CN114369607B - Target gene and primer for detecting macrobrachium rosenbergii virus MrPV-1 and application thereof - Google Patents
Target gene and primer for detecting macrobrachium rosenbergii virus MrPV-1 and application thereof Download PDFInfo
- Publication number
- CN114369607B CN114369607B CN202110657373.6A CN202110657373A CN114369607B CN 114369607 B CN114369607 B CN 114369607B CN 202110657373 A CN202110657373 A CN 202110657373A CN 114369607 B CN114369607 B CN 114369607B
- Authority
- CN
- China
- Prior art keywords
- mrpv
- primer
- virus
- macrobrachium rosenbergii
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Abstract
The invention discloses a target gene and a primer for detecting macrobrachium rosenbergii virus MrPV-1 and application thereof. Based on the target gene sequence, the invention designs and screens out nest and fluorescent quantitative PCR primers capable of amplifying the target gene, and establishes nest PCR and fluorescent quantitative PCR methods for detecting the macrobrachium rosenbergii picornavirus MrPV-1. The established nested PCR method has strong specificity, high sensitivity and good repeatability, and the minimum detection limit is 10copies/uL; the minimum detection limit of the established fluorescence quantitative PCR method is 10 2 The coefficients of variation of the copies/uL in the group and between groups are not more than 5%, the repeatability is good, the detection result is reliable, and the established two PCR methods are suitable for the RowDetection of the macrobrachium rosenbergii picornavirus MrPV-1.
Description
Technical Field
The invention belongs to the technical field of virus pathogen detection. More particularly relates to a target gene and a primer for detecting the macrobrachium rosenbergii virus MrPV-1 and application thereof.
Background
Macrobrachium rosenbergii (macrobrachium rosenbergii) is a large freshwater shrimp native to southeast Asia, and has the advantages of fast growth, wide feeding range, good meat quality nutrient components, short cultivation period and the like, and has developed rapidly since the 60 th 20 th century. In 1976, macrobrachium rosenbergii is introduced, and 10 or more provinces, cities, such as Guangdong, guangxi, hunan, hubei, jiangsu, shanghai, zhejiang and the like are cultivated at present, and the mu yield can reach 70-100 kg, so that the economic benefit is considerable. Diseases are important factors for limiting the development of the macrobrachium rosenbergii breeding industry, and currently, there are 5 viruses which are reported in China and infect macrobrachium rosenbergii, and white spot syndrome viruses (white spot syndrome virus, WSSV) which cause white spot syndrome are mainly included; nodavirus (MacrobrachiumRosenbergiiNodavirus, mrNV) causing muscle turbidimetry (white tail); extremely small viruses (extra small virus-like parts, XSV) that may be either MrNV satellite viruses or helper viruses; parvo-like viruses (HPV) capable of infecting macrobrachium rosenbergii hepatopancreatic epithelial cells; a bicistronic virus, macrobrachium rosenbergii Taihu virus (MacrobrachiumrosenbergiiTaihu virus, mrTV), causes Macrobrachium rosenbergii juvenile syndrome. The viruses have established corresponding detection methods at present, for example, chinese patent CN 103409555A discloses a detection kit and a detection method for the Macrobrachium rosenbergii nodavirus RT-LAMP-LFD.
Establishing the etiology is a serious issue in aquatic disease research, and with the deep research, more and more reports show that the etiology leading to the same kind of viral aquatic disease may be more than one virus. For example, the pathogens of the macrobrachium rosenbergii white tail disease are MrNV and XSV; the pathogens of blue crab "drowsiness" are blue crab reovirus (mud crab reovirus, mcRV) and blue crab bicistronic virus (mud crab dicistrovirus, mcDV). Recently, it has also been reported that the presence of a third pathogen, crab tomato dwarf virus-like virus (McTV), was observed in diseased blue crabs with cryo-electron microscopy. The pathogenic mechanism of the virus is complicated, the existing virus detection means are very difficult to detect the new virus, and the research of aquatic diseases has urgent demands on the rapid detection and identification of the new virus. Macrovirology can be used for analyzing biological information by enriching and sequencing viruses in the environment, preliminarily splicing genome sequences of the viruses, and preliminarily classifying the genome sequences into known virus families, and various researches show that new viruses which are difficult to discover by the traditional method can be obtained by the macrovirology method.
"iron shell" shrimp disease is a further serious problem in the cultivation of macrobrachium rosenbergii, and macrobrachium rosenbergii infected with the disease appears as yellowing of the body surface, slow growth or stop of growth, and simultaneously, the phenomenon that double chelating limbs turn blue and become long is also shown. The macrobrachium rosenbergii breeding industry in Jiangsu Gao mail city in 2010 is affected by the 'iron shell' shrimp disease of macrobrachium rosenbergii, resulting in serious yield reduction in a large area. The present inventors discovered a novel picornavirus by enriching for viruses in Macrobrachium rosenbergii that exhibit "iron capsids" and by metagenomic sequencing, which was temporarily designated (Macrobrachiumrosenbergiipicorna virus, mrPV-1). At present, no clear conclusion exists on the pathology, the infectious source, the transmission path, the infection mode and the like of the virus, no specific treatment method exists, and an accurate, sensitive and specific detection method is necessary to be established for the virus MrPV-1 in order to discover and treat the potential risks in time.
Disclosure of Invention
The invention aims to overcome the defects and the shortcomings of the prior art and provide a target gene, a primer and application thereof for detecting the macrobrachium rosenbergii virus MrPV-1.
The first object of the present invention is to provide a target gene for detecting macrobrachium rosenbergii virus MrPV-1.
The second object of the invention is to provide the application of the target gene in preparing products for detecting the macrobrachium rosenbergii virus MrPV-1.
A third object of the present invention is to provide a primer for detecting the MrPV-1 macrobrachium rosenbergii virus.
The fourth object of the invention is to provide an application of the primer in preparing a product for detecting the macrobrachium rosenbergii virus MrPV-1.
A fifth object of the present invention is to provide a recombinant plasmid.
The sixth object of the invention is to provide a kit for detecting the macrobrachium rosenbergii virus MrPV-1.
The above object of the present invention is achieved by the following technical solutions:
the invention discovers a novel small RNA virus, named Macrobrachiumrosenbergiipicorna virus (MrPV-1) temporarily, by enriching viruses in the bodies of more than ten giant freshwater shrimps infected with iron shell shrimp diseases and utilizing metagenome sequencing, and the genome sequence of the novel small RNA virus is shown as SEQ ID NO. 1. According to the genome sequence obtained by sequencing, the invention designs and develops a corresponding detection primer, a kit and a method of MrPV-1 by taking nucleotide sequences of 11688 th to 13171 th positions in the genome as target genes.
The invention firstly provides a target gene for detecting the macrobrachium rosenbergii virus MrPV-1, and the nucleotide sequence of the target gene is shown as SEQ ID NO. 2.
The primer designed on the basis of the target gene can detect whether the macrobrachium rosenbergii picornavirus MrPV-1 exists in a sample, so that the application of the invention protects the application of the target gene in preparing products for detecting the macrobrachium rosenbergii virus MrPV-1.
The invention also provides a primer for detecting the macrobrachium rosenbergii virus MrPV-1, which is used for amplifying a target gene shown in SEQ ID NO. 2.
Preferably, the primer for detecting the macrobrachium rosenbergii virus MrPV-1 is a nested PCR primer, and the primer sequences are shown in SEQ ID NO. 3-6, see example 1.
Preferably, the primer for detecting the macrobrachium rosenbergii virus MrPV-1 is a fluorescent quantitative PCR primer, and the primer sequences are shown in SEQ ID NO. 7-8, see example 3.
The invention also provides a recombinant plasmid which contains the target gene sequence shown as SEQ ID NO. 2.
Preferably, the recombinant plasmid is pMD-19T as a vector, see example 1.
The invention also provides a kit for detecting the macrobrachium rosenbergii virus MrPV-1, which comprises a reagent for detecting a target gene shown as SEQ ID NO. 2.
Preferably, the reagent is a primer for detecting the macrobrachium rosenbergii virus MrPV-1.
Preferably, the reagent is a nested PCR primer for detecting the macrobrachium rosenbergii virus MrPV-1, and the primer sequence is shown in SEQ ID NO. 3-6.
Preferably, the reagent is a fluorescent quantitative PCR primer for detecting the macrobrachium rosenbergii virus MrPV-1, and the primer sequence is shown in SEQ ID NO. 7-8.
Preferably, the kit further comprises the recombinant plasmid as a positive control.
In view of the fact that the primer can be used for detecting the target gene of the macrobrachium rosenbergii virus MrPV-1, the invention also applies for protecting the application of the primer in preparing products for detecting the macrobrachium rosenbergii virus MrPV-1.
The invention also applies for protecting the application of the recombinant plasmid in preparing a product for detecting the macrobrachium rosenbergii virus MrPV-1.
The invention also provides a nested PCR method for detecting the macrobrachium rosenbergii virus MrPV-1, which comprises the following steps:
s1, extracting RNA of a sample to be detected and reversely transcribing the RNA into cDNA;
s2, carrying out PCR amplification by using the cDNA obtained in the step S1 as a template and using the nested PCR primer;
s3, detecting a PCR result by gel electrophoresis, wherein if a specific band with the size of 1484bp appears in the first round or a specific band with the size of 928bp appears in the second round, the sample to be detected contains MrPV-1.
