CN114369683A - Detection kit for Malaysia prawn virus - Google Patents

Abstract

The invention discloses a detection kit for a Macrobrachium malabaricum virus. The invention designs and develops a corresponding detection kit by taking a 313-1029 th nucleotide sequence in a Malaysia macrobrachium malabaricum virus MrPV-4 genome as a target gene, and establishes nested and qPCR detection methods. The nested PCR method established by the invention has high sensitivity, good repeatability and specificity, and the lowest detection limit is 10 copies/mu L; the Ct value of the established qPCR method has good linear relation with the copy number of the standard product, and the minimum detectionOut limit of 10²The copies/mu L can be used for monitoring the shrimp disease in the culture process and detecting the MrPV-4.

Description

Detection kit for Malaysia prawn virus

Technical Field

The invention belongs to the technical field of detection of aquatic virus pathogens. More particularly, it relates to a detection kit for Macrobrachium malabaricum virus.

Background

Aquatic diseases seriously restrict the development of the aquaculture industry, and more signs show that the research of the aquatic diseases has urgent need for the rapid detection and identification of new viruses. In the face of complex aquatic viruses propagated by Shu gradually, the macrovirology seems to meet the requirement of identifying new viruses. The macro virology primarily splices the genome sequence of the virus by enriching, sequencing and biological information analysis of the virus in the environment and primarily classifies the virus into known virus families. The method does not need to culture specific cell strains of the virus and does not need to carry out antigen-antibody reaction on the virus, and a plurality of researches show that a novel virus which is difficult to discover by the traditional method is obtained by a macroviromics method. The invention discovers a new small RNA virus, namely MrPV-4, by enriching and sequencing macroviruses in macrobrachium malabaricum infected with the disease of the iron-shell shrimps.

The iron-shelled shrimp is the shrimp which shows the phenomena of early sexual maturity such as yellow body surface, slow growth or stop growth, blue turning of double chela limbs, lengthening and the like, and the iron-shelled shrimp can not die, but can cause the yield to be reduced, thereby causing the waste of breeding resources such as feed and the like and causing economic loss. In order to facilitate monitoring of the shrimp diseases of the iron shells and timely perform targeted treatment on possible risks, a monitoring method of the shrimp diseases of the iron shells is needed to be established, detection is performed on MrPV-4, a corresponding detection kit is developed, and the like.

The nested PCR and the fluorescent quantitative PCR have the advantages of strong detection specificity, high sensitivity and the like, and are widely applied to the detection of aquatic animal virus pathogens. For example, Higherhui et al established a nested PCR assay for this virus based on the oyster herpesvirus DNA polymerase gene (Higherhui, Baichangming, Chuainli, et al. establishment and use of nested PCR assay based on oyster herpesvirus DNA polymerase gene [ J ]. aquatic science, 2016,40(3): 326-. Chinese patent CN 103966358A also discloses a fluorescent quantitative PCR detection kit and a detection method for siniperca chuatsi infectious spleen and kidney necrosis virus. However, no kit or method for detecting MrPV-4 to monitor the iron-shell shrimp disease exists at present.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings in the prior art and provide a detection kit for the Macrobrachium mackerel virus.

The first object of the present invention is to provide a target gene for detecting Macrobrachium malabaricum virus MrPV-4.

The second purpose of the invention is to provide the application of the target gene in the preparation of products for detecting MrPV-4.

The third purpose of the invention is to provide a detection kit of the Macrobrachium malabaricum virus MrPV-4.

It is a fourth object of the present invention to provide a primer set for detecting the target gene.

The fifth purpose of the invention is to provide the application of the primer group in the preparation of products for detecting MrPV-4.

The sixth purpose of the invention is to provide a nested PCR method for detecting MrPV-4.

The seventh purpose of the invention is to provide a fluorescent quantitative PCR method for detecting MrPV-4.

The above purpose of the invention is realized by the following technical scheme:

macrobrachium rosenbergii (Macrobrachium rosenbergii), also known as Macrobrachium malabaricum, is enriched and macrovirome sequenced by the virus in the Macrobrachium malabaricum infected with the disease of the giant freshwater shrimp, so that a new small RNA virus is discovered from the Macrobrachium malabaricum, which is temporarily named Macrobrachium rosenbergii picornavirus 4(MrPV-4), and the genome sequence is shown as SEQ ID NO. 1.

The invention refers to the phylogenetic analysis of Picornaviridae by international committee for virus classification (ICTV), and carries out phylogenetic analysis on representative species of a plurality of genera in 8 families under Picornavirales of the order of picornaviruses, tentative species which are not classified into the genera, and newly discovered picornaviruses MrPV-1, MrPV-4, MrPV-7 and MrPV-12 by Bayesian tree building through Bayesian tree building. The results show that the relative relationship between MrPV-4 and MrPV-12 is relatively close, but still cannot be classified into the same genus, and branches of the same genus fall between Marnaviridae and Iflaveridae, but are far away from the two families, and cannot be classified into known families.

In order to facilitate monitoring of the iron-shelled shrimp disease, the invention designs and screens nested PCR and fluorescent quantitative PCR primers aiming at MrPV-4 by taking the 8790-9506 th nucleotide sequence in the genome as a target gene, develops a kit for monitoring the iron-shelled shrimp disease and establishes a corresponding monitoring method.

The invention provides a target gene for detecting Macrobrachium malabaricum MrPV-4, and the nucleotide sequence of the target gene is shown as SEQ ID NO. 2.

On the basis of the target gene, the nested PCR and fluorescent quantitative PCR detection method of MrPV-4 is successfully constructed by designing a PCR primer, and the monitoring of the shrimp disease of the iron shells is realized. Therefore, the application of the invention protects the application of the target gene shown in SEQ ID NO.2 in the preparation of products for detecting MrPV-4.

The invention also provides a primer group for detecting the target gene shown in SEQ ID NO. 2.

Preferably, the primer group for detecting the target gene shown in SEQ ID NO.2 is a nested PCR primer, the sequence of which is shown in SEQ ID NO. 3-6, as shown in example 1.

Preferably, the primer group for detecting the target gene shown in SEQ ID NO.2 is a fluorescent quantitative PCR primer, and the sequence of the primer group is shown in SEQ ID NO. 7-8, see example 4.

The invention also applies to protect the application of the primer group in the preparation of products for detecting MrPV-4.

The invention also applies to and protects a detection kit of the Macrobrachium malabaricum virus MrPV-4, which contains a reagent for detecting the target gene shown in SEQ ID NO. 2.

Preferably, the reagent comprises a primer group for detecting the target gene shown in SEQ ID NO. 2.

