly cooled to 4 ℃ for 20 minutes or more, and tFNA-siR was obtained. Storing at 4 deg.C for use.

The synthetic identification and characterization result of tFNA-siR:

the results of observation using 2 electron microscopes are shown in FIGS. 1-2. Tetrahedral structures of features visible under the mirror. The synthesized tFNA-siR had a size of about 10 to 20nm, and the results are shown in FIG. 3, and it can be considered that tFNA-siR was successfully synthesized.

3. pH responsiveness verification result of tFNA-siR:

the pH-responsive C-rich sequence used in the present invention was ACCCCCTAACCCCCTAACCCCCTAACCCCC, and was carried on S1. Under the condition of pH8 (namely, the pH environment of normal synthesis of materials), the sequence and the S4 chain partially generate complementary pairing of bases to form a normal tetrahedral framework structure. However, at pH5, a four-chain structure (i-motif structure) is formed inside the C-rich sequence, which leads to the opening of the tetrahedral structure of tFNA.

1) Scanning the i-motif structure with a circular dichroism spectrometer will result in the formation of characteristic peaks and troughs. As shown in fig. 4: the peak value of tFNA-SiR increases significantly when the pH is changed from 8 to 5, i.e., under the acidic environment simulating lysosomes, and a typical right shift occurs (from 273nm to 283nm), indicating that at pH5, the i-motif structure of tFNA-SiR is formed and the tFNA framework is opened.

2) Fluorescence quenching reaction

A quenching group BHQ2 and a fluorescent group ROX are respectively modified on S1 and S3 chains of tFNA-SiR. When the i-motif structure is formed, the BHQ2 group is very close to the ROX group, so that the emitted light after the ROX is excited is quenched, and the fluorescence signal cannot be detected. When the C-rich sequence is converted to an i-motif four-chain structure from the original base complementary pairing, ROX is separated from BHQ2 groups, so that the distance is increased, the fluorescence is not quenched any more, and the fluorescence signal can be measured. The change of ROX fluorescence intensity of tFNA-siR-ROX/BHQ2 under different pH conditions was measured by a microplate reader, and the specific result is shown in FIG. 5. The result shows that the environmental acidity is increased along with the reduction of pH, the original balance of C-G and A-T pairing is broken, an i-motif structure is gradually formed, and the fluorescence intensity of the material is also gradually reduced. When the pH was adjusted to 5, the degree of fluorescence quenching was about 90%. It is shown that at this point the i-motif structure is fully formed and tFNA is almost fully opened.

4. tFNA provides better RNase stability of the loaded siRNA.

Degradation of free siRNA and tFNA-siR after 1 hour incubation in different concentrations of RNaseA was compared by 2% agarose gel and counted as a visual line graph, see in particular fig. 6.

As shown in fig. 6: the Cy5 channel indicates the amount of intact siRNA that was not degraded. After 2U/mL RNase A degradation for 1h, the free siRNA was almost completely degraded, but the tFNA-siR still had a clear and complete siRNA band. The siRNA coated in tFNA can be completely degraded when the enzyme concentration reaches 8U/mL (4 times of 2U/mL). Statistical analysis showed that after 1 hour incubation in 2U/mL RNase A, the undegraded free siRNA accounted for only 17%, while more than half of the siRNA in tFNA-siR was protected from degradation (65%).

Degradation of free siRNA and tFNA-siR after incubation in 1U/mL RNaseA for various periods of time was compared by 2% agarose gel and counted as a visual line graph, see in particular FIG. 7.

As shown in fig. 7: unprotected free siRNA disappeared completely during 4-6 hours of degradation, whereas tFNA-siR did not disappear completely after 6-12 hours of incubation. After 1 hour of enzymolysis in 1U/mL RNase A, almost all siRNA in tFNA is preserved, and naked free siRNA is degraded by more than half.

5. tFNA provides better serum stability of the loaded siRNA.

Degradation of free siRNA and tFNA-siR after 24 h incubation in fetal calf serum at different concentrations was compared by 2% agarose gel and counted as a visual line graph, see in particular fig. 8.

As shown in fig. 8: most of the siRNA protected by tFNA remained stable even after 24 hours incubation with 10% concentration of fetal bovine serum, and a clear fluorescent band was detected. In contrast, when the concentration of fetal calf serum exceeds 4%, the free siRNA is completely degraded.

