CN114404441A

CN114404441A - Promoter for osteogenic differentiation of bone marrow mesenchymal stem cells

Info

Publication number: CN114404441A
Application number: CN202210132803.7A
Authority: CN
Inventors: 不公告发明人
Original assignee: Qingdao Situo Xinyuan Cell Medicine Co ltd
Current assignee: Shandong Shixin Technology Development Co ltd
Priority date: 2020-06-22
Filing date: 2020-06-22
Publication date: 2022-04-29
Anticipated expiration: 2040-06-22
Also published as: CN111658775A; CN114404441B; CN111658775B

Abstract

The invention provides an accelerant for osteogenic differentiation of mesenchymal stem cells, belonging to the technical field of stem cells. Experiments prove that the inhibition of the expression of LINC02075 in the bone marrow mesenchymal stem cells can remarkably promote the expression of mRNA and protein of osteogenic differentiation related genes RUNX2, ALP and OCN to promote the osteogenic differentiation of the bone marrow mesenchymal stem cells, so that the LINC02075 can be used as the osteogenic differentiation promoter of the bone marrow mesenchymal stem cells.

Description

Promoter for osteogenic differentiation of bone marrow mesenchymal stem cells

The scheme is a divisional application, the name of the originally applied invention is the function of long-chain non-coding RNA in osteogenic differentiation and adipogenic differentiation of stem cells, and the application dates of the originally applied application are as follows: 2020-06-22, the application number of the original application is: CN 202010575929.2.

Technical Field

The invention belongs to the technical field of stem cells, and particularly relates to an accelerant for osteogenic differentiation of bone marrow mesenchymal stem cells.

Background

Osteoporosis is a systemic, metabolic skeletal disorder. Osteoporosis is characterized by a decrease in bone mass, a loss of bone microarchitecture and an increase in bone fragility, with its major clinical manifestations of pathological fractures and low back pain. With the increasing level of aging, osteoporosis is beginning to be of increasing concern to more and more people.

The mesenchymal stem cells are a type of stem cells having a multi-differentiation and self-renewal ability, which can be differentiated into osteoblasts, chondrocytes, adipocytes, neurons, myoblasts, etc. under various conditions. The mesenchymal stem cells have the advantages of easy acquisition, small immune rejection, rich source ways and the like, and thus, have been used for clinical treatment. In human, osteogenic differentiation and adipogenic differentiation of mesenchymal stem cells are in a mutually restricted balance, that is, the occurrence of adipogenic differentiation inhibits the differentiation of mesenchymal stem cells into osteoblasts, and the occurrence of osteogenic differentiation also inhibits the differentiation of mesenchymal stem cells into adipocytes. During the occurrence and development of osteoporosis, the decrease of bone mass and the increase of fat content in bone marrow coincide with the disorder of the adipogenic differentiation and osteogenic differentiation of mesenchymal stem cells of bone marrow. Therefore, it is feasible to treat osteoporosis by inhibiting the adipogenic differentiation of mesenchymal stem cells.

Long non-coding RNA is a kind of non-coding RNA with the length larger than 200bp, and initially, researchers thought it to be "noise" in genome transcription, but with the continuous research on it, researchers found that long non-coding RNA participates in various vital activities such as cell cycle regulation, embryonic development and cell differentiation. The existing research shows that the expression level or the function of the long-chain non-coding RNA is abnormal and is closely related to a plurality of diseases such as tumor, Alzheimer disease and the like. Meanwhile, recent studies have shown that long non-coding RNAs are closely associated with the maintenance of stem cell pluripotency and differentiation. At present, no report is found about the research on the relevant action of LINC02075 in adipogenic differentiation and osteogenic differentiation of bone marrow mesenchymal stem cells.

Disclosure of Invention

The invention aims to provide application of long-chain non-coding RNA LINC02075 in inhibiting adipogenic differentiation of bone marrow mesenchymal stem cells and promoting osteogenic differentiation of the bone marrow mesenchymal stem cells.