The invention also provides a fluorescent quantitative PCR method for detecting the macrobrachium rosenbergii virus MrPV-1, which comprises the following steps:
s1, extracting RNA of a sample to be detected and reversely transcribing the RNA into cDNA;
s2, taking the cDNA obtained in the step S1 as a template, carrying out fluorescence quantitative reaction by using the fluorescence quantitative PCR primer, and if an amplification curve appears and the Ct value corresponding to the curve is less than 37, taking the amplification curve as a positive result; if the amplification curve does not exist or the Ct value corresponding to the curve is more than or equal to 40, the result is regarded as a negative result; if the Ct value is between 37 and 40, the repeated experiment is recommended, if the Ct value of the repeated result is less than 40 and the amplification curve has obvious peak, the tested sample is judged to be positive, otherwise, the tested sample is judged to be negative.
Preferably, RNA is extracted, the crustacean tissue is removed in the case of shrimp larvae, and gill and muscle portions are removed in the case of shrimp larvae, see example 1.
Preferably, in reverse transcription to cDNA, 500 to 1000ng of RNA is added to 20. Mu.L of the reverse transcription system, see example 1.
More preferably, when reverse transcribed into cDNA, 500 to 800ng of RNA is added to 20. Mu.L of the reverse transcription system, see example 1.
Preferably, the annealing temperature of the first round primers of nested PCR is 53℃to 57℃as described in example 1.
More preferably, the annealing temperature of the first round primers of nested PCR is 57℃as described in example 1.
Preferably, the annealing temperature of the second round primers of nested PCR is 50℃to 60℃as described in example 1.
More preferably, the annealing temperature of the second round primers of nested PCR is 60℃as described in example 1.
Specifically, the reaction system of the first round of nested PCR reaction is as follows: 2X Accurate Taq Master Mix. Mu.L, forward and reverse primer concentrations of 5. Mu.M, 0.5. Mu.L each, 1. Mu.L of cDNA template, and sterilized water make up 20. Mu.L.
Specifically, the reaction procedure of the first round of nested PCR reaction is: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 57℃for 30s, elongation at 72℃for 1min40s,30 cycles; extending at 72deg.C for 10min, and preserving at 4deg.C.
Specifically, if the first round of nested PCR amplification does not detect a positive band, diluting an amplification product with sterile water for 50 times, and then taking the diluted amplification product as a template for carrying out the second round of PCR amplification, wherein a PCR reaction system is the same as that described above, and the reaction procedure is modified as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 30s, elongation at 72℃for 1min10s,30 cycles; extending at 72deg.C for 10min, and preserving at 4deg.C.
The invention has the following beneficial effects:
the invention firstly provides a target gene for detecting the macrobrachium rosenbergii virus MrPV-1, and a nested PCR method and a fluorescent quantitative PCR method for detecting the macrobrachium rosenbergii virus MrPV-1 are respectively established on the basis of the target gene. The method can be used for detecting the virus MrPV-1 in macrobrachium rosenbergii culture, can also be used for screening parent shrimps carrying the virus to cut off longitudinal transmission in time, or is used for eliminating the shrimp larvae carrying the virus in the initial period of the standard thickness of the shrimp larvae so as to reduce the loss caused by a large number of outbreaks in the standard thickness process, can also be used for detecting the MrPV-1 virus before the seedling throwing culture, eliminates the shrimp larvae carrying the MrPV-1 virus and reduces the loss in the culture process. The nested PCR and fluorescent quantitative PCR method established by the invention has high sensitivity, strong specificity and good repeatability, the minimum detection limit of the established nested PCR method is 10copies/uL, and the minimum detection limit of the fluorescent quantitative PCR method is 10 2 The detection result is accurate and reliable.
Drawings
FIG. 1 shows the amplification results of nested PCR primers, where N is a negative control.
FIG. 2 shows the amplification results of the primer MrPV-1-1-F/R at different annealing temperatures, wherein M is DS2000Marker, the annealing temperatures corresponding to lanes 1-6 are sequentially 50 ℃, 50.9 ℃, 53.3 ℃, 55.7 ℃, 56.8 ℃ and 59.9 ℃, and lane 7 is a negative control.
FIG. 3 shows the amplification results of the primer MrPV-1-2-F/R at different annealing temperatures, wherein M is DS2000Marker, the annealing temperatures corresponding to lanes 1-6 are sequentially 50 ℃, 50.9 ℃, 53.3 ℃, 55.7 ℃, 56.8 ℃ and 59.9 ℃, and lane 7 is a negative control.
FIG. 4 shows the result of sensitivity detection of primer MrPV-1-1-F/R, wherein M is DS2000Marker, and the concentration of positive plasmid corresponding to lanes 1-8 is 10 7 copies/uL～10 0 Copies/uL, lane 9 is a negative control.
FIG. 5 shows the result of sensitivity detection of primer MrPV-1-2-F/R, wherein M is DS2000Marker, lanes 1-8 correspond to a positive plasmid concentration of 10 7 copies/uL～10 0 Copies/uL, lane 9 is a negative control.
FIG. 6 shows the results of specific detection of the primers MrPV-1-1-F/R, with lanes 1-4 being the positive controls for MrFV, mrPV-1, mrDV-3, mcDV and McRV, lane 5 being the negative controls.
FIG. 7 shows the results of specific detection of the primers MrPV-1-2-F/R, with lanes 1-4 being the positive controls for MrFV, mrPV-1, mrDV-3, mcDV and McRV, lane 5 being the negative controls.
FIG. 8 shows the detection result of the primer MrPV-1-1-F/R on 10 samples of Macrobrachium rosenbergii in Huzhou, zhejiang province, wherein N is a negative control.
FIG. 9 shows the detection result of the primer MrPV-1-2-F/R on 10 samples of Macrobrachium rosenbergii in Huzhou, zhejiang province, wherein N is a negative control.
FIG. 10 is a standard curve of fluorescent quantitative PCR.
FIG. 11 shows amplification curves of fluorescent quantitative PCR primers, positive plasmid concentrations for A to H of 10 9 copies/uL～10 2 copies/uL。
FIG. 12 shows the result of a specific assay by fluorescent quantitative PCR, wherein A is MrFV positive sample, B is MrPV-1 positive sample, C is MrDV3 positive sample, D is McDV and McRV positive sample, E is positive control, and F is negative control.
FIG. 13 shows the detection results of fluorescent quantitative PCR primers on 10 samples of Macrobrachium rosenbergii in Huzhou, zhejiang province.
Detailed Description
The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.
Reagents and materials used in the following examples are commercially available unless otherwise specified.
Example 1 design and detection of nested PCR primers
1. Primer design
The invention discovers a novel small RNA virus, named Macrobrachiumrosenbergiipicorna virus (MrPV-1) temporarily, by enriching viruses in the bodies of more than ten giant freshwater shrimps infected with iron shell shrimp diseases and utilizing metagenome sequencing, and the genome sequence of the novel small RNA virus is shown as SEQ ID NO. 1. According to the genome sequence obtained by the detected metavirus, in the ORF region of the virus, nucleotide sequences of 11688-13171 positions in the genome are used as target genes, a Primer Premier 6 is used for designing nested PCR primers, the designed primers are tested by using a Primer select of Lasergene 7.1, PCR primers capable of amplifying single bands in an enriched virus template are screened, and the sequences of the screened nested PCR primers are shown as follows:
the primer sequences of the first round of nested PCR are shown below (SEQ ID NOS.3-4):
MrPV-1-1-F：TGTTGTGACGGATGGAGTAGT
MrPV-1-1-R：CTGCTTGGACCTGAGTTGATG
the length of the primer MrPV-1-1-F is 21bp, the primer is positioned at 11688-11709 th position of the MrPV-1 virus genome from 5', the primer MrPV-1-1-R is 21bp, the primer is positioned at 13151-13171 th position, and the product length is 1484bp.
The primer sequences of the second round of nested PCR are shown below (SEQ ID NOS.5-6):
MrPV-1-2-F：GATGTCTGCTGTCGCTTCTAC
MrPV-1-2-R：CATTCCTCCGTCCTCGTTGA
the length of the primer MrPV-1-2-F is 21bp, the primer is positioned at 11718-11739 of the MrPV-1 virus genome from 5', the length of the primer MrPV-1-2-R is 20bp, the primer is positioned at 12625-12645, and the product length is 928bp.
2. Extraction of MrPV-1 viral RNA
(1) Total RNA extraction from tissue
When the tissue sample is taken, the shrimp larvae are preferentially selected to take the crusta tissue, the prawns are preferentially selected to take gills and muscles, and the Trizol method is utilized to extract total RNA in the sample.