Preferably, the reagent comprises a nested PCR primer for detecting a target gene shown as SEQ ID NO.2, and the sequence of the primer is shown as SEQ ID NO. 3-6.

Preferably, the reagent comprises a fluorescent quantitative PCR primer for detecting a target gene shown as SEQ ID NO.2, and the sequence of the primer is shown as SEQ ID NO. 7-8.

Preferably, the kit also comprises a positive recombinant plasmid containing a target gene sequence shown in SEQ ID NO.2 as a positive control.

The invention also provides a nested PCR method for monitoring the shrimp disease by detecting the MrPV-4, namely, nested PCR primers shown in SEQ ID NO. 3-6 are used for carrying out PCR amplification on a sample to be detected, and if a specific band with the size of 717bp appears in the nested first round PCR or a specific band with the size of 340bp appears in the nested second round PCR, the detected sample contains the virus MrPV-4.

The invention also provides a fluorescent quantitative PCR method for monitoring the shrimp disease by detecting MrPV-4, namely, a sample to be detected is amplified by using fluorescent quantitative PCR primers shown in SEQ ID NO. 7-8, and if an amplification curve appears in a qPCR result and the corresponding Ct value is less than 37, the detected sample is a positive result; if no amplification curve exists or the Ct value is more than or equal to 40, the result is negative; if the Ct value of the amplification curve is between 37 and 40, the experiment is recommended to be repeated, if the Ct value of the repeated result is less than 40 and the amplification curve has obvious peaks, the tested sample is positive, otherwise, the sample is negative. Preferably, in selecting the sample tissue, the sub-crustal tissue is taken if the sample is a shrimp fry, and the gill and muscle, or the swimming paw of a parent shrimp is taken if the sample is a shrimp, as in example 1.

Preferably, when reverse transcription of RNA into cDNA is carried out, 500-1000 ng of RNA is added to a 20. mu.L reverse transcription system, as described in example 1.

More preferably, when reverse transcription of RNA into cDNA is carried out, 500-800 ng of RNA is added to a 20. mu.L reverse transcription system, as described in example 1.

Preferably, the annealing temperature of the first round nested PCR primer is 50 ℃ to 60 ℃, see example 1.

More preferably, the annealing temperature of the first round nested PCR primers is 57 ℃, see example 1.

Preferably, the annealing temperature of the second round nested PCR primer is 50 ℃ to 60 ℃, see example 1.

More preferably, the annealing temperature of the second round nested PCR primer is 56 ℃ as shown in example 1.

Specifically, the reaction system of the first round of nested PCR reaction is: 2 × Accurate Taq Master Mix 10uL, 5 μ M forward and reverse primers 0.5uL each, 1uL of cDNA template, 8uL of sterile water.

Specifically, the amplification procedure of the first round of nested PCR reaction is: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles; extension at 72 deg.C for 10min, and final storage at 4 deg.C.

Specifically, if no positive band is detected in the first round of nested PCR amplification, diluting the product by 50-100 times with sterile water, and then using the diluted product as a template to perform the second round of PCR amplification.

Specifically, the amplification procedure of the second round of nested PCR reaction is: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles; extension at 72 deg.C for 10min, and final storage at 4 deg.C.

Specifically, the reaction system of the fluorescent quantitative PCR is as follows: 1 μ L cDNA, primer F0.2 μ L primer R0.2 μ L2 × SYBR GREEN I MIX 5 μ L ddH₂Make up to 10. mu.L of O.

The invention has the following beneficial effects:

the invention provides a kit and a method for detecting MrPV-4, aiming at the MrPV-4. The nested PCR method for detecting MrPV-4, which is established by the invention, has high detection sensitivity, good repeatability and specificity, and the lowest detection limit is 10 copies/mu L. The Ct value of the established qPCR method has good linear relation with the copy number of the standard substance, high sensitivity, good specificity and repeatability, and the minimum detection limit of the method is 10²The copies/mu L, the obtained intra-group variation coefficient and the inter-group variation coefficient are both lower than 5 percent, can be used for detecting MrPV-4 virus, screening and eliminating the virus-carrying seed shrimps, reducing the loss in the culture process and playing a role in monitoring the iron-shell shrimp disease.

Drawings

FIG. 1 shows the results of phylogenetic analyses of MrPV-4 virus.

FIG. 2 shows the amplification results of nested PCR primer MrPV-4-1-F/R.

FIG. 3 shows the amplification results of nested PCR primers, wherein the left panel shows the amplification results of the primer MrPV-4-1-F/R, and the right panel shows the amplification results of the primer MrPV-4-2-F/R.

FIG. 4 shows the result of detecting the optimal annealing temperature of the nested PCR primer MrPV-4-1-F/R, the experiment was repeated three times, the annealing temperatures corresponding to lanes 1-6 were 50 deg.C, 50.9 deg.C, 53.3 deg.C, 55.7 deg.C, 56.8 deg.C and 59.9 deg.C, and lane 7 was a negative control.

FIG. 5 shows the result of detecting the optimal annealing temperature of the nested PCR primer MrPV-4-2-F/R, the experiment was repeated three times, the annealing temperatures corresponding to lanes 1-6 were 50 deg.C, 50.9 deg.C, 53.3 deg.C, 55.7 deg.C, 56.8 deg.C and 59.9 deg.C, and lane 7 was a negative control.

FIG. 6 shows the result of the sensitivity detection of nested PCR primers MrPV-4-1-F/R, the experiment was repeated three times, and the template concentrations corresponding to lanes 1-7 were 10⁷copies/uL、10⁶copies/uL、10⁵copies/uL、10⁴copies/uL、10³copies/uL、10²copies/uL and 10copies/uL, lane 8 is a negative control.

FIG. 7 shows the result of the sensitivity detection of nested PCR primers MrPV-4-2-F/R, the experiment was repeated three times, and the template concentrations corresponding to lanes 1-4 were 10⁴copies/uL、10³copies/uL、10²copies/uL and 10copies/uL, lane 5 is a negative control.

FIG. 8 shows the specific detection result of nested PCR primer MrPV-4-1-F/R, the positive samples in lanes 1-4 are IPV, MrPV-1, MrDV-3, McDV and McRV, respectively, lane 5 is a positive recombinant plasmid, and N is a negative control.

FIG. 9 shows the specific detection result of nested PCR primer MrPV-4-2-F/R, the positive samples in lanes 1-4 are IPV, MrPV-1, MrDV-3, McDV and McRV, respectively, lane 5 is a positive recombinant plasmid, and N is a negative control.

FIG. 10 shows the result of the nested PCR primer MrPV-4-1-F/R on the gill sample of 10 Macrobrachium rosenbergii in Huzhou, Zhejiang, where N is a negative control.