In order to achieve the purpose, the invention provides the following technical scheme:

a molecular intervention target for inhibiting the adipogenic differentiation of bone marrow mesenchymal stem cells is LINC 02075.

Preferably, the sequence of the transcript of LINC02075 is shown as SEQ ID NO. 1.

In addition, the invention provides application of the LINC02075 gene inhibitor in preparation of a bone marrow mesenchymal stem cell adipogenic differentiation inhibitor.

Preferably, the gene inhibitor is one of siRNA, chemically modified siRNA and shRNA.

Preferably, the gene inhibitor is shRNA.

Preferably, the first and second electrodes are formed of a metal,

the sense strand of the shRNA is as follows:

5'-CACCGCTCCTGAAGAAACAGCTTAGCGAACTAAGCTGTTTCTTCAGGAGC -3'，

the antisense strand of the shRNA is:

5'-AAAAGCTCCTGAAGAAACAGCTTAGTTCGCTAAGCTGTTTCTTCAGGAGC -3'。

in addition, the invention provides application of the LINC02075 gene inhibitor in preparation of an osteogenic differentiation promoter of bone marrow mesenchymal stem cells.

Preferably, the gene inhibitor is shRNA,

the sense strand of the shRNA is as follows:

5'-CACCGCTCCTGAAGAAACAGCTTAGCGAACTAAGCTGTTTCTTCAGGAGC -3'，

the antisense strand of the shRNA is:

5'-AAAAGCTCCTGAAGAAACAGCTTAGTTCGCTAAGCTGTTTCTTCAGGAGC -3'。

in addition, the invention provides application of the LINC02075 gene inhibitor in preparation of a medicine for treating osteoporosis.

The invention has the beneficial effects that:

the invention proves that the long-chain non-coding RNA LINC02075 can remarkably inhibit the adipogenic differentiation related genes PPAR gamma, C/EBP alpha and AP2 of the mesenchymal stem cells to inhibit the adipogenic differentiation of the mesenchymal stem cells for the first time, and simultaneously, the inhibition LINC02075 can remarkably promote the osteogenic differentiation related genes OCN, ALP and RUNX2 to promote the osteogenic differentiation of the mesenchymal stem cells, thereby providing possibility for further developing medicines for treating osteoporosis.

Drawings

FIG. 1 changes in the expression level of LINC02075 at 7 and 14 days of adipogenic differentiation

FIG. 2 sh-LINC02075 inhibitory Effect on the expression level of LINC02075 mRNA

FIG. 3 inhibition of the effect of LINC02075 on the mRNA levels of the adipogenic differentiation-associated genes PPAR γ, C/EBP α and AP2

FIG. 4 inhibition of the Effect of LINC02075 on the protein levels of adipogenic differentiation-associated genes PPAR γ, C/EBP α and AP2

FIG. 5 oil red O staining detection of the effect of inhibiting LINC02075 on the adipogenic differentiation of bone marrow mesenchymal stem cells

FIG. 6 inhibition of the Effect of LINC02075 on the mRNA levels of the osteogenic differentiation-associated genes OCN, ALP and RUNX2

FIG. 7 inhibits the effect of LINC02075 on the protein levels of osteogenic differentiation-related genes OCN, ALP and RUNX 2.

Detailed Description

Example 1

Fluorescent quantitative PCR detection of expression level of LINC02075 in adipogenic induction process

1. Induction of adipogenesis

(1) Selecting a third generation human mesenchymal stem cell (purchased from Sciencell company) in logarithmic phase to inoculate into a culture bottle, and adding a complete culture medium to culture;

(2) when the cell fusion degree reaches 70%, the culture medium is replaced by a adipogenic induction culture medium once every 3 days, and RNA is extracted 14 days after adipogenic induction.

RNA extraction

RNA was extracted on days 0, 7 and 14, respectively, and 3 controls were set for each group.