The method comprises the following steps:
taking 0.03g of tissue sample, adding 1mL of Trizol by using a homogenizer for repeated grinding, transferring to an RNase free centrifuge tube, uniformly mixing, and standing at room temperature for 5min; adding 200 μl of chloroform into each tube, mixing repeatedly, standing at room temperature for 10min, and centrifuging at 4deg.C and 1200rpm for 15min; shifting the upper water phase into a new RNase free centrifuge tube, adding isopropyl alcohol with equal volume, mixing, and standing at 4deg.C for more than 10 min; centrifuging at 4deg.C and 1200rpm for 10min, and discarding supernatant; adding 1mL of pre-cooled 75% ethanol into the precipitate, washing once, centrifuging at 1200rpm for 10min, carefully discarding the supernatant, and air-drying the precipitate; the RNA is dissolved by adding proper volume of DEPC treated water into the tube and is directly used for reverse transcription or frozen storage at-20 ℃ for standby.
(2) Reverse transcription of RNA into cDNA
Reverse transcription was performed using Evo M-MLV reverse transcription premix kit (cat No. AG 11728) from Ai Kerui, see the product instructions. To 20. Mu.L of the reverse transcription system, 500 to 1000ng of the extracted RNA (more preferably, 500 to 800ng of RNA) was added, and 5 XEvo M-MLV RT MASTER MIX 4uL was added and the mixture was made up to 20uL with water. After water bath at 37 ℃ for 15min, water bath at 85 ℃ for 5s inactivation, and the reverse transcription product is placed at-20 ℃ for freezing and storing for standby
3. Preparation of positive recombinant plasmid and negative control
The pMD-19T-MrPV-1 positive recombinant plasmid is obtained by the following preparation method:
PCR amplification is carried out by taking cDNA of MrPV-1 virus as a template and using nested PCR primer MrPV-1-1-F/R to obtain an amplification product. And (3) recovering and purifying the amplified product, cloning the amplified product into a pMD-19T vector, transferring the pMD-19T vector into DH5 alpha escherichia coli, selecting bacteria containing successfully constructed recombinant plasmids through screening and sequencing, and extracting the plasmids.
The negative control was pMD-19T empty vector plasmid.
4. Establishment of PCR amplification method
(1) PCR amplification system
The nested PCR detection was performed using cDNA synthesized by reverse transcription as a template, and the primers used for the first round of PCR amplification were MrPV-1-1-F/R, and the PCR enzyme used was 2X Accurate Taq premix (containing dye) from Ai Kerui (cat# AG 11019). The PCR reaction used a 20. Mu.L system: 2X Accurate Taq Master Mix. Mu.L, forward and reverse primer concentrations of 5. Mu.M, 0.5. Mu.L each, 1. Mu.L of cDNA template, and sterilized water make up 20. Mu.L.
(2) PCR reaction
After placing the PCR tube containing the reaction system in a TaKaRa PCR Thermal CPCR apparatus, the reaction was carried out under the following conditions. The PCR cycle for primer amplification is: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 55℃for 30s, elongation at 72℃for 1min40s,30 cycles; then extending at 72 ℃ for 10min, and finally preserving at 4 ℃.
The PCR amplified product is detected by agarose gel electrophoresis, and the size of the fragment to be amplified of the primer MrPV-1-1-F/R is 1484bp. If positive bands are not detected in the first PCR amplification, the product is diluted by 50 times by using sterilized water and used as a template for carrying out the second PCR amplification, and the primer used in the second PCR amplification is MrPV-1-2-F/R. The PCR reaction system is the same as above, and the amplification procedure is changed into: 95 ℃ for 5min;95℃30s,60℃30s,72℃1min10s,30 cycles; storing at 72deg.C for 10min and 4deg.C.
The results of two rounds of nested PCR amplification are shown in FIG. 1, the second round of electrophoresis has positive bands and the negative control has no bands, which shows that the primer group is positive to the detection of the MrPV-1 virus, and the nested PCR detection method of the MrPV-1 is successfully constructed.
5. Optimization of annealing temperature
To facilitate comparison of the effect of different annealing temperatures on the PCR amplification reaction, the concentration was 10 4 The positive recombinant plasmid of copies/uL is used as a template, primers MrPV-1-1-F/R and MrPV-1-2-F/R are respectively used for amplifying the positive plasmid at different annealing temperatures, and the PCR system and other reaction conditions are the same except for the different annealing temperatures, and each experiment is repeated for 3 times.
The amplification results of the primer MrPV-1-1-F/R at different annealing temperatures are shown in FIG. 2, wherein M is DS2000Marker, the annealing temperatures of lanes 1-6 are sequentially 50 ℃, 50.9 ℃, 53.3 ℃, 55.7 ℃, 56.8 ℃ and 59.9 ℃, and lane 7 is a negative control. As can be seen, lane 5 has the brightest band, so the optimum annealing temperature for the first round of amplification primer (one amplification) is set at 57 ℃.
The amplification results of the primer MrPV-1-2-F/R at different annealing temperatures are shown in FIG. 3, wherein M is DS2000Marker, the annealing temperatures of lanes 1-6 are sequentially 50 ℃, 50.9 ℃, 53.3 ℃, 55.7 ℃, 56.8 ℃ and 59.9 ℃, and lane 7 is a negative control. As can be seen, the second round amplification primers (second round amplification) were each well and stable at different annealing temperatures, and therefore the highest annealing temperature, 60℃was chosen as the optimum temperature.
6. Sensitivity detection of primers
To detect the sensitivity and reproducibility of the primers, mrPV-1-1-F/R and MrPV-1-2-F/R were used, respectively, for sensitivity detection of positive plasmids at different concentrations, each experiment was repeated 3 times. Sequentially decreasing positive standard plasmid by 10 times for 8 gradients with concentration of 10 respectively 7 copies/uL、10 6 copies/uL、10 5 copies/uL、10 4 copies/uL、10 3 copies/uL、10 2 The amplification reactions were performed according to the reaction system and conditions of section 5 of example 1, with copies/uL, 10copies/uL and 1 copies/uL.
The sensitivity test result of the primer MrPV-1-1-F/R is shown in FIG. 4, wherein M is DS2000Marker, and the concentration of positive plasmids in lanes 1-8 is 10 in sequence 7 copies/uL～10 0 Copies/uL, lane 9 is a negative control. As can be seen from the figure, the minimum detection limit of one expansion is 10 4 copies/uL。
The sensitivity test result of the primer MrPV-1-2-F/R is shown in FIG. 5, wherein M is DS2000Marker, and the concentration of positive plasmids in lanes 1-8 is 10 in sequence 7 copies/uL～10 0 Copies/uL, lane 9 is a negative control. As shown in the figure, the minimum detection limit of the double-amplification is 10copies/uL, and the PCR method for detecting the MrPV-1 virus established by using the nested PCR primer has extremely high sensitivity.
7. Specific detection of primers
In order to detect the specificity of the nested PCR primers, the invention extracts the RNA of the positive samples of Macrobrachiumrosenbergiiflavivirus (MrFV), mrPV-1, macrobrachiumrosenbergii dicistrovirus-3 (MrDV-3), mud crab reovirus (McRV) and Mud crab dicistrivirus (McDV) respectively, and obtains cDNA by reverse transcription, and the viruses are amplified by the first round and the second round of nested PCR primers respectively, and the McDV is a satellite virus of the McRV, so that in the actual detection process, the two viruses are in the same positive sample. The specific detection results of the nested first round primer MrPV-1-1-F/R and the second round primer MrPV-1-2-F/R are shown in FIG. 6 and FIG. 7, positive samples measured in lanes 1-4 are MrFV, mrPV-1, mrDV-3, mcDV and McRV respectively, lane 5 is a positive control, and lane 6 is a negative control. As shown in FIG. 6, the other virus samples except the positive control are not banded, and as shown in FIG. 7, the other virus samples except the MrPV-1 positive sample and the positive control are banded, and the result shows that the specificity of the nested PCR primer is good, and the MrPV-1 can be specifically detected.
EXAMPLE 2 nested PCR detection of Macrobrachium rosenbergii sample in Huzhou, zhejiang province
The invention uses the nest PCR primer to detect 10 macrobrachium rosenbergii samples in Huzhou of Zhejiang province, and the specific steps are described in example 1. As shown in FIG. 8, the amplification result of the first round primer MrPV-1-1-F/R shows that no specific band appears, and thus the second round PCR detection was performed by diluting the first round PCR product 50-fold as a template. After the second round of nested PCR primer MrPV-1-2-F/R amplification, the fourth sample is found to have a specific band, as shown in figure 9, and the nucleotide sequence of the fourth sample is verified to be the same as that of the product amplified by the second round of PCR primer by sequencing, which shows that the nested PCR detection method of the MrPV-1 virus established by the invention is suitable for practical detection.
Example 3 design and detection of fluorescent quantitative PCR primers
1. Primer design for fluorescent quantitative PCR
According to the genome sequence obtained by the detected metavirus, nucleotide sequences of 11688-13171 in the genome are used as target genes to design fluorescent quantitative PCR primers, the genome sequence is shown as SEQ ID NO.1, and the target gene sequence is shown as SEQ ID NO. 2. The Primer is designed by a Primer 6.0, and the Primer is strictly screened by a Primer select of Lasergene 7.1, so that 1 pair of proper fluorescent quantitative PCR primers MrPV-1-q-F/R is finally obtained, and the size of a fragment to be amplified is 220bp. The primer MrPV-1-q-F is 22bp long, from 5', it is located at 12845-12867 positions of MrPV-1 virus genome, the primer MrPV-1-q-R is 25bp long, it is located at 13040-13065 positions.