Degradation of free siRNA and tFNA-siR after incubation in 10% serum for different periods of time was compared by 2% agarose gel and counted as a visual line graph, see in particular fig. 9.

As shown in fig. 9: the degree of degradation of free siRNA and tFNA-siR after incubation for different periods of time in 10% serum also demonstrates the protective effect of tFNA on siRNA. After only 12 hours of incubation, most of the free siRNA had been broken down and no fluorescent band was detected, while most of the siRNA in fna-siR was still intact after 24 hours of incubation.

6. tFNA provides more controlled release management of the loaded siRNA.

tFNA(s) -SiR is a nano material which simulates the viscous end and carries the target siRNA. siRNA has only one end that forms a base complementary pair with the tfna(s) outer frame, similar to a conventional sticky end ligation. The results of 5% polyacrylamide gel electrophoresis (PAGE) of tFNA, tFNA-siR, tFNA(s) and tFNA(s) -siR obtained in conventional pH8 buffer at room temperature showed that both tFNA and tFNA(s) stably carried siRNA at room temperature (as shown in FIG. 10). Whereas, when the gel running temperature was adjusted up to 37 ℃ to simulate the actual cell culture temperature, siRNA was separated from tFNA(s); in contrast, siRNA embedded in tFNA-siR was stably carried by tFNA after running in polyacrylamide gel at 100V for 50 minutes at 37 deg.C (as shown in FIG. 11). When the running buffer was changed to pH5 to further simulate the environment of entry into the lysosome after uptake by the cells, the pH switch of tFNA responded to form an i-motif, allowing the framework to open and the embedded siRNA to be released from the open tFNA (as shown in figure 12).

7. tFNA can assist siRNA escape from lysosome and enter cytoplasm

Confocal fluorescence microscopy observations of co-localization of tFNA-siR and lysosomes in macrophages after 3, 6, 12 and 24 hours of incubation with tFNA-siR are shown in figure 13: escape of tFNA-siR from lysosomes was observed under confocal microscopy. Fluorescence of Cy5 alone was observed 3 hours after transfection of siRNA, indicating lysosomal escape of embedded siRNA in tFNA (green arrows indicate Cy5 alone, red arrows indicate the overlap of Cy5 signal and Lyso Tracker signal). Over time, the in vitro Cy5 fluorescence signal increased significantly and filled the entire cytoplasm. The tFNA-SiR is proved to have outstanding lysosome escape capacity, and siRNA is favorable to overcome the second membrane barrier and enter cytoplasm to play a role.

8. tFNA-siR can obviously inhibit the expression of TNF alpha mRNA of macrophage after inflammatory stimulation

Free siRNA, tFNA-SiR, tFNA(s) -SiR and lipo3000-SiR were synthesized, respectively, at a concentration of 1000 nM. Wherein lipo3000-siR is a Lipofectamine3000 encapsulated siRNA that was incubated and synthesized according to Lipofectamine3000 instructions. Meanwhile, the target drug with siRNA only connected with the tetrahedral framework nucleic acid at one end is synthesized, and the siRNA is not embedded and is positioned at the outer side of the tetrahedral framework nucleic acid carrier. In the transfection of macrophages, the above synthesized drug was used as a working solution diluted from 1000nM to 200nM concentration using serum-free high-sugar medium. The mRNA levels of intracellular TNF α were subjected to qPCR analysis 24 hours after transfection of macrophages and 4 hours after stimulation with LPS, and the results are shown in fig. 14.

As shown in fig. 14: tFNA-siR can reduce TNF alpha mRNA expression induced by LPS by 5 times, and shows gene silencing effect equivalent to lipo 3000-siR. In addition, the advantages of the embedded load are reflected in the gene silencing effect that the expression level of TNF alpha mRNA of the tFNA-siR group is obviously lower than that of the tFNA(s) -siR group.

After macrophages were transfected with free siRNA, tFNA-siR, tFNA(s) -siR and lipo3000-siR, and stimulated with LPS for 4 hours, the TNF α protein secreted into the supernatant by the cells within 4 hours was analyzed by ELISA, and the results are shown in FIG. 15.