(1) Removing the culture medium, adding 500 mu L Trizol into each hole, and repeatedly blowing and beating the cells until clear and non-viscous liquid is formed;

(2) transferring the mixed solution into a 1.5ml EP tube, adding 100 mu L of chloroform, violently shaking and fully mixing the mixture on an oscillator for 15s, and standing the mixture for 5 minutes at room temperature;

(3) centrifuging at a low temperature and a high speed at 12000r/min for 15min at 4 ℃, and carefully transferring the upper layer transparent RNA aqueous phase into a new RNA enzyme-free EP tube;

(4) adding isopropanol with the same volume, mixing, standing on ice for 10min, 13000r/min, centrifuging at 4 deg.C for 10min, discarding supernatant to obtain white precipitate at tube bottom;

(5) adding 400 μ L70% alcohol, shaking gently, 12000rpm/min at 4 deg.C for 5min, discarding supernatant, placing the tube opening downward, tightly attaching to filter paper, sucking off liquid in the tube opening, drying at room temperature for 5-10min, and detecting RNA concentration and quality.

Reverse transcription of RNA into cDNA

(1) Reverse transcription system

(2) Conditions of reverse transcription reaction

37℃ 15min；85℃ 5s；4℃

4. Fluorescent quantitative PCR reaction

Reaction system:

reaction conditions are as follows:

10min at 95 ℃; 40 cycles of 95 ℃ for 20s, 60 ℃ for 40 s; 5min at 72 ℃.

Primer sequences

Results of the experiment

The experimental results are shown in fig. 1, and it can be seen from the graph that the relative expression level of LINC02075 is 3.13 ± 0.13 (P < 0.0001) 7 days after adipogenic induction and the relative expression level of LINC02075 is 3.95 ± 0.22 (P < 0.0001) 14 days after adipogenic induction, and the above results indicate that the expression level of LINC02075 is significantly up-regulated during the adipogenic induction.

Example 2

Fluorescent quantitative PCR detection of sh-LINC02075 inhibition effect

(1) sh-LINC02075 sequence is as follows:

sense strand: 5'-CACCGCTCCTGAAGAAACAGCTTAGCGAACTAAGCTGTTTCTTCAGGAGC-3' (SEQ ID NO. 6)

Antisense strand: 5'-AAAAGCTCCTGAAGAAACAGCTTAGTTCGCTAAGCTGTTTCTTCAGGAGC-3' (SEQ ID NO. 7)

(2) The lentivirus vector is constructed by the Gicky gene company, bone marrow mesenchymal stem cells are transfected according to the transfection instruction, RNA is extracted after 48 hours, and the fluorescent quantitative detection is carried out, wherein the steps are the same as the example 1.

Results of the experiment

The experimental results are shown in FIG. 2, and it can be seen that the inhibition ratio of sh-LINC02075 is 70.4%.

Example 3

Inhibition of influence of LINC02075 on mRNA level of bone marrow mesenchymal stem cell adipogenic differentiation related genes PPAR gamma, C/EBP alpha and AP2

1. The primer sequences of PPAR γ, C/EBP α and AP2 are as follows:

name of Gene	Primer sequences
		PPARγ	GCCCAGGTTTGCTGAATGTG（SEQ ID NO.8）
	TTGGCAAACAGCTGTGAGGA（SEQ ID NO.9）
		C/EBPα	AGAACAGCAACGAGTACCGG（SEQ ID NO.10）
	GCGGTCATTGTCACTGGTCA（SEQ ID NO.11）
		AP2	TGGGCCAGGAATTTGACGAA（SEQ ID NO.12）
	CCATCCCATTTCTGCACATGT（SEQ ID NO.13）

2. And (3) inoculating the bone marrow mesenchymal stem cells transfected with sh-NC and sh-LINC02075 on a culture plate, performing adipogenesis induction, extracting RNA after 14 days of adipogenesis induction, and detecting the expression difference of PPAR gamma, C/EBP alpha and AP2 between an sh-NC group and an sh-LINC02075 group by using fluorescence quantitative PCR.