The sequence of the primer MrPV-1-q-F/R is shown in the following (SEQ ID NOS.7-8):
MrPV-1-q-F：AGCCGAGATCGCCGCCTTACTT
MrPV-1-q-R：ACCTCGCATAGTGGCAAGAGACAAC
2. establishment of fluorescent quantitative PCR method
RNA extraction and reverse transcription As in example 1, using the reverse transcribed cDNA as a template, ai Kerui CoGreen Pro Taq HS premixed qPCR kit II (AG 11702) carries out fluorescent quantitative PCR detection.
The reaction system is as follows: cDNA1uL, primers 0.2uL each, 2 XSYBR GREEN I MIX 5uL, ddH 2 O was made up to 10uL.
The reaction procedure is shown in table 1:
TABLE 1 fluorescent quantitative PCR reaction procedure
If the qPCR result shows an amplification curve and the Ct value corresponding to the curve is less than 37, the result is regarded as a positive result; if no amplification curve exists or Ct value is more than or equal to 40, the negative result is considered; if the Ct value is between 37 and 40, the repeated experiment is recommended, if the Ct value of the repeated result is less than 40 and the amplification curve has obvious peak, the tested sample is judged to be positive, otherwise, the tested sample is judged to be negative.
2. Fluorescent quantitative PCR standard curve
Sequentially diluting the positive control recombinant plasmid by 10 times of decremental, and selecting 1 copies/uL-10 7 Fluorescence quantitative PCR amplification was performed on a total of 8 dilution gradients of copies/uL, and an amplification curve was drawn, as shown in FIG. 10, in which the logarithmic value of the copy number of the positive control recombinant plasmid was taken as the X axis and the Ct value was taken as the Y axis, and the standard curve equation obtained was y= -3.373x+36.545. Through measuring bookThe correlation coefficient (r 2) =0.9994 and the amplification efficiency (E) =97.9% of the method indicate that the primer of the method is well designed and the reaction system is normal.
Diluting positive recombinant plasmid by 10 times, and selecting 10 2 copies/uL～10 9 The qPCR amplification was performed at 8 dilutions of copies/uL, and the fluorescent quantitative PCR amplification curves of the positive recombinant plasmids at different concentrations are shown in FIG. 11, which shows that S-type amplification curves appear except for the negative control S-free amplification curve, wherein the concentration of A is 10 9 The copies/uL, B is 10 8 COPIES/uL, C is 10 7 COPies/uL, D is 10 6 The copies/uL E is 10 5 The copies/uL F is 10 4 The copies/uL G is 10 3 The copies/uL has H of 10 2 The results of the copies/uL show that the fluorescence quantitative PCR method has wide applicable concentration range and reliable detection result.
3. Sensitivity detection of fluorescent quantitative PCR primers
Respectively diluting the positive recombinant plasmid standard to 10 0 copies/uL～10 3 The copies/uL is amplified by qPCR primer for 4 dilutions, each dilution is repeated for 20 times, the reaction system and the procedure are the same, and the minimum dilution with the variation coefficient less than 5% and the positive detection rate more than 95% is selected as the lowest detection limit. As shown in Table 2, the results of the sensitivity test of MrPV-1 show that when the positive plasmid concentration is more than 10 2 When the peptides/ul is carried out, the variation coefficient is less than 5%, the positive detection rate is more than 95%, and the minimum detection limit is 10 2 copies/ul。
TABLE 2 sensitivity detection of primers
4. Repetitive detection of fluorescent quantitative PCR primers
Subjecting the positive control recombinant plasmid toDiluting with 10 times of decreasing dilution, selecting 10 3 copies/uL～10 7 qPCR amplification was performed on a total of 5 dilution gradients of copies/uL, repeated 5 times, and the intra-batch coefficient of variation was calculated from the Ct values. And carrying out batch-to-batch repeatability tests at 3 different time points, calculating the variation coefficient between batches according to the Ct value, and evaluating the stability of the established method by using the variation coefficient between batches and the variation coefficient between batches, wherein the reaction system and the procedure for detecting the repeatability of the primer are the same. The repeatability detection results of the fluorescent quantitative PCR primers are shown in Table 3, and the results show that the intra-group variation coefficient is 0.43% -4.03%, the inter-group variation coefficient is 0.62% -3.99%, and the intra-group variation coefficient and the inter-group variation coefficient are both below 5%, so that the repeatability and the reproducibility of the method are good, and the results are stable and reliable.
TABLE 3 fluorescence quantitative PCR intra-and inter-group repeat coefficient of variation
5. Specific detection of fluorescent quantitative PCR primers
In order to detect the specificity of the set fluorescent quantitative PCR primers, the invention extracts the RNAs of Macrobrachiumrosenbergiiflavivirus (MrFV), mrPV-1, macrobrachiumrosenbergii dicistrovirus-3 (MrDV-3), mud crab reovirus (McRV) and Mud crab dicistrivirus (McDV) positive samples respectively, and obtains the cDNA by reverse transcription, and uses the fluorescent quantitative PCR primers MrPV-1-q-F/R to amplify the cDNA of the viruses, wherein the McDV is a satellite virus of the McRV, so that in the actual detection process, the two viruses are in the same positive sample. The specific detection results are shown in FIG. 12, wherein A is an MrFV positive sample, B is an MrPV-1 positive sample, C is an MrDV3 positive sample, D is an McDV and McRV positive sample, E is a positive control, and F is a negative control. As shown in the figure, only the positive sample and the positive control of the MrPV-1 show an S-type amplification curve, which shows that the specificity of the set fluorescent quantitative PCR primer is good, and the MrPV-1 can be detected specifically.
Example 4 actual detection of fluorescent quantitative PCR
The invention uses fluorescent quantitative PCR to sample and detect 10 macrobrachium rosenbergii samples in Huzhou of Zhejiang province, the template is the same as that of example 2, and the specific steps are as shown in example 3.
The detection result of the fluorescent quantitative PCR primer MrPV-1-q-F/R is shown in FIG. 13, and other samples have no Ct value and amplification curve except Lane4 which has a Ct value and amplification curve. The Ct values of 10 macrobrachium rosenbergii samples are shown in Table 4, and the Ct value of Lane4 is 26.88, which is converted into 733copies/uL, and is 10 4 The range between the first amplification minimum detection limit and the second amplification minimum detection limit is 10copies/ul, and the nested PCR result is matched.
TABLE 4 fluorescent quantitative PCR primer MrPV-1-q-F/R amplification of Ct values of 10 Macrobrachium rosenbergii samples
The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.