FIG. 11 shows the result of the nested PCR primer MrPV-4-1-F/R on the gill sample of 10 Macrobrachium rosenbergii in Huzhou, Zhejiang, where N is a negative control.

FIG. 12 is a fluorescent quantitative PCR standard curve.

FIG. 13 shows the amplification curve of the fluorescent quantitative PCR primers, with the concentration of the A-H positive recombinant plasmids being 10⁸copies/uL～10copies/uL。

FIG. 14 shows the specific detection results of fluorescent quantitative PCR, wherein A is an IPV positive sample, B is an MrPV-1 positive sample, C is an MrDV3 positive sample, D is a McDV and McRV positive sample, E is a positive control, and F is a negative control.

FIG. 15 shows the results of fluorescence quantitative PCR primers on 10 Macrobrachium rosenbergii samples in Huzhou, Zhejiang province.

Detailed Description

The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.

Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

Example 1 establishment of nested PCR detection method and optimization of reaction conditions

1. Design of nested PCR primers

The invention discovers a novel small RNA virus from Macrobrachium malabaricum infected with 'shrimp-shaped' disease by macrovirome sequencing, tentatively names the small RNA virus as Macrobrachium rosenbergii picornavirus 4(MrPV-4), and the genome sequence is shown as SEQ ID NO. 1. Meanwhile, the invention refers to the phylogenetic analysis of Picornaviridae by the International Committee for viral Classification (ICTV), and carries out phylogenetic analysis on representative species of a plurality of genera within 8 families under Picornavirales of Picornaviridae, tentative species which are not classified into the genera, newly discovered small RNA viruses MrPV-1, MrPV-4, MrPV-7 and MrPV-12 by Bayesian tree building through Bayesian tree building, and the result is shown in FIG. 1. As can be seen from FIG. 1, the relative relationship between MrPV-4 and MrPV-12 is relatively close, but still cannot be classified into the same genus, and the branches fall between Marnaviridae and Iflaveridae, but are far from both families, and cannot be classified into known families.

In order to realize monitoring of MrPV-4 virus, the nucleotide sequence of 8790-9506 th site in the MrPV-4 virus genome is used as a target gene (shown as SEQ ID NO. 2), nested PCR amplification primers MrPV-4-1-F/R and MrPV-4-2-F/R are designed and screened, and the sizes of fragments to be amplified are 717bp and 340bp respectively.

The sequence of the first round amplification primer (hereinafter referred to as first amplification) of nested PCR is shown as follows:

MrPV-4-1-F(SEQ ID NO.3)：CCTTGGATATGAAGTCACCTCAG

MrPV-4-1-R(SEQ ID NO.4)：GCGAGCGGATAAGTTCTTAATAGA

the nested PCR amplification primer MrPV-4-1-F is 23bp long, is positioned at 8790-8812 th from the 5' end of the MrPV-4 genome, is 24bp long, and is positioned at 9483-9506 th of the genome.

The sequence of the nested PCR second round amplification primer (hereinafter referred to as second amplification) is shown as follows:

MrPV-4-2-F(SEQ ID NO.5)：GATGGAACACCACCTTAC

MrPV-4-2-R(SEQ ID NO.6)：TCAATTACAGCACGAGTC

the nested PCR amplification primer MrPV-4-2-F is 18bp long, is positioned at the 8829 th to 8846 th sites from the 5' end of the MrPV-4 genome, and is 18bp long, and is positioned at the 9151 th to 9168 th sites of the genome.

2. Tissue RNA extraction and reverse transcription

Selecting a tissue: and if the sample to be detected is a shrimp fry, taking a subcrustal tissue, and if the sample to be detected is a prawn, taking gills and muscles or taking swimming feet of a parent prawn.

Tissue RNA extraction Using Promega

The Super total RNA extraction kit (cat # LS1040), the specific steps are performed according to the kit instructions. After completion of the RNA extraction, the concentration was measured, and then the tissue RNA was reverse-transcribed into cDNA using Evo M-MLV reverse transcription premix kit (cat # AG11728) from Exkory.

Adding 500-1000 ng (preferably 500-800 ng) of template RNA into the prepared reaction system, performing water bath at 37 ℃ for 15min, performing water bath inactivation at 85 ℃ for 5s, and freezing and storing at-20 ℃ for later use.

3. Establishment of nested PCR method

(1) First round nested PCR

The cDNA obtained by reverse transcription is used as a template, a first round of nested PCR primers MrPV-4-7-F/R are used for PCR amplification, and a negative control is set. The PCR adopts a 20uL system, and the reagent used for amplification is 2x Accurate Taq premix (containing dye) of Esciurel, and the product number is AG 11019.

And (3) PCR reaction system: 2 × Accurate Taq Master Mix 10uL, forward and reverse primers at a concentration of 5 μ M each 0.5uL, cDNA template at 1uL, and 8uL of sterile water.

PCR reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles; extending for 10min at 72 ℃, and storing at 4 ℃.

After the PCR reaction is finished, taking a proper amount of PCR products for electrophoresis detection, wherein the result is shown in figure 2, a negative control (N) has no band, and a single band with the size consistent with the expected size appears in a lane 4, which indicates that the PCR method is successfully constructed, and the detected sample is MrPV-4 virus positive and has high toxic content.

(2) Second round of nested PCR

And if the positive strip is not detected in the first round of nested PCR amplification products, diluting the first round of PCR products by 50-100 times with sterilized water, using the diluted products as a template, and performing second round of nested PCR amplification by using a primer MrPV-4-2-F/R. The PCR reaction system is the same as the above, and the amplification procedure is changed into: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 1mins, and 30 cycles; extending for 10min at 72 ℃, and storing at 4 ℃.

The PCR amplification result is shown in FIG. 3, the left side is the first round nested PCR amplification result without a band, after the first round amplification product is diluted by 50 times, the second round amplification product has a single positive band but no band in the negative control, the band size is consistent with the expected fragment size, the construction success of the PCR method is shown, and the detected sample is MrPV-4 virus positive but has lower toxic amount.

4. Construction of Positive recombinant plasmid pMD19-T-MrPV-4

The cDNA obtained by reverse transcription is taken as a template, an amplification primer MrPV-4-1-F/R is used for amplification, and the amplification reaction system and the reaction procedure are the same as above. And detecting the PCR product by using 1% agarose gel electrophoresis, selecting a strip with the size consistent with the expected size, sending the PCR product corresponding to the strip to a Tianyihui company for sequencing, comparing the sequencing result with the sequence spliced by the macrovirus group, and carrying out the next experiment if the sequence is consistent.