Results of the experiment

The experimental results are shown in fig. 3, and it can be seen from the figure that after LINC02075 is inhibited, the expression of lipogenic differentiation related genes PPAR γ, C/ebpa and AP2 can be significantly inhibited, wherein the relative expression level of PPAR γ is 0.52 ± 0.02 (P < 0.0001), the relative expression level of C/ebpa is 0.22 ± 0.05 (P < 0.0001), and the relative expression level of AP2 is 0.41 ± 0.04 (P < 0.0001).

Example 4

Inhibiting the influence of LINC02075 on the protein levels of bone marrow mesenchymal stem cell adipogenic differentiation related genes PPAR gamma, C/EBP alpha and AP 2.

1. Protein extraction

(1) Inoculating bone marrow mesenchymal stem cells transfected with sh-NC and sh-LINC02075 on a culture plate, performing adipogenesis induction, adding 100 mu L of RIPA lysate into the culture plate after 14 days of adipogenesis induction, scraping the cells by using a cell scraper, and collecting the cell lysate into an EP (EP) tube;

(2) crushing the cells by using a cell ultrasonic crusher, centrifuging for 15min at 4 ℃ at 12000 r/min;

(3) the supernatant was transferred to a new EP tube and the protein concentration was measured using the BCA method;

(4) the protein concentration was adjusted to 2. mu.g/. mu.L using 5 Xloading buffer and the protein sample was obtained by boiling for 5 min.

Western blot experiment

(1) Preparing 12% separation gel and 5% concentrated gel, and adding 10 μ L protein sample into each well;

(2) electrophoresis conditions: concentrating the gel at constant pressure of 90V for about 20 minutes; the separation gel is 130V, and the time is about 1 h;

(3) and (3) electrotransfer conditions: constant current 280mA, NC film with 0.45nm aperture; the film transferring time is 1.5 h;

(4) gently taking out the membrane with forceps, placing in 5% skimmed milk powder, and sealing at room temperature for 1 h;

(5) cutting bands according to the size of the protein, incubating corresponding C/EBP alpha, PPAR gamma, AP2 and beta-actin primary antibody, and incubating overnight at 4 ℃;

(6) taking out the membrane the next day, incubating at room temperature for 30min, washing the membrane with TBST for 3 min each time, and repeating for 3 times;

(7) incubating the secondary antibody, and incubating for 1h in a shaking table at room temperature;

(8) the membrane was washed with TBST for 3 minutes each, repeated 3 times, and subjected to development exposure.

Results of the experiment

The experimental result is shown in figure 4, and it can be seen from the figure that compared with the sh-NC group, the protein expression levels of C/EBP alpha, PPAR gamma and AP2 of the sh-LINC02075 group are obviously lower than those of the si-NC group, which indicates that the inhibition of LINC02075 can obviously inhibit the protein expression of adipogenic differentiation related genes C/EBP alpha, PPAR gamma and AP 2.

Example 5

Oil red O staining detection

(1) Inoculating bone marrow mesenchymal stem cells transfected with sh-NC and sh-LINC02075 on a culture plate for adipogenic induction;

(3) after 14 days of adipogenic induction, the culture medium is discarded, the cells are gently washed 3 times with PBS (phosphate buffer solution), 3 minutes each time, and 10 percent formaldehyde is added for fixation for 40 minutes;

(4) discarding formaldehyde, adding 500 mu L of oil red O staining solution, and staining for 30 minutes;

(5) oil red O was removed and the cells were gently washed 3 times with PBS for 3 minutes each, observed under an inverted microscope and photographed.

Results of the experiment

The experimental result is shown in fig. 5, and it can be seen from the figure that the number of oil red O-stained cells in the transfected sh-LINC02075 group is significantly lower than that in the transfected sh-NC group, which indicates that the inhibition of LINC02075 can effectively inhibit the generation of lipid differentiation of mesenchymal stem cells and the transformation of mesenchymal stem cells into adipocytes.