Sequence listing
<120> a target gene for detecting MrPV-1 of macrobrachium rosenbergii virus, primer and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 14462
<212> DNA
<213> Macrobrachium rosenbergii picornavirus-1 (Macrobrachium rosenbergii picorna virus 1)
<400> 1
cccccccccc cccccccccc cacacccccc cccccccccc cccccccccc caagaaacct 60
tcttttttgg aggtcactct tgagaaactc ccagaaaaac ctgtccccca ggtccctatc 120
tgcaggaaga agcgtgcagc cccaccacct aagaggttgc cccctccccg ccctgcagtc 180
accttggatt gggcaaggac tcctgctaaa ggagctccta tctataccaa caaagggaaa 240
atcattcctg tagaggaatt gacaaagaag gaagttgatt tttgggatgt agaactagaa 300
ctctaccaac cagtcccagt gcctgtgatt gataacatca tacttgaaaa agtagaatgc 360
tattcagccc cagcacgtaa gagtgcccca cccaagaagg agaagaaaga agtaggtaag 420
aaagtcacct atgctacctt ctgcaagcct atcaagaagg ctaagaaagt tgtacaaact 480
aagcagaaga agaaatctaa gattcgtgaa aacctgatca agactgctcc taagtggagc 540
ttgacagcag caaggcgcag acagcgaaaa tctcgctgct ttgtttcccc taaaggcttc 600
gatgaggagc ctgaagaaga acaacctgca ccagagcctg ttgatgcccc caactgtctc 660
tcagaaagag agctcaaagc tatctcaaga gctccaaaac ctaagatcgt tgaacccgtt 720
gtctttgaca acgtatttga cgatttgagg gacgaagcta ctgactttgt cgagaagaac 780
agttggatgt atgagcatgt tcaacgcagc ccaccaccta cccgcagagg gtttgtgcac 840
cactcaaaac tcaagactaa gaaagatctt gagcgcattg ctgctcaacc tccccccaag 900
gagaagaaga agcgcaggca caaccgtcct gcaaacttga tgactttctc acgaaagaag 960
cccactgcag tagagtccac aaccattgcc tatgacgctc ttcttcaaga gattcagaaa 1020
tcccatgaag agacattaac ttcagaagcc agccgattgc acaaattggg agtaaactca 1080
gaagaatatg ctcattatgt tgctgatttt ctagaacttt ggcttgagca aaatcctctt 1140
cagattaaga aggatgatga ctactacaat ttttacgaca aatttgtttt tgacgcaatg 1200
tacaaattca gtgaagcatc agtagatatg tttgatcaat tatcagatgt aattactaga 1260
gctattggta ttcatgacgc tgctcttaca gtagcgttgt gttgcaattt ggcctctatt 1320
gttgctgcat ttagattgtt cactcaagta aaaggaaaac ttgacgttgc tgtagctatt 1380
ggaagtatag tttccaatgt cttatcaatg gcatgtgttt tcatttcatc tagagtactt 1440
accagaacag tcaccgaagc tttgcgtgac ggtctgggaa gagtgaaaac aatgtttatt 1500
gaaatgcagt caggaattgt agatttcgtt cgtcaacttt atgacaatcc aaaggaaact 1560
cagctctctg ttcttgaaca tcaagcagtt attgaaagag ttacacatgc taccactatt 1620
caagaatcta ttgatggact tgttactgat ttaggcaaat ctttgcctga taggatcaac 1680
gcatgcaagg attatgtgca agcattgaaa cctctttgca cagagaaaga cggagatgcc 1740
tattctttga aaggatggtc cccaactaag aaggcttact atggagatca ttggtttttg 1800
ccttgggaag ttgataaaaa cagcccgaat atgaagatca attttgacaa tacctacact 1860
gtcatcccaa tccctaaaga aggggttcac agtgactcta tccgttgtta tttagcactt 1920
ttgtgcgaag tccccctcca ggagatttat atttataagt ctgagaatgg aggtttccct 1980
aagactgatc gagttatttc agatgagatt gttacagcat ccgaaattga tgcagtcaaa 2040
tttttaaaca ttcgtgctgc agttaatgat aaagcaaaag attcagttga agtcaatagg 2100
aaacaacagc aagttatgtt gcaagcctct aaggataggt tgactaaatt atttaatgtt 2160
ttgaaatcta acaaccaatc tttagaacct ttgaagaact tgatgtacga tcttggtctt 2220
gaagaagaaa ccatgaaaca atttatcgac tctcaagttg aagacgcact ggaaatgaac 2280
ttagtaggtg atggtgacga tacatctgtt accataccta ttgagaagtt tatagtcgat 2340
tttatgattt cctccaacac agccgatttt attgacagtc ttagagatgg aattcagcaa 2400
tgtaactctt ttggttctgc caaggaatgt gcggacatcg catgcaaagc tggactaagt 2460
ttggatgtgg ttattaaact atttaaagta tctttagatg cttgcaacga ccagacttac 2520
aatactgttg ccgacaattt ccagtgttgt acagtaactg atttggaagg ttttatttgt 2580
gctttgatag actattataa agcacagaat attttgctta ccacaccaaa tggtacatat 2640
ggttatctcg aaaagcaacc cagcgaacct gttagaatca tatctgtttc aacacaggga 2700
actgttgatg ttctgaaccc tgctcctaag gcttggaaag actataagat caaacccttc 2760
cccgacacta agaatgatat tctatctata ttcccgaagg ataatcattt ttgcgctgat 2820
tgctttttgc acccgcgcaa agataagatt gaacctcaag acttaataag cgtcggtgcg 2880
cttgcgatgg ctgatgccgt taggatactt gaaattgatc ctgctttgtg tccagattct 2940
attgatatca catttagatg ggcaggctat ggtgtcgttc aacctgacgc caacggaaaa 3000
gtttttgaac cagcctgtag acgaaaatct gttgtacttc ttaatggaga gatatttgtt 3060
ttccctgaat ttgttagaag aaaagacaga gaaggatact atcttactaa agaagttttc 3120
ggaagtcctg ttataaagaa agatcacttt gtgaaaacta acactctggg aggccttcaa 3180
ggtctctgga atgatgaagc aggaaatgtc agttatccta tcgtgatgag taggattctt 3240
ccccaattgt tgatgaatca agaaaagaag caggaatggc aaggacaagt tataccaact 3300
aaatttacgg caggaggccg tagttatgat gttattttcc atgacgataa gactgatcat 3360
gacgctcaga acaatggtaa actctataac aaccatttct ggggatgttc taaatgtgct 3420
tggcaaggcg gcgtcaaacc tgtcgctaga gtcaaggaca atgaatctaa tgacaacctc 3480
acaaaatcaa tgtcggttgt taaactagtt gcttgcacat tgtgtgttgt tatgtctata 3540
gttttaacgc acaatgacgc taaggcacgc cccatagatt actttaaaaa tattctatgt 3600
ggtgttgctt taggcggagc agctatgtct ggttttgaac ttttcggcca tttgttccac 3660
aaagctacag aaccccagga tgaggaagaa attgcattag aacttcgcaa gaatttgtta 3720
gcatataatg gaataccagt agaaactatg gctagagctc cttcagtttt aagagcctct 3780
attaagaaag ctgatgaagt ggttagattc ttagccactc ataagcaaaa aactggtata 3840
aatgtaagtc ttaatcatct tctccagaga ttaacagaaa aacatatttc gattttgcaa 3900
tctggagctt acgaagcttt gcgtccatct acatatatta tgttaatcac gagcgcacct 3960
ggtcttggta aaaaccatgc ttttactgaa aggcatggtt ttggaagttc tcatgttggt 4020
tgcggaatta gaaagttaaa ggacatctgc ggtcaaactg ctagaacgaa gtggttaaaa 4080
cttgacgcca atggatattt caatgaaatg aatggtgagc agattaccat ctacgacgag 4140
tgggctatga gaactgaaga acccatgatg tatatgatca accaagttgg aaacaacact 4200
cctgccacat tcagtggagc atcagttgaa gcaaaacatc agttgtttat gagtgatttt 4260
ctgattctcc tttcaaacaa ggagactcta ccacagaacc ctcgtataaa caatgaagca 4320
atggctgcta ttgacagtag aataaatcat tatagggttt ctgatgcagc tactgaaact 4380
tggttagcaa ctcacaatcg tcatgaactg agaccaagca ctttacccac cgatatttca 4440
gcgatgaagt gggaaaagag aattggaaat aattgggttg ccaccacttg gaatgagatg 4500
tggtatgaag ctgctgtaca ttattacaac caaaggcagc agattaaccc cctctcaatc 4560
caacgtacac aacaacatct gttgggtggt tatgaagaag atcatgtcgc tcaccctagg 4620
caacttgccg aactttggaa tatggtaaaa atacccgata ttccacttgc aaaagaagct 4680
ggaaaattca cttggtcttt agctagtaaa gattatgaca tttgggaaaa agttagagaa 4740
ggcactaaag ccccaggcag ggacgacaac ctctacgtgc atttgcatgg gcattccgga 4800
aaaggaaaaa ctacttggat gaaggaggtg attgacgact ggtctacttt aactaagagt 4860
gaatcagctt gtttctatat ttcttgtgaa gaagaatatc ataacttcat gaaatatcag 4920
aggcacacag tgagagcagg agacattatc gttactgatg acgttttctg ggaaccttac 4980
tgcaatgtaa acgacatggt cggttcactc cgtggaatag ttgtttgtca tctctctaat 5040
tcttgtggaa agtattttaa gactaagagc cctggatggc tatctctaaa cagtcttaga 5100
tttatttgga acaacttgag aactgtttgg aagactactc aacaagaagg agtcacacgc 5160
ccagctagat atttccacag cactcttcgt aacatcagag aaggagaatt gaggagaagt 5220
ggtttgtacg gcaatttgtt cgttctgcag gatagagtaa gaacagcagt tccaggagac 5280
aataattggt tagaagtctc tccagatcct ttctacacct ttgagatgga acttactact 5340
gaaaacaaat ggtatgttcc cactgaacag cagttctatt ctcctggatc cattaaagaa 5400
agattcctgc agaaagttct ggattggcgt aactcttcta ctccaaccac aattgttaac 5460
accagccagc ctgttcctaa tgattttgaa gttgagattg ttgctaaaaa cctagaagag 5520
ctaaagaaat tgttaaaaga gcctgatgac atgttgaaag aactttgtac agaaaaagga 5580