The PCR product was recovered by cutting the Gel using the MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 from TaKaRa, and pMD from TaKaRa was used^TMThe 19-T Vector Cloning Kit (cat # 3271) ligated the gel recovery product with the pMD-19T Vector. After the ligation, the ligation product was transferred into DH 5. alpha. E.coli competent cells by heat shock method, shaken, spread on an Amp-resistant LB medium, incubated overnight at 37 ℃ and screened for single colonies the next day. After the picked single colony is propagated, PCR detection is carried out on the bacterial liquid of the picked single colony by using an amplification primer MrPV-4-1-F/R. Screening bacterial liquid with target bands, sequencing and detecting whether the bacterial liquid contains target plasmids. Propagating the single colony bacterial liquid with correct sequencing result, extracting Plasmid with MiniBEST Plasmid Purification Kit Ver.4.0 Kit of TaKaRa company to obtain positive recombinant Plasmid pMD19-T-MrPV-4, and freezing at-20 deg.C after determining concentration for later use.

5. Optimization of annealing temperature

At a lower concentration (10)⁴copies/uL) positive recombinant plasmid is taken as a template, amplification is carried out by using a first amplification primer MrPV-4-1-F/R and a second amplification primer MrPV-4-2-F/R respectively at different annealing temperatures, the annealing temperature corresponding to the brightest band is selected as the optimal annealing temperature, and the experiment is repeated for 3 times.

The result of the optimization of the annealing temperature of the first amplification primer MrPV-4-1-F/R is shown in FIG. 4, the annealing temperatures corresponding to lanes 1-6 are 50 ℃, 50.9 ℃, 53.3 ℃, 55.7 ℃, 56.8 ℃ and 59.9 ℃, respectively, lane 7 is a negative control, and it can be seen from the figure that the band of lane 5 is brightest, so the optimal annealing temperature of the first amplification primer MrPV-4-1-F/R is 57 ℃.

The annealing temperature optimization results of the secondary amplification primers MrPV-4-2-F/R are shown in FIG. 5, the annealing temperatures corresponding to the lanes 1-6 are 50 ℃, 50.9 ℃, 53.3 ℃, 55.7 ℃, 56.8 ℃ and 59.9 ℃, respectively, the lane 7 is a negative control, and as can be seen from the figure, the band brightness of the lanes 1-4 is equivalent, so the highest annealing temperature of 56 ℃ is selected as the optimal annealing temperature of the secondary amplification primers MrPV-4-2-F/R.

Example 2 detection of sensitivity, reproducibility and specificity of primers

1. Sensitivity and reproducibility detection

The positive recombinant plasmids prepared in example 1 were each diluted to 10⁷copies/uL、10⁶copies/uL、10⁵copies/uL、10⁴copies/uL、10³copies/uL、10²copies/uL, 10copies/uL and 1 copy/uL. Taking positive recombinant plasmids with different concentrations as templates, carrying out PCR amplification by using an amplification primer, repeating for 3 times, and detecting the sensitivity and the repeatability of the primer.

The sensitivity and the repeatability of the first amplification primer are shown in FIG. 6, and it can be seen from the figure that the results of 3 amplifications are consistent, and the lowest detection limit of the first amplification primer is 10⁴copies/uL。

At a concentration of 10⁴copies/uL、10³copies/uL、10²The positive recombinant plasmids of copies/uL, 10copies/uL and 1copy/uL are taken as templates, PCR amplification is carried out by using two amplification primers, the amplification is repeated for 3 times, and the sensitivity and the repeatability of the primers are detected.

The sensitivity and the repeatability of the two-amplification primer are shown in FIG. 7, and it can be seen from the figure that the results of 3-times amplification are consistent, and the lowest detection limit of the two-amplification primer is 10 copies/uL.

2. Specificity detection

The invention respectively extracts the tissue RNA of the positive samples of the Infectious Prematurity Virus (IPV), the small RNA-like virus-1 (MrPV-1) of the macrobrachium rosenbergii, the bicistronic virus-3 (MrDV-3) of the macrobrachium rosenbergii, the bicistronic virus (McDV) of the blue crab and the reovirus (McRV) of the blue crab, and carries out reverse transcription to obtain the cDNA. The cDNA is taken as a template, a first amplification primer MrPV-4-1-F/R is used for amplification, after the first amplification is finished, a PCR product is diluted by 50 times and taken as the template, and then a second amplification primer MrPV-4-2-F/R is used for amplification. The specific detection results are shown in FIG. 8 and FIG. 9, wherein the positive samples in lanes 1-4 are IPV, MrPV-1, MrDV-3, McDV and McRV, respectively, lane 5 is a positive plasmid, and lane 6 is a negative control. Since McDV is a satellite virus of McRV, the two viruses are in the same positive sample in the actual detection process. As can be seen from FIGS. 8 and 9, the positive control has no single band, and the other groups have no band, indicating that the nested PCR primers of the present invention have good specificity.

EXAMPLE 3 detection of actual samples

The constructed nested PCR detection method is used for detecting 10 Malaysia prawn gill samples collected from Huzhou city, Zhejiang province, and detection results are respectively shown in FIG. 10 and FIG. 11, wherein no band appears in the first amplification cycle, and 3 single bands appear in the second amplification cycle, which indicates that the constructed nested PCR detection method is suitable for actual detection of virus MrPV-4.

Example 4 design of fluorescent quantitative PCR primer and establishment of PCR method

1. Design of fluorescent quantitative PCR primer

The qPCR primer obtained by design and screening was named MrPV-4-q-F/R using the same target gene as in example 1, the size of the fragment to be amplified was 220bp, and the primer sequence was as follows:

MrPV-4-q-F(SEQ ID NO.7)：GCTGTTGAGATGGAACACCACCTT

MrPV-4-q-R(SEQ ID NO.8)：GCTCCTTGAGAATGTCAGGCATGG

the MrPV-4-q-F primer is 24bp in length and is positioned at the 8821-8844 sites of the virus genome from the 5' end, and the MrPV-4-q-R primer is 24bp in length and is positioned at the 8915-8938 sites of the genome.

2. Establishment of fluorescent quantitative PCR method

The qPCR detection method of virus MrPV-4 was constructed by using the cDNA in example 1 as a template and MrPV-4-q-F/R for qPCR detection. The real-time fluorescence quantification system used was: roche LightCycler480 II; the qPCR kit is of Ekery

Green Pro Taq HS premix type qPCR kit II (AG 11702).

The qPCR reaction system is as follows: cDNA1uL, primer F0.2 uL, primer R0.2 uL, 2 XSSYBR GREEN I MIX 5uL, ddH₂O makes up 10 uL.