As shown in fig. 15: the inhibitory effect of TNF α protein expression was consistent with qPCR. the effect of tFNA-siR on TNF α expression inhibition was strongest in each group, comparable to commercial Lipofectamine 3000.

In conclusion, the invention enables both ends of the target siRNA to be connected to the tetrahedral frame nucleic acid through base complementary pairing, thereby embedding the target siRNA into a carrier frame, realizing protective carrying of the siRNA, improving the cell-entering capability of the siRNA, and simultaneously, further realizing dynamic release of the siRNA in a target cell by utilizing a pH responsive switch, realizing controllable delivery of the siRNA and enabling the treatment effect of the oligonucleotide drug to be more remarkable.

SEQUENCE LISTING

<110> Sichuan university

<120> embedded siRNA-carrying tetrahedral framework nucleic acid and application thereof

<130> GYKH1118-2022P0114747CC

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 76

<212> DNA

<213> Artificial sequence

<400> 1

tacgggtagg ccgagactac tatggcgtgc agcagctggt gataaaaccc cctaaccccc 60

taacccccta accccc 76

<210> 2

<211> 92

<212> DNA

<213> Artificial sequence

<400> 2

ctcggcctac ccgtacgaga agggcatctc atagtacggt attggaccga gtcctcgcat 60

gagagttgac ggagtctgcc tgtccactat gc 92

<210> 3

<211> 77

<212> DNA

<213> Artificial sequence

<400> 3

tttatcacca gctgctgcac gccatagtag agcatagtgg acaggcagac tccgtcaact 60

cagatctcga acattcc 77

<210> 4

<211> 92

<212> DNA

<213> Artificial sequence

<400> 4

catgcgagga ctcggtccaa taccgtacta aagggaatta gggaattaag gggttaaagg 60

gaggatcttc agacttagga atgttcgaga tc 92

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence

<400> 5

gucucagccu cuucucauuc cugct 25

<210> 6

<211> 59

<212> DNA

<213> Artificial sequence

<400> 6

gagatgccct tctcgaagca ggaaugagaa gaggcugaga cauataagtc tgaagatcc 59

Claims

1. A tetrahedral framework nucleic acid, wherein: it is a tetrahedral framework nucleic acid with siRNA embedded inside.

2. The tetrahedral framework nucleic acid of claim 1, wherein: it is a tetrahedral framework nucleic acid with siRNA embedded inside by base complementary pairing.

3. The tetrahedral framework nucleic acid of claim 2, wherein: the four DNA single-strands of the tetrahedral framework nucleic acid have the side length of 30 bp.

4. The tetrahedral framework nucleic acid of claim 3, wherein: one of the four DNA single strands of the tetrahedral framework nucleic acid comprises 4 repeats of CCCCCC.

5. The tetrahedral framework nucleic acid of claim 4, wherein: one of the four DNA single strands of the tetrahedral framework nucleic acid comprises ACCCCCTAACCCCCTAACCCCCTAACCCCC, one DNA single strand sequence comprises CGAGAAGGGCATCTC, and one DNA single strand sequence comprises GGATCTTCAGACTTA.

6. The tetrahedral framework nucleic acid of claim 5, wherein: four DNA single-stranded sequences of the tetrahedral framework nucleic acid are shown in SEQ ID NO. 1-4.

7. The tetrahedral framework nucleic acid of any one of claims 1 to 6, wherein: the sequence of the siRNA is shown in SEQ ID NO. 5-6.

8. A method for preparing a tetrahedral framework nucleic acid according to any one of claims 1 to 7, wherein the method comprises the steps of: it comprises the following steps:

taking four DNA single chains and a sense strand and an antisense strand of the siRNA, adding the four DNA single chains and the sense strand and the antisense strand of the siRNA into a TM buffer solution, maintaining the temperature at 95 ℃ for 10min, and rapidly cooling to 4 ℃ for more than 20min to obtain the siRNA.

9. The method of claim 8, wherein: the four single DNA strands have the same final concentration as the sense strand and the antisense strand of the siRNA.

10. Use of a tetrahedral framework nucleic acid according to any one of claims 1 to 7 in the manufacture of an anti-inflammatory medicament.