aaaggatgta tctgggtaaa cgagcggctg ttttacaagt ttgcaaaaat accttctctc 5640
cgaggctctg cttggcaact tcctagtacc ttaaaagaag aagatcttga taaagtagtt 5700
ttgaacatgt tccagacgtt caagagaatg gctccagatt ctaaagtctt tgtaaagatt 5760
ggtgacgtta aatactggaa tagagataaa gtcatcttct ctacgaaagg tggaattaga 5820
tataaacttc acactataat tgatcttgag aaggaacccg gaaaggtccg aattgattta 5880
attgagacag aaaagcagtt agaagttaaa tctatcttct gcaataaaat gatgttgatc 5940
cgagttcttg aagatggaat ttatggagtt gaagataata tcaagatgaa gattggtgac 6000
atcaagctac ttatgacagt taaagaccag atattcgacc atgtcaatat gatcggagca 6060
gtaactgagt ggcgtcaaat ttgtcttaga aacaaggaac aagccagaaa agtctcaaag 6120
cttcagaaac taaaggaatg gattgaaggc gacacaacaa cagctctgtg tttcaagatc 6180
tttatgactt tgtgtttatt agagatcacg atcataggcg tccgctcttt tttcaactgg 6240
tactcaggtg accccgtaat tagctgtatt ttctgtaaag gttcatactc tatcacgaaa 6300
gagaatgcca aatatgtcac aaatgataga ttcgaatatt gtcttttatg taataagtgg 6360
aggctaagaa cccagccccc cacttacaac gagtgtgtag cttttcagat gtttgaagag 6420
ggtagggact accgtgtaat cgacccctgt aattatccaa gtgttagata catggaagca 6480
ctacgagacc ctttccctcc tgaaatccat cagaatcttc acgggtatga acaccagttg 6540
aaagagatgc agtctgatgt taatgatttg cattcgagag gccaggcaaa gaaacttcta 6600
gaccaacatc ggggaggagg atatgcccaa gctagacagt acattgagcg aggagctcac 6660
ttacgaccac cagaatggtc tgccaattta ttctcacacg agtcagggcc acctcaaggc 6720
acaaatagtt ccaccgccgg atttggctat tctgacccat atcagtttcc tccgcaagac 6780
ccagttcaaa aagctgttag agactttgcg aagggagcca agtttgattt agactctcat 6840
gtgaacaagt taattggcag agaactccaa agtggaagtg gtaagtttgt agatatctcc 6900
catctgcaga agaaagtaga agatgctgtt gtcactcttt ctggaggctg tgagttgcaa 6960
gggctaagga ttaaaggaaa atatgtgttg tttccattcc atttggttac acatgctaac 7020
atccaaaatt tggcaatcac cactaaagtc aatggaaaga cttatcaagt gacggacgtc 7080
catcggattg gagattgtga cgcagcaatt ggagtaatta atggaaaaga cgtagaattt 7140
gcggaagata taacacacat tttcttccca gaatccgaat taaacaacgt aaaatctgtt 7200
ggtatgtttg tatgtaagaa agaaaacgga acggttaata gagtcccaga aactttacac 7260
tcatggcaca ccaacgacca aaagggtttc ccattggaaa tccaaatccc ggtagtgggt 7320
ggtaaagtac agaccactag aggagattgt ggttctcctt attacgctat cgttgaagaa 7380
gcgcatcacg aatatttgcg gtttgttgca attcacgctg ctaaagtgag cgaacgggct 7440
tatgaaggag cagtgattac acatgagcgt attcgtgaga cgcttgacgc gatggaggga 7500
cttgagacgg cggtttcaaa catgctgaaa ccaacggttg ttgacctagg aaacaagaaa 7560
tacaatacag tagtttatgt caagaacgaa attgaaagtc tcgcatcaaa caggaaacca 7620
actttccgat acaagagtcc tcttgaattt ctcatgaaaa tagaacattt tgagtatcca 7680
caagataaat caaagagggc gccttggttt gatgagttgg cagcagagtt cgactgcccc 7740
gttcttgaag tggatgaatc tgctcctgtt ttaccaccgc aagtattagc tgtattgccc 7800
agaaacaacc atggaaagcc tgataagatt cagaatcaaa taaaccagat tcttgagaat 7860
ccaaaacatc tcaatttatc tagagatgaa tatgatgaga tgaacgcagt tttcaaggat 7920
caggtttatt tgatcaggag atcttatctt taccagtggg atgtgcaatc accagttgcg 7980
agcatgaacg cagttaaaca tcagactttc acttccaagc cgattgcagt gaacaaatca 8040
gcaggattct atggtcatct aagaaaactg ccgatgaaga accaactaat agacgtgggg 8100
cctactggaa accgcaggtt tgtgaaaggg aacgagggtg ttcttctact gaactacgtg 8160
cgaagatgtg ctgatttggt aagaagagga gactcttttc taaccgtctt ccactatatg 8220
gcaaagagag aagctttacc agccgataag gctttagctg gaaaagtaag aatgttcagc 8280
gcagctagtg tggagcttac aatcgtcgaa aggatgtttt ttatgccttt aattgcattg 8340
atttcagccg tcgacgggcc attccgcact ggttatgatg agctagtgtc tctcggtaga 8400
aagcacgcat ctctcgtgga aggatttcca aatgtggcct cattcgattt ttcgaggttt 8460
gataagtggg ccactaaagc tgaggtttat tttgctgtcc gactgctctg ctggatgaat 8520
cttctatggt gtgaaggtga tggacttatg gctgatacta tcgcagctgc tttcacaaag 8580
atctactgtg atagcccgat tctatgcaag ggcgatttgt ttagagctaa tggtactctt 8640
ccaagtggca tattacttac taatgtaatt ggctctgcta tcgtccacat gcgaactctc 8700
agggcttata aatatctgta tgaaatgaga cttggactca aagatcaata catgttccat 8760
atttatccat tagcttgcgg agatgatctg accgtatact gtactgacga agggttagta 8820
cctttggatc agttagttga aaagatgcaa gaaaatggat gcaagttgac aacgacatct 8880
aaagaagccg tcgccactga tattattgaa tgggctccat ccagtgaagg aacctcattt 8940
attagtagga ctgtctggtg gaatgacgag cagaggtgtt atttttcacc tttgaagatc 9000
agttccatag tgaaatgttt gtggtatgcg catagtttag catacgaatc accagcagac 9060
ctgcttttaa tggttattac tgaagccaga gcaataagga gatcacttga ttacaacgtg 9120
gtgatgaaga tggttaatat cattggcaga catccgctat taaagaacca tcagcagttg 9180
tcaaaattat gtgtgaaaca tgttactgct caccgacttc atgctctcta catcaaaaca 9240
ggtcagaacc ccatgagtag agaattggag ctgccttctc ccgcagcagg gaaaactgaa 9300
ttaataccct ctgacgagcc atacgtagga acgaagttca ctatcaaccc cgaaggagga 9360
tataaatttg aatataagat gctccagtac aatacctcag tcaaaaggaa ggtgcaggaa 9420
tggtgccaga agaatcctgg aaaggtgact atcaatcagg aacctaccaa gaggacagtt 9480
gtgctagcag atggtacaac taggtatatc tggctataca attacgtctg gaaggtgcaa 9540
ggcacttctc tacccaggca tacattcaag gacctggaac aagactgctg gaatgaactc 9600
tggaacgaca ttagaaaatg gtataaagtg gttgaaaaga aagatgcatt tgaccaaatg 9660
ctggacgact cagatgagaa aggatttgac ctagttcacc accgagataa tgacccagtt 9720
gttggcatca agcaaggcag aatttggact atcttcgtaa aacttgaaga tggatggcat 9780
acttcaacag ttaccggcaa gtacaatagc aaggatatgt atgatcaagc tcatacttgg 9840
cgcagagcca atccttctcc agccaatcac cactacagta tactcagaga aggagacatt 9900
ctgatgtccc atgacattga cactctccga gagtggtatg actggcataa cgtagttcaa 9960
tatgaccacg agatggagag aggggattct atgcctcctc agacgactgg cccagacgtt 10020
ggccagcccg cgattccagc cggtagctct tgccccccat tagaggcttt catcctaaag 10080
cctaaaggtc atgggcaagt gcatattgat gtttcacagc agactgattt tctcacagaa 10140
cttgccgcca tgcagacagc agtttacata ggaacacaat ccattccagg taacgtagca 10200
aacggagatg ttctcttcac ttgtggagga gatgacatca tgaaacatga gtggtttgct 10260
cagaaatatg ttacccacag taaatttgga ggtcattact atgtaatact gaagattgca 10320
ggtgcttcaa acctttgtgg tacagtttca ttcacggcta aaaatacaaa agactctgct 10380
ctcgagaagt atcagaatca gtcaattata aacattcagg acatgcttgc acaaggaatt 10440
gcaggctcca ctattgtttt gcaatgtaat ctctctaaca atagtgtgga gaaaggactg 10500
actaagctga tgtgggtagc caaagatgca actgcaacca agttcgaagt tactccaact 10560
caatgggaaa tgaaagccgt gagcggttgg ggcagtgcat tcatctctga acttactgcc 10620
tcaacagcta tgactgtgtc cacttttgtg gctcttggtc atattgaccc ggtaaaaggt 10680
tacgaactca caatggaact tggtggttgg agtccagcgg caattgaagt tgtcactgga 10740
ggtggtgaca aaggaagcat agttggtaag accattggag agctagatcc caactcgtct 10800
gtgtatgtct ggtcaacaaa gactactcca acaaataggt ttgattccat tgctgatatg 10860
gccgctaaag gacaatataa cccagatagt caattcaatg atgctttgag aggcaagtgg 10920
gttactggcg taacacctag aacatcctgg tggagaagcg ctttgttgca cgatggctca 10980
ggacagtatt tcacagttgt gagggctata tatccataca atcatccttg tgtaatggct 11040
ggaagacagc cagacaaaga atatgatgct tctcttttgg ctccagtcgc agtctacggt 11100
tcttactact gtcctaagac ttatttacga tttccatata ttaaggacac tgtgcgactg 11160
acttcaccta ccgactttgg acaactcaca gactatcttg cgaaagacgc tccagagatg 11220
attttctcat acatgagagg aaaaatggta gcttctgtga agaaagctaa agttgaagag 11280
aagaatatca ctgatgaaat cactagggtg aatgtggaca taatgagaag ttttaagtgg 11340
ggtccattca accaggcaaa gaacatggat tgttggtctt ggtcactaga aggctcatct 11400