The qPCR reaction procedure is shown in table 1:

TABLE 1 qPCR reaction procedure

If an amplification curve appears in the qPCR result and the Ct value corresponding to the curve is less than 37, determining that the detected sample is a positive result; if no amplification curve exists or the Ct value is more than or equal to 40, the result is negative; if the Ct value of the curve is between 37 and 40, the experiment is recommended to be repeated, if the Ct value of the repeated result is less than 40 and the amplification curve has obvious peaks, the detected sample is positive, otherwise, the detected sample is negative.

3. Drawing of standard curve and qPCR detection

10 times of positive recombinant plasmids are degressively diluted, and 10 selection times are carried out²copies/uL～10⁷qPCR amplification was performed for 6 dilutions total copies/uL, taking the logarithm of the copy number of the recombinant plasmid as the X-axis and Ct as the Y-axis, and a standard curve was established, as shown in fig. 12, and the equation of the obtained standard curve was: y-3.4071 x + 36.361. The correlation coefficient (R2) and the amplification efficiency (E) of the method were determined to be 0.9942 and 96.6%, indicating that the primers designed by the method were good and the reaction system was normal.

The positive recombinant plasmids with different concentrations are used as templates for qPCR detection, the qPCR amplification curve is shown in figure 13, and the result shows that S-shaped amplification curves appear except negative control non-S-shaped amplification curves, wherein the concentration of A is 10⁷copies/uL, B is 10⁶copies/uL, C10⁵copies/uL with a D of 10⁴copies/uL, E is 10³copies/uL, F is 10²The results show that the fluorescence quantitative PCR method has wide applicable concentration range.

Example 5 sensitivity, specificity and reproducibility of detection

1. Sensitivity detection

Diluting the positive plasmid standard to 10⁰copies/uL～10³And (3) amplifying the copies/uL with qPCR primers at 4 concentrations, repeating the concentrations by 20, selecting the minimum dilution with the variation coefficient less than 5% and the positive detection rate more than 95% as the minimum detection limit of the reaction system and the procedure.

Results of sensitivity detectionAs shown in Table 2, when the dilution is less than 10²The coefficient of variation is more than 5% when copies/uL are used, and the positive detection rate is less than 95%, so the minimum detection limit is 10²copies/uL。

TABLE 2 sensitivity test results

2. Specificity detection

The cDNA of the sample used for nested PCR primer specificity detection in example 2 was used as a template, and qPCR detection was performed using the primer MrPV-4-q-F/R. The specific detection results are shown in FIG. 14, in which A is an IPV positive sample, B is an MrPV-1 positive sample, C is an MrDV-3 positive sample, D is a positive sample of McDV and McRV, E is a positive control, and F is a negative control. As can be seen, only the positive control shows the amplification curve, and the result is consistent with that of nested PCR, indicating that the specificity of the qPCR detection method is good.

3. Repeatability detection

Positive recombinant plasmids (10) at 5 different concentrations³copies/uL、10⁴copies/uL、10⁵copies/uL、10⁶copies/uL、10⁷copies/uL) as a template, and repeating the detection five times, and calculating the intra-group variation coefficient according to the Ct value. In addition, batch-to-batch repeatability tests are carried out at 3 different time points, the batch-to-batch variation coefficient is calculated according to the Ct value, and the stability of the established method is evaluated by utilizing the batch-to-batch and batch-to-batch variation coefficients. The repeatability detection results of the qPCR primers are shown in Table 3, the intra-group variation coefficient is 0.43-3.90%, the inter-group variation coefficient is 1.49-3.81%, and both the intra-group variation coefficient and the inter-group variation coefficient are below 5%, which indicates that the method has good repeatability and reproducibility and stable and reliable results.

TABLE 3 repeatability tests

EXAMPLE 6 fluorescent quantitative PCR detection of real samples

The constructed fluorescence quantitative PCR detection method is used for detecting 10 Malaysia prawn gill samples collected from Huzhou city, Zhejiang, and the fluorescence quantitative PCR result is shown in FIG. 15, and the Ct value corresponding to the curve is shown in Table 4. As can be seen from FIG. 15, 3 of the 10 samples had amplification curves and the corresponding Ct values were less than 37. The Ct value of the positive results against the standard curve was converted to copy numbers 908copies, 6067copies and 385copies, respectively, all in nested PCR amplification (10)⁴copies/uL) and two detection limits of amplification (10)¹copies/uL), the detection result is consistent with nested PCR.

TABLE qPCR detection Ct values for gill samples of 410 Macrobrachium rosenbergii

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> Zhongshan university

<120> detection kit for Malaysia prawn virus

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 9818

<212> DNA

<213> Macrobrachium rosenbergii picornavirus-4 (Macrobrachium rosenbergii virus 4)