Example 6

1. Osteogenic induction

(2) when the cell confluence reached 70%, the medium was changed to osteogenic induction medium every 3 days.

2. Fluorescent quantitative PCR detection of influence of LINC02035 inhibition on mRNA levels of osteogenic differentiation related genes OCN, ALP and RUNX2

(1) Primer sequences for OCN, ALP and RUNX2 were as follows:

name of molecule	Sequence of
		RUNX2	TTCTCCAACCCACGAATGCA（SEQ ID NO.14）
	GGTGTGGTAGTGAGTGGTGG（SEQ ID NO.15）
		ALP	TCGTTGACACCTGGAAGAGC（SEQ ID NO.16）
	CCTGTTCAGCTCGTACTGCA（SEQ ID NO.17）
		OCN	GTGCAGCCTTTGTGTCCAAG（SEQ ID NO.18）
	CGGATTGAGCTCACACACCT（SEQ ID NO.19）

2. Bone marrow mesenchymal stem cells transfected with sh-NC and sh-LINC02075 were inoculated on a culture plate for osteogenic induction, 7 days after osteogenic induction, RNA was extracted, and the expression differences of RUNX2, ALP and OCN between the sh-NC group and the sh-LINC02075 group were detected by fluorescence quantitative PCR, using the same experimental procedure as in example 1.

Results of the experiment

The experimental results are shown in fig. 6, and it can be seen from the graph that the mRNA expression levels of RUNX2, ALP and OCN of the sh-LINC02075 group are significantly higher than those of the sh-NC group, wherein the relative expression level of RUNX2 is 2.38 ± 0.26 (P < 0.01), the relative expression level of OCN is 3.82 ± 0.16 (P < 0.0001), and the relative expression level of ALP is 3.04 ± 0.25 (P < 0.01), and it can be seen from the above results that the inhibition of LINC02075 can significantly promote the mRNA level expression of the osteogenic differentiation related gene.

Example 7

Example 4

1. Protein extraction

(1) Inoculating bone marrow mesenchymal stem cells transfected with sh-NC and sh-LINC02075 on a culture plate, performing adipogenesis induction, adding 100 mu L of RIPA lysate into the culture plate after 7 days of osteogenesis induction, scraping the cells by using a cell scraper, and collecting the cell lysate into an EP (EP) tube;

Western blot experiment

(5) cutting the strips according to the protein size, incubating corresponding OCN, ALP, RUNX2 and beta-actin primary antibodies, and incubating overnight at 4 ℃;

Results of the experiment

The experimental result is shown in fig. 7, and it can be seen from the figure that after LINC02075 is inhibited, the protein expression amounts of the osteogenic culture related genes OCN, ALP and RUNX2 are obviously higher than those of the control group, which indicates that the inhibition of LINC02075 can significantly promote osteogenic differentiation of bone marrow mesenchymal stem cells.

Sequence listing

<110> Sino Situo New cell medicine Limited

<120> role of long non-coding RNA in osteogenic differentiation and adipogenic differentiation of stem cells

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1754

<212> DNA

<213> Human source (Human)

<400> 1

agttgcaatg ccccagtgag gcagtagact gacctcacgt gacttttggg aatgaacact 60

gagaccatca accctatcaa tgagggttat aaaaacaaca acgaagtacc acctgacaac 120

ttcaaattat ttattgattc ctgaaaagga aaatgaaagg aagctggcca aagccacgga 180

gtgccagttg aataagttat caagagtctt cttggattga cgatgcggct ccatttgcag 240

cacttagcat cttctgcctt ggaggagagc tcctggtggg cgctcagccc acctgcttca 300

actgcaagct cactgaagac agacacccca gtttagcatg gtgcccggct ggcaggaggg 360

ctcttttcct cttttgcaga ctgttgatgc agcctcctaa gtaccctctc tgcctcccat 420

cttggctcct ccagtccacc ctacagtctt cctaagacac tgactgatcg gatcctctga 480

ctctgctgaa atgcctcagg gactctccac agctacagca atgacttccc aagagtgccc 540

tggggcacaa cagtcccaag agatgctcct gaagaaacag cttagggcca aaataaatgt 600

agaaaatgct ctttactgaa gctccccagc ccttggagat tcacatgccc tatgagcata 660

atcagggatc tgagaagtcc tgcaaggtta gcatgcagcc aggttagcat atttgataca 720

gttttccgaa gctttttcca tcacaggcaa tctttttgca agcaatgtct acaaacagcc 780

caagacatag tcccacagaa catactttgg gaagcagtga gctgcatggt agagcctgaa 840

gttcagtcgg ggaggggaag ggcagcggtt gtgtgatgag tccctgccca agggaacatg 900

gtctgtggga gactgagatg gctcagggtg caaaagggaa ggtgctggct gtgtgcagac 960

atgacagaga cttgtgggtc aggaaagtcc atcagcagct ctcctctctg ccttcagtct 1020

cttcatctag acacagatgt cctgggcacg tgtgtgtttc tagacctggc acatcctgag 1080

tgaatcttgg cctcttaatg aacccagcag cctcctgctg cagagtcgct gagatgctgt 1140

gcagttatga catatcctcc caccacaaaa gaacattcca gcttgtccag gggatggtca 1200

cggaggccag tgctccaccg gatccccagc agcaggagcc ttctgtggta gaaaaagcat 1260

gggcatcgga ggccgagtcc gggattccca tcctgatcca tcactgacta ggtgctgtgg 1320

ggccttggag acgtggtttc aacacattgg ccaggctggt ctcgaactcc tgaagtcgtg 1380

attcgcccgc cttggcctcc caaagtgctg ggtttatagg catgagccgc tgcacccggc 1440

ccaggttgag gtttttgaag agcatcacct ttgcaggtga gaaacgctgc aggcaggaat 1500

ccagccgtca ttcttgacac cacccttatc taatcccctg ccaactgcta gttccagcca 1560

gcatcagctc tctcctggac cactgccact acctcctaac aggattccca cctccacctc 1620

cgctctcatt acccccgatc tgcagccaac ttgagatgat catatcaccc cctccacacc 1680

caacacaact ccaaaatgca aagaggcttc ctctgttctt ggatcaaggg tttaaacatg 1740

acctagaagc cctc 1754

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gctgcatggt agagcctgaa 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cagcaccttc ccttttgcac 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acatggctga gaacgggaag 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gccttctcca tggtggtgaa 20

<210> 6

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caccgctcct gaagaaacag cttagcgaac taagctgttt cttcaggagc 50

<210> 7

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aaaagctcct gaagaaacag cttagttcgc taagctgttt cttcaggagc 50

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcccaggttt gctgaatgtg 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttggcaaaca gctgtgagga 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

agaacagcaa cgagtaccgg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gcggtcattg tcactggtca 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tgggccagga atttgacgaa 20

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ccatcccatt tctgcacatg t 21

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ttctccaacc cacgaatgca 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ggtgtggtag tgagtggtgg 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tcgttgacac ctggaagagc 20

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

cctgttcagc tcgtactgca 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gtgcagcctt tgtgtccaag 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

cggattgagc tcacacacct 20

Claims

The application of the LINC02075 gene inhibitor in preparing the osteogenic differentiation promoter of the mesenchymal stem cells is characterized in that the sequence of a transcript of the LINC02075 is shown as SEQ ID No. 1;

the gene inhibitor is shRNA (short hairpin ribonucleic acid),

the sense strand of the shRNA is as follows:

5'-CACCGCTCCTGAAGAAACAGCTTAGCGAACTAAGCTGTTTCTTCAGGAGC -3'，

the antisense strand of the shRNA is:

5'-AAAAGCTCCTGAAGAAACAGCTTAGTTCGCTAAGCTGTTTCTTCAGGAGC -3'。