cttgttgaca aatcaatggc aactgttctt ccaaacgtag actcagtagc tggtacagtt 11460
gtagatgagg ctagcccaga tcgcactgcc tcccaattag cagaatctac tactcacaga 11520
gacacgcgtg taggatctaa acaagcagga agtactttgt caggaacagc agaagtaatg 11580
ctagatacct cagatgttct agttgtcgaa gagatttttc ttttagatat cattgatgct 11640
ggtgcttttg acatgaaagc tgtaagtatt ggatcttcct tcccagttgt tgtgacggat 11700
ggagtagtta acgctaagat gtctgctgtc gcttctacaa attttatgca gaaagttgaa 11760
gagcaattac aagataatta taattaccgt ctcacactaa aacatccagt gttggcaaac 11820
aagatttttg aggtgtatct gcatgctcat ttgacaggag gacacacttg gcttactcaa 11880
gctactaacg agtatatgat ggcgacaaac tttgaccaat ggataatagc tgaaataaaa 11940
gaggtgcgag gaactgaagt gtttgttctt actgatactt ctaattggac ctctttcaag 12000
ttggcaaaca ttgagaaagt taaggaaaga gttcgaacaa taaggtatat tcagagagct 12060
cctatcacag cacctgtttc taacccaaga aaccaaggaa ggaaagtaca aggagtaaga 12120
actcttcaat cgggcgacaa tgagtacatg gccttcatct accacgctgc aagtagccaa 12180
gttaaaaatt caatcaactt ggtttccatg tgcatgtggc aagaccataa ggaattgtgc 12240
aagaatgtag aatggaagaa acgccatact ctccacatga ctctcgctct acttaaatca 12300
aacacagttt cagcaggagt gctcaggaaa gatctggacg accattttga ttttgatgac 12360
caatcatctt ttgctctcaa gatgaagaat ggtgctccag ttgtttcctg gttaggaagg 12420
actttggttg cagaaatcga tgaatctttc cctatggaag agaagtttaa gaagatcacc 12480
aaggaactgg cagagaaatg cactatttcc aaacctattg caactctccc agccaagcca 12540
catgtctcaa tagcttttct tcgagatgct ccgcaggaag tgagagataa gatcgcagca 12600
cagtatgtga cagaatggaa gagactcaac gaggacggag gaatgaagca catatcgcac 12660
tgttgttggt atgaagtcaa gtctatctgg acaaaagaag aaagagctgc tcaaaagcaa 12720
gtgtcaaaga ggacatataa gaatgtggaa acacagactc caatcactga caagcagaaa 12780
gcagctgcag caagagagaa gatcttctcc cagaagaata acatcgtaga accaaaggag 12840
caacaagccg agatcgccgc cttacttgga ggcagtgctc tgcaaggact tgggcaagga 12900
ctgggagcat gggcagcttc agctatgcac tttcgacagg ctaaatggat ggctaacttc 12960
caagcgcaaa catcgaaaga attactgttt cagaaatttc gccaagcaag cgccctgcaa 13020
aatcagctgt ttgaccagaa gttgtctctt gccactatgc gaggtgcaga aagagtggct 13080
actaacccaa caagacctcc tcttgaagga ccaaagacag cttccatcgg cactcaaccg 13140
atgtctcatg catcaactca ggtccaagca gctacactgt tgcaccgcga tttcaataca 13200
gagccgacga ctgccgacaa cggttcgcac attattgtgc cttttacaag agctatccag 13260
attggcagct acaaaacagg aaatgatgtt ggacttgaca ctgacgcact tatacagtcg 13320
cgtctaccac gagcagttgg cactaacgtc aatctacttg atctgtctcc acccacgaaa 13380
cacactcaga cggatgatat tagcaataat aagctactta atccttcatt tgcccccaag 13440
acagtcgaga gcgctagcgg accggagtct gtactaccag cgactagcga aaatagtaat 13500
cagacaacac ctgaaccaca tcctagcact tccggagcct caacgtctgc tgttcatcct 13560
gcagaaactc aggcttctgg agaggtcagt aaaggatcta acacaggtag tcagagtaca 13620
gaatctactt cctgggctga ggaggttgag cgaaaccctg aaccgccagc accctcaatg 13680
aaaactgcaa gtagccaggc ttcaaagcct acatatgcgt ctgtggctgg agcacctaga 13740
gtaaagagac aagctcctcc tcctcctgtg catacagaaa gcgaaccagc accctcatca 13800
cagcatggtg gtccaccagc taaccactcc atcttctaaa tttactaggc cagaaagagc 13860
ctggaatttt ggcaggtgcc tcactgagaa tttttgtttt tttttttata tcagtgagct 13920
ggcctaacta attaatgcag taacaataag aacaagatga cctagtactg cattagcacc 13980
tactaattcc aacaacactt tttgtattta ttgttgtggc tcaacttaga attaagcgca 14040
tatttaaaaa tacaaaaaaa aatataagtt tttcataatt tgaacttcta gggaaacttc 14100
ttattattta tcattattcg tttcccgtaa ttcgaaatta tacccttaga aaattaccaa 14160
aattaatgca gtaacaataa gaaaaagatg acctagtact gcattagaac ctactaattc 14220
caacaacact ttttgtattt attgttgtgg ctcaacttag aattaagcgc atatttaaaa 14280
atacaaaaaa aaatataagt ttttcataat ttgaacttct agggaaactt cttattattt 14340
atcattattc gtttcccgta attcgaaatt atacccttag aaaattacca aaattaatgc 14400
agtaacaata agaaaaagat gacctagtac tgcattagaa cctactaatt ccaacaacac 14460
tt 14462
<210> 2
<211> 1484
<212> DNA
<213> Macrobrachium rosenbergii picornavirus-1 (Macrobrachium rosenbergii picorna virus 1)
<400> 2
tgttgtgacg gatggagtag ttaacgctaa gatgtctgct gtcgcttcta caaattttat 60
gcagaaagtt gaagagcaat tacaagataa ttataattac cgtctcacac taaaacatcc 120
agtgttggca aacaagattt ttgaggtgta tctgcatgct catttgacag gaggacacac 180
ttggcttact caagctacta acgagtatat gatggcgaca aactttgacc aatggataat 240
agctgaaata aaagaggtgc gaggaactga agtgtttgtt cttactgata cttctaattg 300
gacctctttc aagttggcaa acattgagaa agttaaggaa agagttcgaa caataaggta 360
tattcagaga gctcctatca cagcacctgt ttctaaccca agaaaccaag gaaggaaagt 420
acaaggagta agaactcttc aatcgggcga caatgagtac atggccttca tctaccacgc 480
tgcaagtagc caagttaaaa attcaatcaa cttggtttcc atgtgcatgt ggcaagacca 540
taaggaattg tgcaagaatg tagaatggaa gaaacgccat actctccaca tgactctcgc 600
tctacttaaa tcaaacacag tttcagcagg agtgctcagg aaagatctgg acgaccattt 660
tgattttgat gaccaatcat cttttgctct caagatgaag aatggtgctc cagttgtttc 720
ctggttagga aggactttgg ttgcagaaat cgatgaatct ttccctatgg aagagaagtt 780
taagaagatc accaaggaac tggcagagaa atgcactatt tccaaaccta ttgcaactct 840
cccagccaag ccacatgtct caatagcttt tcttcgagat gctccgcagg aagtgagaga 900
taagatcgca gcacagtatg tgacagaatg gaagagactc aacgaggacg gaggaatgaa 960
gcacatatcg cactgttgtt ggtatgaagt caagtctatc tggacaaaag aagaaagagc 1020
tgctcaaaag caagtgtcaa agaggacata taagaatgtg gaaacacaga ctccaatcac 1080
tgacaagcag aaagcagctg cagcaagaga gaagatcttc tcccagaaga ataacatcgt 1140
agaaccaaag gagcaacaag ccgagatcgc cgccttactt ggaggcagtg ctctgcaagg 1200
acttgggcaa ggactgggag catgggcagc ttcagctatg cactttcgac aggctaaatg 1260
gatggctaac ttccaagcgc aaacatcgaa agaattactg tttcagaaat ttcgccaagc 1320
aagcgccctg caaaatcagc tgtttgacca gaagttgtct cttgccacta tgcgaggtgc 1380
agaaagagtg gctactaacc caacaagacc tcctcttgaa ggaccaaaga cagcttccat 1440
cggcactcaa ccgatgtctc atgcatcaac tcaggtccaa gcag 1484
<210> 3
<211> 21
<212> DNA
<213> Macrobrachium rosenbergii picornavirus-1 (Macrobrachium rosenbergii picorna virus 1)
<400> 3
tgttgtgacg gatggagtag t 21
<210> 4
<211> 21
<212> DNA
<213> Macrobrachium rosenbergii picornavirus-1 (Macrobrachium rosenbergii picorna virus 1)
<400> 4
ctgcttggac ctgagttgat g 21
<210> 5
<211> 21
<212> DNA
<213> Macrobrachium rosenbergii picornavirus-1 (Macrobrachium rosenbergii picorna virus 1)
<400> 5
gatgtctgct gtcgcttcta c 21
<210> 6
<211> 20
<212> DNA
<213> Macrobrachium rosenbergii picornavirus-1 (Macrobrachium rosenbergii picorna virus 1)
<400> 6
cattcctccg tcctcgttga 20
<210> 7
<211> 22
<212> DNA
<213> Macrobrachium rosenbergii picornavirus-1 (Macrobrachium rosenbergii picorna virus 1)
<400> 7
agccgagatc gccgccttac tt 22
<210> 8
<211> 25
<212> DNA
<213> Macrobrachium rosenbergii picornavirus-1 (Macrobrachium rosenbergii picorna virus 1)
<400> 8
acctcgcata gtggcaagag acaac 25
Claims (5)
1. A primer for detecting macrobrachium rosenbergii virus MrPV-1, which is characterized in that the primer is used for amplifying a gene shown in SEQ ID NO. 2; the primer is a nested PCR primer, and the sequence of the nested PCR primer is shown as SEQ ID NO. 3-6; wherein the genome sequence of the macrobrachium rosenbergii virus MrPV-1 is shown as SEQ ID NO. 1.