<400> 1

ttccggttaa atgtagggta tattaagacc caggcctaat aaagtaaaat aaactaaaat 60

gacggccgag gagcccagaa taaattctgg gtgctctaac atatacgtca tgtctaaaag 120

taaataaaag aaaattagtc atgcgttaag cggaatacta gcttgcttta agtcgtgcga 180

cgactcaatt ccaacgacaa tgacagcgac gaaataagtt aatagcgagg cgaaataaaa 240

tatcgaataa gtgcgtacgg ctccaacctt aaaaacggga tattccctag gaatcacgga 300

gatatcgcga acgcgagcgg ataagttctt aatagaatta tgcgaaatgg atttcaggac 360

caagacggat aaaagaaatt gaaaatttgt gaacgaagcg ttaaaatgtt tatattatgc 420

gagactactt aatactaagc gcaaaaccta tcactaggaa aaagcgcgaa cgaaaattaa 480

aatgataggc atacaacaat aacaactata ataaacaaca aatattcaaa caagaaaaat 540

gaattgttat tgagggcagg ttttgagaaa acattgcaaa acgaaaattg ggtactagct 600

tgcttaaagt cgtgcgacga ctcaacccag agaaaaagaa tgacacgtac tcaattacag 660

cacgagtcgt aggagacgaa cttcctttga aggtcgtaaa tctcgtttct cacggtgttg 720

taattaaccg tgagccacga gcggggaact tttgaaccaa acttccactt gaagtctctg 780

agagcatcag gaccgtgatg acaaatgaaa cgctgcacta cttggaaacg caattgcagg 840

tcactttcgt catcaatgaa ttgtttagga cggtatttga gctccttgag aatgtcaggc 900

atgggcaaag gtgcccacca gacactatca cggcaaacaa aaggtgactt caagaaagtc 960

atctggtcaa aagtaaggtg gtgttccatc tcaacagctt taagagctga ggtgacttca 1020

tatccaagga gatgaagaat ggccttgatg gactggccat tatatttttc tagaacatcg 1080

ggggtgacag attgagcaac atcatcacca taagttaaca tgcgaacttt cgaatcaaac 1140

atacgcaaat catacgcgga cggtgtaaca agcaaacaaa aagcaatata atgaatgtaa 1200

gtgttggtga ttgaattaaa cacgtcagta aacggatttc cagatttgtt tcccttgtgg 1260

gaggttgaaa tgcactccct catgatatgg tacggattgc gaagacattc aatcaaagca 1320

acgcgagcac gctgttcagc aggatccgcc ccctcataat acgccagaac gacgtcttca 1380

aagaagcgaa aagcaggttg tccaacagta ccatcataat tcttaaaatc ttcggcaata 1440

catttgtcac tattcctgag aaaaccctca gcgtaatagc gccaagcttc ctcacgatcc 1500

ataccaatac catgatagaa aacaaatcca gcacgagctt tataataatc aagaaaagca 1560

ccaaaataac gacgaacaag caaaacataa cacaagtcag gttgctcaaa aactcgagtt 1620

ttgccaataa gacacttttc ctccttcaga agctcatcct tggtggtaga aatccaaagt 1680

gagagaggag caatgccttc acgacataac ttttcagcat tttctaaacg tttaacaaaa 1740

gtacatccaa acaaaggaat ttcatgttgc aaagctttag gtgagaattc atacttaacg 1800

ggttcgagtt cttgtccaat tccagtctcc tgaggcaaag ccttgaaaaa ctgtttcttc 1860

ccagccttga aaccaaagct agaccagtaa ccaactccgg tgttcatgtt gagtggctgc 1920

atgatctcgt ttccattgat tgcctcatga agggagtaaa catgcttttg acgacgaatc 1980

tcaaattttg acacaaaatg atcaacacaa tattcatgca gaccaggagg gatagcacgt 2040

cctgcagtgc aggcatactt ttgggcattt gaaataagtg ggtgaacgac gcgcaaatca 2100

ggcaaatgaa caacatgttg tgatgcggga cgataattac aatcttcgtc acgcaaaagt 2160

aattgaccac gataagtaac acgaacaaat ttagtttcag taggtgtaaa gtgtgaagct 2220

ttccacttgc caaacgtacc ctgaccaaca agttccatag tgctattcca atgacgagaa 2280

aagttggcag gcgcaggttc aacagacaac tgaacaatct ctttttcggc aggtggcaca 2340

aaggttaatt taattgaatc aaaagcagct tgcacggagt tgcggtgaat aggtgcggct 2400

ccgacgacat tagcattttt atacaaacaa caatgaaaag cgataatcgg cgagttaagc 2460

atacgtggat gctgcgaaag atatggtagt ccacaatctc catcaacagt agcactggaa 2520

ggtactccat taatgaaaac atggccaggc gcatagcctg cagcagaaaa aatgcccatg 2580

gtgacatcgt aatcatttcc gggcacaacg cgaccatcat gattgataat gcgagcagtt 2640

tgattcttgt taataatggg cgacaaatca tcggcaagaa aagtccaaat attacgacaa 2700

gacgacacag tttcggtacg caattttaca atacgcaaat caatcggttt tccgaaatac 2760

tcaagctggc atgaatttga agcagacaga taaaatggaa tgggttcaga gacagttccg 2820

tccactttac gattagaaat aaacatggca gtttcaggat tgtctcgaac ggcattacga 2880

aaatgttcat acatgtgatt tgggataagc atagtacgac catccaacat gagacattga 2940

gtgcgctgca aattaatacc atcctgaaat atgaaaactt cgcgtaaatt tttcctaatg 3000

cgctcctgat tttggagaac atcagaggtg tcaccttggg gcacagctgg tgcgcctttg 3060

ggttccacct tacggcgacg aataaaacga gcagtatcgt acaccgattg cattgaagca 3120

acctcaacgg aacgaagcaa cgagttaata ataaatgaaa cagttttaaa aacaacgact 3180

aaacctaaac caacagcggc gagaccagca cacattttca taaaaccttg aaaacgtgcc 3240

ttatacacac gataaaaacg cgacaaacga taaatagtgt caaagaaatt ggcatcaacg 3300

acggtttttt cctccttaaa cacttcagga ggccccccat taatgcaaat gttaaacgga 3360

tacggactac gaatttttac gaggcgctta agttcctcgg cttcaaaacc gagttcttca 3420

tcattcataa caagaacagt gtccatgaaa gcactacatt gggagtatga ccaattatcg 3480

gagttgagaa aggtagcccc ccacttctgc aacattgatt gaccttcatc ataattacga 3540

gtggtttgag cggaatagcc ctcccgaaac gaaataagcg gacgagcact ccacatttgc 3600

actgaggcag acgtgtcccc atttgaagaa gctgtagcga ttggtgaggt agtaggagtt 3660

ggatcagctt caatacgagt caacgcatca gagagagcgt taaaatcaac actgcgctct 3720

tgatgcttct tcagaagttc ggcgatataa gtcgagaaaa gaacacggtt attagaaact 3780

acaccattgt acaagttgac aggatacaat tcaaaagcgt cattacacaa acgaatcaaa 3840

tcattagcag aatcgcaatt tgccaattct ccacaaaatt tctgagcatc caattgacga 3900

acaatagcat tttgaccgtt aaagtccaaa ccataatttg gtgcgacaac aacacgatat 3960

gcgaaagtaa tacgacgaac gagtgcggtg gcatcacgca ctttagaaag agcggtttgc 4020

attgacgtca tgtttgaggt tatatttaca aactttgaaa caaacacttc atctttggca 4080

tcgacggcgg ctttattcat agcggcggga atagcgttaa ctaagcgaat tagattggcg 4140

ggatcattac cttcaactga ctgttcaaac tcatccatga caacaaaagg ttgtccgtca 4200

tacccctcaa agaatttatt ttctccaaaa ggcatgacgt aaacatcatg ttgccactct 4260

ttctttccta atttgagctt cagagcgaca atacgcggaa tgagagttgc ggaaagtagg 4320

gacttcccag taccagcatc accacacagg aacgaacaca cgggctgtgg ttgtgcttta 4380

ggagtttgac gcaacttatg caaacgctta taacgagtac gaacgatttc acaaacacgc 4440

atgagattat tgggtatagt catttcaacg gaaagcaaat caagatcacg acacatagtt 4500

gttaaattga cgagaaaagt ccagggagtg gcggcaatag gtttaccggc attgtcctgt 4560

aaagtaagag cggcaagacg cggcaaagtg gtatcttcca tcttctcaaa cgtaaaatat 4620

ccttctccat ccatttctgt aaagatgttg aagagacgca cgtaagagtg tagttgtgca 4680

ctctcccagt tctggttaag aacgtctcca tgaatgagat agagaaaaga atgaaaaaac 4740

aacaacaaaa aagacctgaa gcctgcgtct ttgcagactc cacacgttcg ccggatatat 4800

ttttcatacc cgggtccaag aaagaaacca taaaatccaa gcacactttt aaatagagac 4860

ggaacaacag caccaattcg aaacgaaaaa gggtccactt ctaaatcggc taaattaaac 4920

aaaccttgcg ggcgagcgtc gccctcaaaa gcaggcggct ttccaattaa atcgcctgga 4980

ggaataaacg ctccgaaatc aaccaaatta tcacgcgaat cgacgatatg gcaattaaaa 5040

gcttgtggat ccgaatcact atccacaaaa cgacggcggt cacgttgaat attacaagcg 5100

gcatcggcag cacgatcggc atcgtgctgg tggcgacgag cataacctgg ctcatcatca 5160

gggtccagca aatttacagg cccagcggcg ggcttaatag gatcatcttt tgctctagac 5220

ttggcaaaag catcaaaact accatctgta cacgcggctt ccatccggga aatcaattcc 5280

tctgcttccg catcagaatt gatttcctga tcttcttctt cctcatcgtc attgtgttgt 5340

ttgtcgtgac gaccgacata tttgcgcaag atatttacaa ttgaagcaac ggcaacagtt 5400

ttcatggcga cttcaccata atagaaggta tggacggcgg taataagagg taaaccatcg 5460

tccataagag cagttaaaaa agcaacacac ttatcaaatt ttttagcgag tttttgcttc 5520

aattttgtgg cacctagcgc taaggaagca ccagcagcgg cagcagctgc tgaatcagca 5580

gcaaattttg gtatagcagc gagagttgtc ctaacttgat taaaagcgga aacaatagca 5640

gataaaatat ctgtccaacc ctgaacagtt tcagtgtcag acgcgaaata catttgacga 5700

cgtggtttac gaccacctcg tcgtttaaca aaattacatt cagtatatac aggacgacgc 5760

aagtcacgag aacgagataa atcatcaacg acactatcag aagccgtcac gtcagaaaca 5820

aaagaatcag ttttgtcttt tgctggttcg tgagcaatga aagctttcga atcagcttgt 5880

ggtgtggctt cgacatcagc ggaaatacca aacaacgaca aattagaaaa acgcgaagca 5940

acaagatctt catctgcagc cagagaacgt gttgaagtta cacgccactt tggcaatggc 6000

agataaaagt gcggcatcca atcatcatca accataacat ttgcagtaag ggtaacatcg 6060

gggttacgca tggtgtaaaa attaacaaca ccactgtaac ccggcgaaga atgccaacgt 6120

cccataggca catgaacaag attgtgcata ccgggaactt tgaaatcgac actttgatta 6180

ttaactaggt ttacagaagt gcacacattc atcttccgag cggtcgtttc tggctcattc 6240

atccactcaa aagtgttata gtaagaagta agagaaccat tgacagaggc ataaatacga 6300

caagtcccag tggtacaacc cgaagccaag atgcgatatt taaccccacc agaacaatgc 6360

aaataagggc gcaacatccc ggcaaagtct tccgtcatca tactaggcat gatcgcacca 6420

gtttgagcaa tgtgaataaa atcatcgttg gtggcagcag tgaaacgttg actagacagg 6480

tgatggggca tacgcaataa ttctcgcacg tcccagttgt ggtacatgta tcctttctta 6540

cacaaatcat tcttatagaa agaatgtata gaatcacgag ggctttcaac agtaggcccc 6600

agtggacaag aatcagactg aacaacttcg ccataataag atccataaac aggcgttgcg 6660

aattcgaaat caggaccggc acgaatgtat acatttatat caactgtggt tggagcccct 6720

ggagcaaacg taagagggtg gcgagcttga acaatcaaac aaccagtcat ggccaaatta 6780

tcgaacataa caggagcgta gtcagtgggg aaagtccacg gagcacgcac agcaaagaca 6840

tcatcgtttt gtcctatttg atgggaatat tctggcaaat tacgattatt attgtacaag 6900

cttgtcgttc cgttaggatc aaaataaaca gcaagctctc cacgtgtaaa cggcgacgca 6960

ataatttcaa atttatactc gacgcttcca cgccactggg aaaagaaatg tccccaatga 7020

cttagattcg tagactcacg ctcactgttg gcaacagtag cgttgacagg attcacagga 7080

ataatgaaca aattacctga gttatgagtg gaattccact cgaaaatcat aaggcgagac 7140

caaatacgac acatttcatg tatatttgtc aaagaaggcg ttccaaagtg gtttaattgc 7200

ggattaacaa ccattgaatt aaaaggtcga agagcaacta ctctgtgccc ggaatcggca 7260

cacgacatag tctcggactc ttcttcgcga acttcaacac gacgcaaaga attaggcgtg 7320

gcgccattag agcgattgat tccttccaaa aagggaccag tcatggcgac tttggaagat 7380

tgcggcaaag cgttaatagg cactttaata gcaaagttgg gctcgagggg tgttatagta 7440

atgtgaaaat gcttcgttgc ggattcagtg gacggtcgct tcaatttatt ccacacacca 7500

atgcgaagtg acccataaac gataatattg ggagtcacta ttccaaaaga ttgggggata 7560

gaccaaggaa tgtcaagagc acaagctccc gcactaccta atttggcaat aacatgcggc 7620

aaattgagaa cagaaccata cgaaatctga gtggtggcag cggagaaacc agctggttcc 7680

caatacatac acagagcacc gacactatac ggatcattgt taaaacgcaa cgtagcacga 7740

aaaccggttc gaaacgcgaa ataccctttc ttcagataag cggcagacga ataattaagc 7800

aaataggaac caggtagatc aagaaaggcg gcagttccac taacgttagt attaattgac 7860

caatcgaacg gtccgtaagt acattcgcga aacacggcag ccatactggt tgggctgggc 7920

aaatcatcag accaatcact acgctcctcg acatcatcgc acagaacagg tgcgaggtcg 7980

tcgtgcttgg cttctatagc ggaaagcgaa gcaacggggt gagtgtcaga ttgaggagca 8040

gcctcattat tcataaataa atcagtacac aaggcatgac aatgatcatg tgggcgacaa 8100

ttatcaaaca ataaagtatc atggcaacgc ggcgaacaaa acattacacg attgagagtc 8160

caaaagtact ctccacattc aacgcaagca aaattcggga tacgcgaacg agttaaagcg 8220

aaccaagaat cacggcactc agaatcacac caaacttcat acttataaga ctgttcaaaa 8280

ggatctccac actgcacaca agtttgtgcg ttgggagata cgtcgtcatt aatctcggca 8340

ccaaatttaa taggctcagg agcaaatggc atagggaacg ttgaaacgat acaccaacgt 8400

gaacaataat caacggcggt agcagaatag tagtgcatat aacaatattt acattgagaa 8460

tttctcggac caactttggc ttggtgattc cacatgctaa aacaataaga agaacaccaa 8520

tgatcaggag atgttccgtc acctacctta gtacgacacc aaacacattg tccttgcgga 8580

actagaacac gactaaaatc atcagtttca actggcacct caatagaagt acgatcttca 8640

tcttgaggcc agccgtgacg gcatggatca caaatgttgg cagcatcggg atctttacga 8700

acaaaagtat aattacaaac gaagcattta actaaagcgt ttacatcagt caaacccatc 8760

tggggtgttg cagcaatcat gtcacgggcg gcagagagtc gaacgggtgg agtgacatta 8820

acctcaattt gtgaggcacg tgcaggaagt tgcgaacgaa atcgttctcc agtttgtcga 8880

gaacgttcct gctctctatg ccaaacgtaa tcagcaaaag tacgcttaat agcacggaac 8940

gcgataacag gaaaacaaga cgagcaataa aatcgaactt catacgacgg cacgtcgagg 9000

ggagattgaa attcttctcc atcaacgcgt atacatatgc aattcttgcg acaattaaaa 9060

caagaatcac gagttttact agtgcgcgaa aacttagtcc acaagtgatg ctggatagcg 9120

caggcaaatt cagcttcact tatctcgacg tctttaagga catcaaggtt aacgatggta 9180

tagactggtg tgtcaagaaa gaaagttacg tttgtggttt ccatcatatt ttgagtgcgg 9240

gtacttcctg cgcgacgcag cgaactacga cgtcaacagt aggaacccaa gaaaagttca 9300

acgaacaaga aatcccactt aagggcgtcg acgggggtga aactgctcat attaaaatca 9360

ataggatcac actgtattct gtcctacggc tctgacttga cctagaatgt ctagtttagg 9420

cccgttttaa aaggccagtt catcgggttg acagccgaca tagtcacaat cagaatcttc 9480

gggatcccta gaggggagtt accggtccta cagaacataa gtgatcacca atcgcttaat 9540

ataggtttcc ttctggactt acctccagaa tggtggtgct gagcagactc agcgcgtaca 9600

aaacattaaa taagccaggt aagaaatggg tcagataaag ctaattgctt caaagaggtg 9660

ccaatatggg gcacggttaa gaagattagc aaaatctaat gccttcctag gcgaggggtc 9720

gagaacgacc atggctcatt ggatcatacg atcagtcttc tctctcgagg agagggggaa 9780

gggctcagag aaactcacag gggaatggtg agtgccgc 9818

<210> 2

<211> 717

<212> DNA

<213> Macrobrachium rosenbergii picornavirus-4 (Macrobrachium rosenbergii virus 4)

<400> 2

gcgagcggat aagttcttaa tagaattatg cgaaatggat ttcaggacca agacggataa 60

aagaaattga aaatttgtga acgaagcgtt aaaatgttta tattatgcga gactacttaa 120

tactaagcgc aaaacctatc actaggaaaa agcgcgaacg aaaattaaaa tgataggcat 180

acaacaataa caactataat aaacaacaaa tattcaaaca agaaaaatga attgttattg 240

agggcaggtt ttgagaaaac attgcaaaac gaaaattggg tactagcttg cttaaagtcg 300

tgcgacgact caacccagag aaaaagaatg acacgtactc aattacagca cgagtcgtag 360

gagacgaact tcctttgaag gtcgtaaatc tcgtttctca cggtgttgta attaaccgtg 420

agccacgagc ggggaacttt tgaaccaaac ttccacttga agtctctgag agcatcagga 480

ccgtgatgac aaatgaaacg ctgcactact tggaaacgca attgcaggtc actttcgtca 540

tcaatgaatt gtttaggacg gtatttgagc tccttgagaa tgtcaggcat gggcaaaggt 600

gcccaccaga cactatcacg gcaaacaaaa ggtgacttca agaaagtcat ctggtcaaaa 660

gtaaggtggt gttccatctc aacagcttta agagctgagg tgacttcata tccaagg 717

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccttggatat gaagtcacct cag 23

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcgagcggat aagttcttaa taga 24

<210> 5

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gatggaacac caccttac 18

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcaattacag cacgagtc 18

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gctgttgaga tggaacacca cctt 24

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gctccttgag aatgtcaggc atgg 24

Claims (10)

1. A target gene for detecting Macrobrachium malabaricum virus MrPV-4 is characterized in that the nucleotide sequence of the target gene is shown as SEQ ID NO. 2.

2. Use of the target gene of claim 1 in the manufacture of a product for detecting MrPV-4.

3. A kit for detecting Macrobrachium malabaricum virus MrPV-4, comprising a reagent for detecting the target gene of claim 1.

4. The kit according to claim 3, wherein the reagent contains a primer set for detecting the target gene according to claim 1.

5. A primer set for detecting the target gene of claim 1.

6. The primer group of claim 5, wherein the primer group is nested PCR primers, and the sequences of the primers are shown as SEQ ID NO. 3-6 in sequence.

7. The primer group of claim 5, wherein the primer group is a fluorescent quantitative PCR primer, and the sequence of the primer is shown as SEQ ID NO. 7-8 in sequence.

8. Use of the primer set of any one of claims 5 to 7 in the preparation of a product for detecting MrPV-4.

9. A nested PCR method for detecting MrPV-4 is characterized in that nested PCR primers shown in SEQ ID NO. 3-6 are used for carrying out PCR amplification on a sample to be detected, and if a specific band with the size of 717bp appears in the nested first round PCR or a specific band with the size of 340bp appears in the nested second round PCR, the nested PCR method is a positive result.

10. A fluorescent quantitative PCR method for detecting MrPV-4 is characterized in that a sample to be detected is amplified by using fluorescent quantitative PCR primers shown in SEQ ID No. 7-8, and if an amplification curve appears in a qPCR result and the corresponding Ct value is less than 37, the result is a positive result; if no amplification curve exists or the Ct value is more than or equal to 40, the result is negative; if the Ct value of the curve is between 37 and 40, the experiment is recommended to be repeated, if the Ct value of the repeated result is less than 40 and the amplification curve has obvious peaks, the result is positive, otherwise, the result is negative.

Images