2. A primer for detecting macrobrachium rosenbergii virus MrPV-1, which is characterized in that the primer is used for amplifying a gene shown in SEQ ID NO. 2; the primer is a fluorescent quantitative PCR primer, and the sequence of the fluorescent quantitative PCR primer is shown as SEQ ID NO. 7-8; wherein the genome sequence of the macrobrachium rosenbergii virus MrPV-1 is shown as SEQ ID NO. 1.
3. Use of the primer according to claim 1 or 2 for preparing a product for detecting macrobrachium rosenbergii virus MrPV-1.
4. A kit for detecting macrobrachium rosenbergii virus MrPV-1, comprising a reagent for detecting a target gene represented by SEQ ID No.2, said reagent comprising the primer of claim 1 or 2.
5. The kit according to claim 4, further comprising a recombinant plasmid comprising the target gene sequence shown in SEQ ID NO. 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110657373.6A CN114369607B (en) | 2021-06-11 | 2021-06-11 | Target gene and primer for detecting macrobrachium rosenbergii virus MrPV-1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110657373.6A CN114369607B (en) | 2021-06-11 | 2021-06-11 | Target gene and primer for detecting macrobrachium rosenbergii virus MrPV-1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114369607A CN114369607A (en) | 2022-04-19 |
| CN114369607B true CN114369607B (en) | 2023-10-03 |
Family
ID=81138336
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110657373.6A Active CN114369607B (en) | 2021-06-11 | 2021-06-11 | Target gene and primer for detecting macrobrachium rosenbergii virus MrPV-1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114369607B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1451764A (en) * | 2003-05-19 | 2003-10-29 | 中国科学院武汉病毒研究所 | Method for compound rverse transcription polymerase chain reaction detection of Ro's pond shrimp viral |
| CN101875980A (en) * | 2010-07-16 | 2010-11-03 | 中国水产科学研究院黄海水产研究所 | Kit and method for detecting Macrobrachium rosenbergii Nodavirus |
| CN103122393A (en) * | 2012-11-30 | 2013-05-29 | 杭州三合创新科技有限公司 | Macrobrachium rosenbergii nodavirus detection kit and detection method |
| CN104946797A (en) * | 2015-06-12 | 2015-09-30 | 广西壮族自治区水产科学研究院 | Primer and kit for one-step fluorescent quantitative RT-PCR detection method of Nodamura virus of macrobrachium rosenbergii |
| WO2017187440A1 (en) * | 2016-04-26 | 2017-11-02 | Viaqua Therapeutics Ltd. | Compositions and methods for treating viral infections in shrimps |
| WO2018056803A1 (en) * | 2016-09-21 | 2018-03-29 | Universiti Malaya | Rapid detection of prawn viruses, method and kit thereof |
| CN109988870A (en) * | 2019-05-05 | 2019-07-09 | 湛江出入境检验检疫局检验检疫技术中心 | Shrimp steals the triple fluorescent PCR detection kit and its application of dead nodavirus, haemocyte irido virus, Nodavirus |
-
2021
- 2021-06-11 CN CN202110657373.6A patent/CN114369607B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1451764A (en) * | 2003-05-19 | 2003-10-29 | 中国科学院武汉病毒研究所 | Method for compound rverse transcription polymerase chain reaction detection of Ro's pond shrimp viral |
| CN101875980A (en) * | 2010-07-16 | 2010-11-03 | 中国水产科学研究院黄海水产研究所 | Kit and method for detecting Macrobrachium rosenbergii Nodavirus |
| CN103122393A (en) * | 2012-11-30 | 2013-05-29 | 杭州三合创新科技有限公司 | Macrobrachium rosenbergii nodavirus detection kit and detection method |
| CN104946797A (en) * | 2015-06-12 | 2015-09-30 | 广西壮族自治区水产科学研究院 | Primer and kit for one-step fluorescent quantitative RT-PCR detection method of Nodamura virus of macrobrachium rosenbergii |
| WO2017187440A1 (en) * | 2016-04-26 | 2017-11-02 | Viaqua Therapeutics Ltd. | Compositions and methods for treating viral infections in shrimps |
| WO2018056803A1 (en) * | 2016-09-21 | 2018-03-29 | Universiti Malaya | Rapid detection of prawn viruses, method and kit thereof |
| CN109988870A (en) * | 2019-05-05 | 2019-07-09 | 湛江出入境检验检疫局检验检疫技术中心 | Shrimp steals the triple fluorescent PCR detection kit and its application of dead nodavirus, haemocyte irido virus, Nodavirus |
Non-Patent Citations (5)
| Title |
|---|
| NaveenKumar S 等.Genetic analysis of RNA1 and RNA2 of Macrobrachium rosenbergii nodavirus (MrNV) isolated from India.《Virus Research》.2013,第173卷(第2期),第377-385页. * |
| Sudhakaran R 等.Experimental vertical transmission of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV) from brooders to progeny in Macrobrachium rosenbergii and Artemia.《J Fish Dis》.2007,第30卷(第1期),第27-35页. * |
| Wu Z 等.Virome analysis for identification of novel mammalian viruses in bat species from Chinese provinces.《J Virol》.2012,第86卷(第20期),第10999-11012页. * |
| 林锋 等.罗氏沼虾野田村病毒3种检测方法比较.《江苏农业科学》.2014,第42卷(第10期),第214-216页. * |
| 黄光华 等.罗氏沼虾野田村病毒实时荧光定量RT-PCR检测方法的建立.《南方农业学报》.2016,第46卷(第11期),2059-2063. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114369607A (en) | 2022-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN113502352B (en) | EMA-ddPCR primer and probe for detecting infectious ASFV and application | |
| CN111218530B (en) | Primer group and kit for detecting octopoda iridovirus 1 by fluorescence quantitative PCR | |
| CN110894556A (en) | PCR primer, probe, kit and detection method for detecting African swine fever virus infectivity | |
| CN110777221A (en) | Locked nucleic acid probe fluorescent quantitative PCR detection composition, detection method and detection kit for African swine fever virus | |
| CN112094944B (en) | Kit for quantitatively detecting novel coronavirus copy number | |
| CN111321248B (en) | African swine fever virus MGF-505R gene fluorescence PCR detection reagent, kit and application thereof | |
| CN115044710B (en) | Primer group and kit for detecting pangolin beta coronavirus and application of primer group and kit | |
| CN113789413B (en) | Primer pair, probe, kit and method for simultaneously detecting five lily viruses | |
| CN111041128B (en) | Primer probe set, kit and detection method for detecting duck astrovirus type 3 based on real-time fluorescent quantitative PCR | |
| CN114369607B (en) | Target gene and primer for detecting macrobrachium rosenbergii virus MrPV-1 and application thereof | |
| CN107254556A (en) | Method, RPA IAC primers and kit based on RPA IAC technology examination bean mosaic virus 4s | |
| CN117025846A (en) | Primer group for detecting novel coronavirus by multiple ddPCR and application thereof | |
| CN111621596A (en) | Porcine circovirus type 3 real-time fluorescent quantitative PCR detection primer probe set, kit and method | |
| CN107523627B (en) | LAMP kit for detecting acute hepatopancreas necrosis pathogen | |
| CN112941240B (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| CN114807444A (en) | Primer, kit and method for detecting African swine fever virus | |
| CN111961757A (en) | Double-gene probe method real-time fluorescence quantitative PCR kit for detecting duck tembusu virus and application | |
| CN114196786A (en) | Poultry adenovirus type 4 and 8 dual fluorescent quantitative PCR rapid detection kit and method | |
| CN114369608B (en) | White-foot shrimp picornavirus gene and application thereof | |
| CN113430274A (en) | RPA primer, probe, kit and method for detecting liver enterocytozoon | |
| CN112695137A (en) | PMA-qPCR detection method of porcine pseudorabies virus | |
| CN114369682B (en) | Method for detecting freshwater long-arm shrimp picornavirus | |
| CN114369681B (en) | Product and method for detecting bicistronic virus-3 | |
| CN111961758B (en) | N-DMV and N-DHCLV dual real-time fluorescent quantitative PCR identification and detection primer and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |