CN114369607A

CN114369607A - Target gene and primer for detecting Macrobrachium rosenbergii virus MrPV-1 and application thereof

Info

Publication number: CN114369607A
Application number: CN202110657373.6A
Authority: CN
Inventors: 何建国; 缪琪瑾; 翁少萍; 周丹丹
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2021-06-11
Filing date: 2021-06-11
Publication date: 2022-04-19
Anticipated expiration: 2041-06-11
Also published as: CN114369607B

Abstract

The invention discloses a target gene and a primer for detecting macrobrachium rosenbergii virus MrPV-1 and application thereof. The invention designs and screens nested and fluorescent quantitative PCR primers capable of amplifying target genes on the basis of the target gene sequence, and establishes nested PCR and fluorescent quantitative PCR methods for detecting the Macrobrachium rosenbergii small RNA virus MrPV-1. Is establishedThe nested PCR method has strong specificity, high sensitivity and good repeatability, and the minimum detection limit is 10 copies/uL; the lowest detection limit of the established fluorescent quantitative PCR method is 10²The coefficient of variation between copies/uL and groups is not more than 5%, the repeatability is good, the detection result is reliable, and the two established PCR methods are both suitable for detecting the Macrobrachium rosenbergii small RNA virus MrPV-1.

Description

Target gene and primer for detecting Macrobrachium rosenbergii virus MrPV-1 and application thereof

Technical Field

The invention belongs to the technical field of virus pathogen detection. More particularly relates to a target gene for detecting Macrobrachium rosenbergii virus MrPV-1, a primer and application thereof.

Background

Macrobrachium rosenbergii (Macrobrachium rosenbergii) is a large freshwater shrimp originally produced in southeast Asia, has the advantages of fast growth, wide feeding range, good meat quality and nutrient content, short culture period and the like, and develops rapidly since the 20 th century 60 years of artificial culture. The macrobrachium rosenbergii is introduced in 1976 in China, and is cultured in more than 10 provinces, cities and autonomous regions such as Guangdong, Guangxi, Hunan, Hubei, Jiangsu, Shanghai, Zhejiang and the like at present, the yield per mu can reach 70-100 kg, and the economic benefit is considerable. The disease is an important factor for limiting the development of macrobrachium rosenbergii breeding industry, and the number of viruses infecting macrobrachium rosenbergii reported in China at present is mainly 5, namely White Spot Syndrome Virus (WSSV); nodavirus (macrobrachium rosenbergii nodavirus, MrNV), which causes muscle whitish disease (caucasia alba); very small viruses (XSV) which may be MrNV satellite viruses or helper viruses; parvovirus-like virus (HPV) capable of infecting the epithelial cells of the hepatopancreas of macrobrachium rosenbergii; a bicistronic virus that causes juvenile syndrome of macrobrachium rosenbergii-macrobrachium rosenbergii taihu virus (MrTV). Corresponding detection methods are established for the viruses at present, and for example, Chinese patent CN 103409555A discloses a kit for detecting macrobrachium rosenbergii nodavirus RT-LAMP-LFD and a detection method thereof.

It is important to establish that pathogens are important in the research of aquatic diseases, and with the progress of the research, more and more reports show that pathogens causing the same viral aquatic disease may be more than one virus. For example, the pathogeny of the white tail disease of the macrobrachium rosenbergii is MrNV and XSV; as another example, the pathogens of the green crab 'lethargy' are two types of green crab reovirus (McRV) and green crab bicistronic virus (McDV). Recently, it has also been reported that the presence of a third pathogen, crab tomato dwarf virus-like virus (McTV), was observed in diseased blue crabs using cryoelectron microscopy. The pathogenic mechanism of the virus is complicated, the existing virus detection means is very difficult to detect the new virus, and the research on aquatic diseases has urgent need for the rapid detection and identification of the new virus. Macrovirology can initially splice the genome sequence of viruses by enriching and sequencing the viruses in the environment and analyzing biological information, and initially classify the viruses into various known virus families, and a plurality of researches show that new viruses which are difficult to find by the traditional method can be obtained by the macrovirology method.

The 'iron shell' shrimp disease is another important problem in the culture of the macrobrachium rosenbergii, and the macrobrachium rosenbergii infected with the disease shows that the body surface is yellow, grows slowly or stops growing, and simultaneously shows the phenomenon that double-chela turns blue, and becomes long, so that the performance is premature. The macrobrachium rosenbergii breeding industry in Jiangsu Gaoyou city in 2010 is affected by the iron shell shrimp disease of macrobrachium rosenbergii, so that large-area serious yield reduction is caused. The inventor discovers a novel small RNA virus by enriching the virus in macrobrachium rosenbergii bodies which show 'iron shells' and sequencing the virus through metagenome, and tentatively names the virus (Macrobrachium rosenbergii virons 1, MrPV-1). At present, no definite conclusion is made on the pathology, the infection source, the transmission path, the infection mode and the like of the virus, no targeted treatment method is available, and in order to discover and carry out targeted treatment on potential risks, an accurate, sensitive and specific detection method needs to be established for the virus MrPV-1.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a target gene and a primer for detecting the Macrobrachium rosenbergii virus MrPV-1 and application thereof.

The first purpose of the invention is to provide a target gene for detecting the Macrobrachium rosenbergii virus MrPV-1.

The second purpose of the invention is to provide the application of the target gene in preparing a product for detecting the macrobrachium rosenbergii virus MrPV-1.

The third purpose of the invention is to provide a primer for detecting the Macrobrachium rosenbergii virus MrPV-1.

The fourth purpose of the invention is to provide the application of the primer in the preparation of products for detecting the Macrobrachium rosenbergii virus MrPV-1.

The fifth object of the present invention is to provide a recombinant plasmid.

The sixth purpose of the invention is to provide a kit for detecting the macrobrachium rosenbergii virus MrPV-1.

The above object of the present invention is achieved by the following technical solutions:

the invention discovers a new small RNA virus by enriching the virus in the Macrobrachium rosenbergii body infected with the shrimp disease of the iron shell through metagenome sequencing, which is tentatively named as Macrobrachium rosenbergii marginalis virus 1(MrPV-1), and the genome sequence of the virus is shown as SEQ ID NO. 1. According to the invention, according to a genome sequence obtained by sequencing, a nucleotide sequence of 11688 th to 13171 th sites in a genome is taken as a target gene, and a corresponding detection primer, a kit and a method of MrPV-1 are designed and developed.

The invention firstly provides a target gene for detecting Macrobrachium rosenbergii virus MrPV-1, and the nucleotide sequence of the target gene is shown as SEQ ID NO. 2.

The primers designed on the basis of the target gene can detect whether the macrobrachium rosenbergii small RNA virus MrPV-1 exists in a sample, so that the application of the target gene in preparing a product for detecting the macrobrachium rosenbergii virus MrPV-1 is protected.

The invention also provides a primer for detecting the Macrobrachium rosenbergii virus MrPV-1, wherein the primer is used for amplifying the target gene shown in SEQ ID NO. 2.

Preferably, the primer for detecting the Macrobrachium rosenbergii virus MrPV-1 is a nested PCR primer, and the sequence of the primer is shown as SEQ ID NO. 3-6 in example 1.

Preferably, the primer for detecting the Macrobrachium rosenbergii virus MrPV-1 is a fluorescent quantitative PCR primer, and the sequence of the primer is shown as SEQ ID NO. 7-8 in example 3.

The invention also provides a recombinant plasmid, which contains a target gene sequence shown in SEQ ID NO. 2.

Preferably, the vector of the recombinant plasmid is pMD-19T, see example 1.

The invention also provides a kit for detecting the macrobrachium rosenbergii virus MrPV-1, which comprises a reagent for detecting the target gene shown in SEQ ID NO. 2.

Preferably, the reagent is a primer for detecting the macrobrachium rosenbergii virus MrPV-1.

Preferably, the reagent is a nested PCR primer for detecting the Macrobrachium rosenbergii virus MrPV-1, and the sequence of the primer is shown as SEQ ID NO. 3-6.

Preferably, the reagent is a fluorescent quantitative PCR primer for detecting the Macrobrachium rosenbergii virus MrPV-1, and the primer sequence is shown as SEQ ID NO. 7-8.

Preferably, the kit further comprises the recombinant plasmid as a positive control.

In view of the fact that the primer can be used for detecting the target gene of the Macrobrachium rosenbergii virus MrPV-1, the invention also applies to protect the application of the primer in preparing products for detecting the Macrobrachium rosenbergii virus MrPV-1.

The invention also applies to protect the application of the recombinant plasmid in the preparation of products for detecting the Macrobrachium rosenbergii virus MrPV-1.

The invention also provides a nested PCR method for detecting the Macrobrachium rosenbergii virus MrPV-1, which comprises the following steps:

s1, extracting RNA of a sample to be detected and carrying out reverse transcription to obtain cDNA;

s2, performing PCR amplification by using the nested PCR primer by using the cDNA obtained in the step S1 as a template;

s3, detecting a PCR result through gel electrophoresis, wherein if a specific band with the size of 1484bp appears in the first round or a specific band with the size of 928bp appears in the second round, the result indicates that the detected sample contains MrPV-1.

The invention also provides a fluorescent quantitative PCR method for detecting the Macrobrachium rosenbergii virus MrPV-1, which comprises the following steps:

s2, taking the cDNA obtained in the step S1 as a template, and carrying out fluorescent quantitative reaction by using the fluorescent quantitative PCR primer, wherein if an amplification curve appears and the Ct value corresponding to the curve is less than 37, the result is regarded as a positive result; if no amplification curve exists or the Ct value corresponding to the curve is more than or equal to 40, the result is regarded as negative; if the Ct value is between 37 and 40, the experiment is recommended to be repeated, if the Ct value of the repeated result is less than 40 and the amplification curve has obvious peaks, the tested sample is judged to be positive, and if not, the tested sample is judged to be negative.

Preferably, the RNA is extracted from the crustacean tissue in the case of shrimp larvae and the gill and muscle portions in the case of shrimp larvae, as described in example 1.

Preferably, when reverse transcription is performed to form cDNA, 500-1000 ng of RNA is added to 20. mu.L of the reverse transcription system, as described in example 1.

More preferably, when reverse transcription is performed to form cDNA, 500-800 ng of RNA is added to 20. mu.L of the reverse transcription system, as described in example 1.

Preferably, the annealing temperature of the primers in the first round of nested PCR is 53 ℃ to 57 ℃, see example 1.

More preferably, the annealing temperature of the primers in the first round of nested PCR is 57 ℃ as shown in example 1.

Preferably, the annealing temperature of the primers in the second round of nested PCR is 50 ℃ to 60 ℃, see example 1.

More preferably, the annealing temperature of the primers in the second round of nested PCR is 60 ℃ as shown in example 1.

Specifically, the reaction system of the first round of nested PCR reaction is as follows: 2 × Accurate Taq Master Mix 10 μ L, forward and reverse primer concentrations 5 μ M, 0.5 μ L each, 1 μ L of cDNA template, sterile water make up to 20 μ L.

Specifically, the reaction procedure of the first round of nested PCR reaction is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 1min for 40s, 30 cycles; further extension at 72 deg.C for 10min, and final storage at 4 deg.C.

Specifically, if no positive band is detected in the first round of nested PCR amplification, diluting the amplification product by 50 times with sterilized water, and then using the diluted amplification product as a template to perform the second round of PCR amplification, wherein the PCR reaction system is the same as the above, and the reaction procedure is modified as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min for 10s, 30 cycles; extending for 10min at 72 ℃, and storing at 4 ℃.

The invention has the following beneficial effects:

the invention firstly provides a target gene for detecting the Macrobrachium rosenbergii virus MrPV-1, and establishes a nested PCR method and a fluorescent quantitative PCR method for detecting the Macrobrachium rosenbergii virus MrPV-1 on the basis of the target gene. The method can be used for detecting the virus MrPV-1 in the culture of the macrobrachium rosenbergii, can also be used for screening the breeding shrimps, timely eliminates parent shrimps carrying the virus to cut off longitudinal propagation, or is used for eliminating the shrimp seedlings carrying the virus at the initial stage of shrimp seedling marking to reduce the loss caused by a large amount of outbreaks in the marking process, and can also be used for detecting the MrPV-1 virus before seedling throwing culture, eliminates the shrimp seedlings carrying the MrPV-1 virus and reduces the loss in the culture process. The nested PCR and fluorescent quantitative PCR method established by the invention has high sensitivity, strong specificity and good repeatability, the minimum detection limit of the established nested PCR method is 10copies/uL, and the minimum detection limit of the fluorescent quantitative PCR method is 10²The copies/uL and the detection result are accurate and reliable.

Drawings

FIG. 1 shows the amplification results of nested PCR primers, in which N is a negative control.

FIG. 2 shows the results of amplification of primers MrPV-1-1-F/R at different annealing temperatures, which are repeated three times, wherein M is DS2000Marker, the annealing temperatures in lanes 1-6 are 50 deg.C, 50.9 deg.C, 53.3 deg.C, 55.7 deg.C, 56.8 deg.C and 59.9 deg.C, and lane 7 is negative control.

FIG. 3 shows the results of amplification of primers MrPV-1-2-F/R at different annealing temperatures, which are repeated three times, wherein M is DS2000Marker, the annealing temperatures in lanes 1-6 are 50 deg.C, 50.9 deg.C, 53.3 deg.C, 55.7 deg.C, 56.8 deg.C and 59.9 deg.C, respectively, and lane 7 is a negative control.

FIG. 4 shows the results of sensitivity detection of primers MrPV-1-1-F/R, which are repeated three times, wherein M is DS2000Marker, and the concentration of positive plasmids corresponding to lanes 1-8 is 10⁷copies/uL～10⁰copies/uL, lane 9 is a negative control.

FIG. 5 shows the sensitivity detection node of the primer MrPV-1-2-F/RThree replicates of fruit, where M is DS2000Marker, and the concentration of positive plasmid in lanes 1-8 is 10⁷copies/uL～10⁰copies/uL, lane 9 is a negative control.

FIG. 6 shows the result of the specific detection of the primers MrPV-1-1-F/R, wherein the positive samples in lanes 1-4 are MrFV, MrPV-1, MrDV-3, McDV and McRV, respectively, lane 5 is a positive control, and lane 6 is a negative control.

FIG. 7 shows the result of the specific detection of the primers MrPV-1-2-F/R, wherein the positive samples in lanes 1-4 are MrFV, MrPV-1, MrDV-3, McDV and McRV, respectively, lane 5 is a positive control, and lane 6 is a negative control.

FIG. 8 shows the result of detecting 10 Macrobrachium rosenbergii samples from Huzhou city, Zhejiang by the primer MrPV-1-1-F/R, wherein N is a negative control.

FIG. 9 shows the result of detecting 10 Macrobrachium rosenbergii samples from Huzhou city, Zhejiang by the primer MrPV-1-2-F/R, wherein N is a negative control.

FIG. 10 is a standard curve of fluorescent quantitative PCR.

FIG. 11 shows the amplification curve of the fluorescent quantitative PCR primers, with positive plasmid concentrations of 10 for A-H⁹copies/uL～10²copies/uL。

FIG. 12 shows the result of specific detection by fluorescent quantitative PCR, in which A is an MrFV positive sample, B is an MrPV-1 positive sample, C is an MrDV3 positive sample, D is an McDV and McRV positive sample, E is a positive control, and F is a negative control.

FIG. 13 shows the results of the fluorescent quantitative PCR primers on 10 Macrobrachium rosenbergii samples in Huzhou, Zhejiang province.

Detailed Description

The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.

Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

Example 1 design and detection of nested PCR primers

1. Primer design

The invention discovers a new small RNA virus by enriching the virus in the Macrobrachium rosenbergii body infected with the shrimp disease of the iron shell through metagenome sequencing, which is tentatively named as Macrobrachium rosenbergii marginalis virus 1(MrPV-1), and the genome sequence of the virus is shown as SEQ ID NO. 1. According to the genome sequence obtained by the detected macrovirus, in the ORF region of the virus, the nucleotide sequences of 11688 to 13171 bits in the genome are taken as target genes, Primer Premier 6 is used for designing nested PCR primers, the designed primers are tested by Primer select of Lasergene 7.1, PCR primers capable of amplifying a single strip in an enriched virus template are screened, and the sequence of the screened nested PCR primers is shown as follows:

the primer sequences of the first round of nested PCR are shown as follows (SEQ ID NO. 3-4):

MrPV-1-1-F：TGTTGTGACGGATGGAGTAGT

MrPV-1-1-R：CTGCTTGGACCTGAGTTGATG

the length of the primer MrPV-1-1-F is 21bp, the primer MrPV-1-F is located at positions 11688 to 11709 of the MrPV-1 virus genome from 5', the length of the primer MrPV-1-1-R is 21bp, the primer MrPV-1-R is located at positions 13151 to 13171, and the length of a product is 1484 bp.

The primer sequences of the second round of nested PCR are shown as follows (SEQ ID NO. 5-6):

MrPV-1-2-F：GATGTCTGCTGTCGCTTCTAC

MrPV-1-2-R：CATTCCTCCGTCCTCGTTGA

the length of the primer MrPV-1-2-F is 21bp, the primer MrPV-1-2-F is located at the 11718 th to 11739 th positions of the MrPV-1 virus genome from 5', the length of the primer MrPV-1-2-R is 20bp, the primer MrPV-1-2-R is located at the 12625 th to 12645 th positions, and the length of the product is 928 bp.

2. Extraction of MrPV-1 Virus RNA

(1) Tissue total RNA extraction

When taking a tissue sample, the shrimp fry is preferably taken from the carapace tissue, the prawn is preferably taken from the gill and the muscle, and the total RNA in the sample is extracted by using a Trizol method.

The method comprises the following steps:

taking 0.03g of tissue sample, adding 1mL of Trizol by using a homogenizer for repeated grinding, then transferring the tissue sample to an RNase free centrifuge tube, uniformly mixing, and standing for 5min at room temperature; adding 200 μ L chloroform into each tube, mixing, standing at room temperature for 10min, centrifuging at 4 deg.C and 1200rpm for 15 min; transferring the upper aqueous phase into a new RNase free centrifuge tube, adding isopropanol with the same volume, reversing, mixing uniformly, and standing at 4 ℃ for more than 10 min; centrifuging at 4 deg.C and 1200rpm for 10min, and removing supernatant; adding 1mL of precooled 75% ethanol into the precipitate, washing once, centrifuging at 1200rpm for 10min, carefully removing supernatant, and air-drying the precipitate; DEPC treatment water with a proper volume is added into the tube to dissolve RNA, and the RNA is directly used for reverse transcription or frozen storage at the temperature of minus 20 ℃ for standby.

(2) Reverse transcription of RNA into cDNA

The reverse transcription was carried out using Evo M-MLV reverse transcription premix kit (cat # AG11728) from Excery, Inc., with reference to the product manual. Adding 500-1000 ng of extracted RNA (preferably 500-800 ng of RNA) into 20 μ L of reverse transcription system, adding 5 XEvo M-MLV RT MASTER MIX 4uL, and supplementing to 20uL with water. Inactivating in 37 deg.C water bath for 15min, inactivating in 85 deg.C water bath for 5s, and freezing the reverse transcription product at-20 deg.C for use

3. Preparation of positive recombinant plasmid and negative control

The pMD-19T-MrPV-1 positive recombinant plasmid is obtained by the following preparation method:

taking cDNA of MrPV-1 virus as a template, and performing PCR amplification by using a nested PCR primer MrPV-1-1-F/R to obtain an amplification product. And (3) recovering and purifying the amplification product, cloning the amplification product to a pMD-19T vector, transferring the vector into DH5 alpha escherichia coli, screening and sequencing, selecting bacteria containing successfully constructed recombinant plasmids, and extracting plasmids to obtain the recombinant plasmid.

The negative control was pMD-19T empty vector plasmid.

4. Establishment of PCR amplification method

(1) PCR amplification system

Nested PCR detection is carried out by taking cDNA synthesized by reverse transcription as a template, a primer used for the first round of PCR amplification is MrPV-1-1-F/R, and a PCR enzyme used is 2 × Accurate Taq premix (containing dye) (cargo number AG11019) of Aikory company. The PCR reaction used a 20. mu.L system: 2 × Accurate Taq Master Mix 10 μ L, forward and reverse primer concentrations 5 μ M, 0.5 μ L each, 1 μ L of cDNA template, sterile water make up to 20 μ L.

(2) PCR reaction

After the PCR tube containing the reaction system was placed in a TaKaRa PCR Thermal CPCR apparatus, the following conditions were set for the reaction. The PCR cycle for primer amplification was: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min for 40s, 30 cycles; then further extension at 72 ℃ for 10min, and finally storage at 4 ℃.

The PCR amplification product is detected by agarose gel electrophoresis, and the size of the fragment to be amplified by the primer MrPV-1-1-F/R is 1484 bp. And if no positive band is detected in the first round of PCR amplification, diluting the product by 50 times by using sterilized water as a template, and performing second round of PCR amplification by using a primer MrPV-1-2-F/R. The PCR reaction system is the same as the above, and the amplification procedure is changed into: 5min at 95 ℃; 30 cycles of 95 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 1min for 10 s; preserving at 72 deg.C for 10min and 4 deg.C.

The two rounds of nested PCR amplification results are shown in FIG. 1, the second round of electrophoresis image has a positive band and a negative control has no band, which indicates that the primer group is positive to the detection of the MrPV-1 virus, and the nested PCR detection method of the MrPV-1 is successfully constructed.

5. Optimization of annealing temperature

To compare the effect of different annealing temperatures on PCR amplification reactions, the concentration was 10⁴The positive recombinant plasmid of copies/uL is used as a template, primers MrPV-1-1-F/R and MrPV-1-2-F/R are respectively used for amplifying the positive plasmid at different annealing temperatures, a PCR system and other reaction conditions are the same except for different annealing temperatures, and each experiment is repeated for 3 times.

The amplification results of the primer MrPV-1-1-F/R at different annealing temperatures are shown in FIG. 2, wherein M is DS2000Marker, the annealing temperatures of lanes 1-6 are 50 ℃, 50.9 ℃, 53.3 ℃, 55.7 ℃, 56.8 ℃ and 59.9 ℃ in sequence, and lane 7 is a negative control. As can be seen, the band in lane 5 is brightest, so the optimal annealing temperature for the first round of amplification primers (first amplification) is set at 57 ℃.

The amplification results of the primer MrPV-1-2-F/R at different annealing temperatures are shown in FIG. 3, wherein M is DS2000Marker, the annealing temperatures of lanes 1-6 are 50 ℃, 50.9 ℃, 53.3 ℃, 55.7 ℃, 56.8 ℃ and 59.9 ℃ in sequence, and lane 7 is a negative control. As can be seen from the figure, the second round amplification primers (second amplification) were bright and stable in each band at different annealing temperatures, and the highest annealing temperature of 60 ℃ was selected as the optimum temperature.

6. Sensitive detection of primers

In order to detect the sensitivity and the repeatability of the primers, the primers MrPV-1-1-F/R and MrPV-1-2-F/R are respectively used for carrying out sensitivity detection on positive plasmids with different concentrations, and each experiment is repeated for 3 times. The positive standard plasmid is sequentially decreased by 8 gradients by 10 times, and the concentration is respectively 10⁷copies/uL、10⁶copies/uL、10⁵copies/uL、10⁴copies/uL、10³copies/uL、10²Amplification reactions were carried out according to the reaction system and conditions in example 1, part 5, with copies/uL, 10copies/uL and 1 copies/uL.

The sensitivity detection result of the primer MrPV-1-1-F/R is shown in FIG. 4, wherein M is DS2000Marker, and the concentrations of the positive plasmids of lanes 1-8 are 10 in sequence⁷copies/uL～10⁰copies/uL, lane 9 is a negative control. As can be seen, the minimum detection limit of a diffusion is 10⁴copies/uL。

The sensitivity detection result of the primer MrPV-1-2-F/R is shown in FIG. 5, wherein M is DS2000Marker, and the concentrations of the positive plasmids of lanes 1-8 are 10 in sequence⁷copies/uL～10⁰copies/uL, lane 9 is a negative control. As can be seen from the figure, the minimum detection limit of the secondary amplification is 10copies/uL, and the PCR method for detecting the MrPV-1 virus, which is established by applying the nested PCR primer, has extremely high sensitivity.

7. Specific detection of primers

In order to detect the specificity of the nested PCR primers, the invention extracts the RNA of a positive sample of each of Macrobrachium rosenbergiiflag virus (MrFV), MrPV-1, Macrobrachium rosenbergii dicistrovirus-3(MrDV-3), Mud crab reovirus (McRV) and Mud crab dicistrovirus (McDV), carries out reverse transcription to obtain the cDNA of the RNA, and uses the primers of a first round and a second round of nested PCR to amplify the viruses respectively, because the DV is a satellite virus of the McRV, the two viruses are in the same positive sample in the actual detection process. The results of the specific detection of the nested first round primer MrPV-1-1-F/R and the second round primer MrPV-1-2-F/R are shown in FIG. 6 and FIG. 7, respectively, the positive samples detected in lanes 1-4 are MrFV, MrPV-1, MrDV-3, McDV and McRV, lane 5 is a positive control, and lane 6 is a negative control. As can be seen from FIG. 6, no band appeared in all the virus samples except the positive control, and as can be seen from FIG. 7, the bands appeared in all the virus samples except the MrPV-1 positive sample and the positive control, and the results show that the nested PCR primer of the present invention has good specificity and can specifically detect the MrPV-1.

Example 2 nested PCR detection of Macrobrachium rosenbergii samples from Huzhou, Zhejiang

The invention utilizes the nested PCR primers to detect 10 macrobrachium rosenbergii samples in Huzhou city, Zhejiang province, and the specific steps refer to example 1. The amplification result of the first round primer MrPV-1-1-F/R is shown in FIG. 8, and no specific band appears, so the first round PCR product is diluted by 50 times to be used as a template for the second round PCR detection. After the second round of nested PCR primer MrPV-1-2-F/R amplification, a fourth sample is found to have a specific band, as shown in FIG. 9, the nucleotide sequence of the fourth sample is identical to that of the product amplified by the second round of PCR primer through sequencing verification, which indicates that the nested PCR detection method for the MrPV-1 virus established by the invention is suitable for actual detection.

Example 3 design and detection of fluorescent quantitative PCR primers

1. Primer design for fluorescent quantitative PCR

According to a genome sequence obtained by the detected macrovirus, a fluorescent quantitative PCR primer is designed by taking a nucleotide sequence of 11688-13171 th sites in the genome as a target gene, wherein the genome sequence is shown as SEQ ID NO.1, and the target gene sequence is shown as SEQ ID NO. 2. The primers are designed by Primer 6.0, and strictly screened by Primer select of Lasergene 7.1, so that 1 pair of proper fluorescent quantitative PCR primers MrPV-1-q-F/R is finally obtained, and the size of a fragment to be amplified is 220 bp. The length of the primer MrPV-1-q-F is 22bp, the primer MrPV-1-q-F is located at 12845-12867 th sites of the MrPV-1 virus genome from 5', and the length of the primer MrPV-1-q-R is 25bp, and the primer MrPV-1-q-R is located at 13040-13065 th sites.

The sequence of the primer MrPV-1-q-F/R is shown as follows (SEQ ID NO. 7-8):

MrPV-1-q-F：AGCCGAGATCGCCGCCTTACTT

MrPV-1-q-R：ACCTCGCATAGTGGCAAGAGACAAC

2. establishment of fluorescent quantitative PCR method

Extraction and reverse transcription of RNA As in example 1, reverse transcribed cDNA was used as a template, and the cDNA of Escire corporation was used

Green Pro Taq HS premix type qPCR kit II (AG11702) was used for fluorescent quantitative PCR detection.

The reaction system is as follows: cDNA1uL, primers 0.2uL each, 2 × SYBR GREEN I MIX 5uL, ddH₂O was made up to 10 uL.

The reaction sequence is shown in table 1:

TABLE 1 fluorescent quantitative PCR reaction procedure

If an amplification curve appears in the qPCR result and the Ct value corresponding to the curve is less than 37, the result is regarded as a positive result; if no amplification curve exists or the Ct value is more than or equal to 40, the result is regarded as a negative result; if the Ct value is between 37 and 40, the experiment is recommended to be repeated, if the Ct value of the repeated result is less than 40 and the amplification curve has obvious peaks, the tested sample is judged to be positive, and if not, the tested sample is judged to be negative.

2. Fluorescence quantitative PCR standard curve

Sequentially carrying out 10-fold degressive dilution on the positive control recombinant plasmid, and selecting 1 copies/uL-10⁷Fluorescence quantitative PCR amplification is carried out on 8 dilution gradients of copies/uL, an amplification curve is drawn, as shown in figure 10, the logarithmic value of the copy number of the positive control recombinant plasmid is taken as an X axis, the Ct value is taken as a Y axis, and the obtained standard curve equation isy-3.373 x + 36.545. The correlation coefficient (r2) and the amplification efficiency (E) of the method were determined to be 0.9994 and 97.9%, indicating that the design of the primers of the method was good and the reaction system was normal.

The positive recombinant plasmid is diluted by 10 times in a descending way, and 10 selected²copies/uL～10⁹The fluorescence quantitative PCR amplification curves of the positive recombinant plasmids with different concentrations are shown in figure 11, and the graphs show that S-shaped amplification curves appear except negative control non-S-shaped amplification curves, wherein the concentration of A is 10⁹copies/uL, B is 10⁸copies/uL, C10⁷copies/uL with a D of 10⁶copies/uL, E is 10⁵copies/uL, F is 10⁴copies/uL with a G of 10³copies/uL, H is 10²The results show that the fluorescence quantitative PCR method has wide applicable concentration range and reliable detection results.

3. Sensitivity detection of fluorescent quantitative PCR primers

Respectively diluting the positive recombinant plasmid standard substance to 10⁰copies/uL～10³And (3) amplifying the copies/uL by using qPCR primers for 4 dilutions in total, repeating the dilutions for 20 times, and selecting the minimum dilution with the variation coefficient of less than 5% and the positive detection rate of more than 95% as the minimum detection limit of the reaction system and the procedure. The results of the sensitivity detection of MrPV-1 are shown in Table 2, and it is understood from the table that when the concentration of the positive plasmid is more than 10²coefficient of variation is less than 5% when copies/ul is detected, positive detection rate is more than 95%, and minimum detection limit is 10%²copies/ul。

TABLE 2 sensitivity detection of primers

4. Repeatability detection of fluorescent quantitative PCR primers

10 times of the positive control recombinant plasmid is diluted in a descending way, and 10 selection results³copies/uL～10⁷And (3) carrying out qPCR amplification on 5 dilution gradients of copies/uL, repeating for 5 times, and calculating the intra-batch variation coefficient according to the Ct value. In addition, the reaction system and the procedure for performing the batch repeatability tests at 3 different time points, calculating the batch variation coefficient according to the Ct value, evaluating the stability of the established method by utilizing the batch and batch variation coefficients, and detecting the repeatability of the primer are the same as above. The results of the repeatability tests of the fluorescent quantitative PCR primers are shown in Table 3, and it can be seen from the table that the intra-group coefficient of variation is 0.43% -4.03%, the inter-group coefficient of variation is 0.62% -3.99%, and both the intra-group coefficient of variation and the inter-group coefficient of variation are below 5%, indicating that the method has good repeatability and reproducibility, and stable and reliable results.

TABLE 3 fluorescent quantitative PCR Intra-group repeat and inter-group repeat coefficient of variation

5. Specificity detection of fluorescent quantitative PCR primers

In order to detect the specificity of the set fluorescent quantitative PCR primer, the invention extracts the RNA of the positive samples of the Macrobrachium rosenbergii virus (MrFV), MrPV-1, Macrobrachium rosenbergii dicistrovirus-3(MrDV-3), Mud crab reovirus (McRV) and Mud crab dicistrovirus (McDV), carries out reverse transcription to obtain the cDNA thereof, and uses the fluorescent quantitative PCR primer MrPV-1-q-F/R to amplify the cDNA of the viruses. The specific detection results are shown in FIG. 12, wherein A is MrFV positive sample, B is MrPV-1 positive sample, C is MrDV3 positive sample, D is McDV and McRV positive sample, E is positive control, and F is negative control. As can be seen from the figure, only the MrPV-1 positive sample and the positive control have S-shaped amplification curves, which shows that the specificity of the fluorescent quantitative PCR primer is good, and the MrPV-1 can be specifically detected.

EXAMPLE 4 practical detection of fluorescent quantitative PCR

The invention utilizes fluorescent quantitative PCR to sample and detect 10 macrobrachium rosenbergii samples in Huzhou city of Zhejiang province, the template is the same as the embodiment 2, and the specific steps refer to the embodiment 3.

The detection result of the fluorescent quantitative PCR primer MrPV-1-q-F/R is shown in FIG. 13, and except that Lane4 has a Ct value and an amplification curve, other samples have no Ct value and no amplification curve. Ct values of 10 macrobrachium rosenbergii samples are shown in Table 4, the Ct value of Lane4 is 26.88, and the copy number is 733copies/uL, and is located at 10⁴The nested PCR results were matched between copies/ul (one amplification minimum detection limit) and 10copies/ul (two amplification minimum detection limits).

TABLE 4 Ct values of 10 Macrobrachium rosenbergii samples amplified by fluorescent quantitative PCR primer MrPV-1-q-F/R

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<120> target gene and primer for detecting Macrobrachium rosenbergii virus MrPV-1 and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 14462

<212> DNA

<213> Macrobrachium rosenbergii picornavirus-1 (Macrobrachium rosenbergii virus 1)

<400> 1

cccccccccc cccccccccc cacacccccc cccccccccc cccccccccc caagaaacct 60

tcttttttgg aggtcactct tgagaaactc ccagaaaaac ctgtccccca ggtccctatc 120

tgcaggaaga agcgtgcagc cccaccacct aagaggttgc cccctccccg ccctgcagtc 180

accttggatt gggcaaggac tcctgctaaa ggagctccta tctataccaa caaagggaaa 240

atcattcctg tagaggaatt gacaaagaag gaagttgatt tttgggatgt agaactagaa 300

ctctaccaac cagtcccagt gcctgtgatt gataacatca tacttgaaaa agtagaatgc 360

tattcagccc cagcacgtaa gagtgcccca cccaagaagg agaagaaaga agtaggtaag 420

aaagtcacct atgctacctt ctgcaagcct atcaagaagg ctaagaaagt tgtacaaact 480

aagcagaaga agaaatctaa gattcgtgaa aacctgatca agactgctcc taagtggagc 540

ttgacagcag caaggcgcag acagcgaaaa tctcgctgct ttgtttcccc taaaggcttc 600

gatgaggagc ctgaagaaga acaacctgca ccagagcctg ttgatgcccc caactgtctc 660

tcagaaagag agctcaaagc tatctcaaga gctccaaaac ctaagatcgt tgaacccgtt 720

gtctttgaca acgtatttga cgatttgagg gacgaagcta ctgactttgt cgagaagaac 780

agttggatgt atgagcatgt tcaacgcagc ccaccaccta cccgcagagg gtttgtgcac 840

cactcaaaac tcaagactaa gaaagatctt gagcgcattg ctgctcaacc tccccccaag 900

gagaagaaga agcgcaggca caaccgtcct gcaaacttga tgactttctc acgaaagaag 960

cccactgcag tagagtccac aaccattgcc tatgacgctc ttcttcaaga gattcagaaa 1020

tcccatgaag agacattaac ttcagaagcc agccgattgc acaaattggg agtaaactca 1080

gaagaatatg ctcattatgt tgctgatttt ctagaacttt ggcttgagca aaatcctctt 1140

cagattaaga aggatgatga ctactacaat ttttacgaca aatttgtttt tgacgcaatg 1200

tacaaattca gtgaagcatc agtagatatg tttgatcaat tatcagatgt aattactaga 1260

gctattggta ttcatgacgc tgctcttaca gtagcgttgt gttgcaattt ggcctctatt 1320

gttgctgcat ttagattgtt cactcaagta aaaggaaaac ttgacgttgc tgtagctatt 1380

ggaagtatag tttccaatgt cttatcaatg gcatgtgttt tcatttcatc tagagtactt 1440

accagaacag tcaccgaagc tttgcgtgac ggtctgggaa gagtgaaaac aatgtttatt 1500

gaaatgcagt caggaattgt agatttcgtt cgtcaacttt atgacaatcc aaaggaaact 1560

cagctctctg ttcttgaaca tcaagcagtt attgaaagag ttacacatgc taccactatt 1620

caagaatcta ttgatggact tgttactgat ttaggcaaat ctttgcctga taggatcaac 1680

gcatgcaagg attatgtgca agcattgaaa cctctttgca cagagaaaga cggagatgcc 1740

tattctttga aaggatggtc cccaactaag aaggcttact atggagatca ttggtttttg 1800

ccttgggaag ttgataaaaa cagcccgaat atgaagatca attttgacaa tacctacact 1860

gtcatcccaa tccctaaaga aggggttcac agtgactcta tccgttgtta tttagcactt 1920

ttgtgcgaag tccccctcca ggagatttat atttataagt ctgagaatgg aggtttccct 1980

aagactgatc gagttatttc agatgagatt gttacagcat ccgaaattga tgcagtcaaa 2040

tttttaaaca ttcgtgctgc agttaatgat aaagcaaaag attcagttga agtcaatagg 2100

aaacaacagc aagttatgtt gcaagcctct aaggataggt tgactaaatt atttaatgtt 2160

ttgaaatcta acaaccaatc tttagaacct ttgaagaact tgatgtacga tcttggtctt 2220

gaagaagaaa ccatgaaaca atttatcgac tctcaagttg aagacgcact ggaaatgaac 2280

ttagtaggtg atggtgacga tacatctgtt accataccta ttgagaagtt tatagtcgat 2340

tttatgattt cctccaacac agccgatttt attgacagtc ttagagatgg aattcagcaa 2400

tgtaactctt ttggttctgc caaggaatgt gcggacatcg catgcaaagc tggactaagt 2460

ttggatgtgg ttattaaact atttaaagta tctttagatg cttgcaacga ccagacttac 2520

aatactgttg ccgacaattt ccagtgttgt acagtaactg atttggaagg ttttatttgt 2580

gctttgatag actattataa agcacagaat attttgctta ccacaccaaa tggtacatat 2640

ggttatctcg aaaagcaacc cagcgaacct gttagaatca tatctgtttc aacacaggga 2700

actgttgatg ttctgaaccc tgctcctaag gcttggaaag actataagat caaacccttc 2760

cccgacacta agaatgatat tctatctata ttcccgaagg ataatcattt ttgcgctgat 2820

tgctttttgc acccgcgcaa agataagatt gaacctcaag acttaataag cgtcggtgcg 2880

cttgcgatgg ctgatgccgt taggatactt gaaattgatc ctgctttgtg tccagattct 2940

attgatatca catttagatg ggcaggctat ggtgtcgttc aacctgacgc caacggaaaa 3000

gtttttgaac cagcctgtag acgaaaatct gttgtacttc ttaatggaga gatatttgtt 3060

ttccctgaat ttgttagaag aaaagacaga gaaggatact atcttactaa agaagttttc 3120

ggaagtcctg ttataaagaa agatcacttt gtgaaaacta acactctggg aggccttcaa 3180

ggtctctgga atgatgaagc aggaaatgtc agttatccta tcgtgatgag taggattctt 3240

ccccaattgt tgatgaatca agaaaagaag caggaatggc aaggacaagt tataccaact 3300

aaatttacgg caggaggccg tagttatgat gttattttcc atgacgataa gactgatcat 3360

gacgctcaga acaatggtaa actctataac aaccatttct ggggatgttc taaatgtgct 3420

tggcaaggcg gcgtcaaacc tgtcgctaga gtcaaggaca atgaatctaa tgacaacctc 3480

acaaaatcaa tgtcggttgt taaactagtt gcttgcacat tgtgtgttgt tatgtctata 3540

gttttaacgc acaatgacgc taaggcacgc cccatagatt actttaaaaa tattctatgt 3600

ggtgttgctt taggcggagc agctatgtct ggttttgaac ttttcggcca tttgttccac 3660

aaagctacag aaccccagga tgaggaagaa attgcattag aacttcgcaa gaatttgtta 3720

gcatataatg gaataccagt agaaactatg gctagagctc cttcagtttt aagagcctct 3780

attaagaaag ctgatgaagt ggttagattc ttagccactc ataagcaaaa aactggtata 3840

aatgtaagtc ttaatcatct tctccagaga ttaacagaaa aacatatttc gattttgcaa 3900

tctggagctt acgaagcttt gcgtccatct acatatatta tgttaatcac gagcgcacct 3960

ggtcttggta aaaaccatgc ttttactgaa aggcatggtt ttggaagttc tcatgttggt 4020

tgcggaatta gaaagttaaa ggacatctgc ggtcaaactg ctagaacgaa gtggttaaaa 4080

cttgacgcca atggatattt caatgaaatg aatggtgagc agattaccat ctacgacgag 4140

tgggctatga gaactgaaga acccatgatg tatatgatca accaagttgg aaacaacact 4200

cctgccacat tcagtggagc atcagttgaa gcaaaacatc agttgtttat gagtgatttt 4260

ctgattctcc tttcaaacaa ggagactcta ccacagaacc ctcgtataaa caatgaagca 4320

atggctgcta ttgacagtag aataaatcat tatagggttt ctgatgcagc tactgaaact 4380

tggttagcaa ctcacaatcg tcatgaactg agaccaagca ctttacccac cgatatttca 4440

gcgatgaagt gggaaaagag aattggaaat aattgggttg ccaccacttg gaatgagatg 4500

tggtatgaag ctgctgtaca ttattacaac caaaggcagc agattaaccc cctctcaatc 4560

caacgtacac aacaacatct gttgggtggt tatgaagaag atcatgtcgc tcaccctagg 4620

caacttgccg aactttggaa tatggtaaaa atacccgata ttccacttgc aaaagaagct 4680

ggaaaattca cttggtcttt agctagtaaa gattatgaca tttgggaaaa agttagagaa 4740

ggcactaaag ccccaggcag ggacgacaac ctctacgtgc atttgcatgg gcattccgga 4800

aaaggaaaaa ctacttggat gaaggaggtg attgacgact ggtctacttt aactaagagt 4860

gaatcagctt gtttctatat ttcttgtgaa gaagaatatc ataacttcat gaaatatcag 4920

aggcacacag tgagagcagg agacattatc gttactgatg acgttttctg ggaaccttac 4980

tgcaatgtaa acgacatggt cggttcactc cgtggaatag ttgtttgtca tctctctaat 5040

tcttgtggaa agtattttaa gactaagagc cctggatggc tatctctaaa cagtcttaga 5100

tttatttgga acaacttgag aactgtttgg aagactactc aacaagaagg agtcacacgc 5160

ccagctagat atttccacag cactcttcgt aacatcagag aaggagaatt gaggagaagt 5220

ggtttgtacg gcaatttgtt cgttctgcag gatagagtaa gaacagcagt tccaggagac 5280

aataattggt tagaagtctc tccagatcct ttctacacct ttgagatgga acttactact 5340

gaaaacaaat ggtatgttcc cactgaacag cagttctatt ctcctggatc cattaaagaa 5400

agattcctgc agaaagttct ggattggcgt aactcttcta ctccaaccac aattgttaac 5460

accagccagc ctgttcctaa tgattttgaa gttgagattg ttgctaaaaa cctagaagag 5520

ctaaagaaat tgttaaaaga gcctgatgac atgttgaaag aactttgtac agaaaaagga 5580

aaaggatgta tctgggtaaa cgagcggctg ttttacaagt ttgcaaaaat accttctctc 5640

cgaggctctg cttggcaact tcctagtacc ttaaaagaag aagatcttga taaagtagtt 5700

ttgaacatgt tccagacgtt caagagaatg gctccagatt ctaaagtctt tgtaaagatt 5760

ggtgacgtta aatactggaa tagagataaa gtcatcttct ctacgaaagg tggaattaga 5820

tataaacttc acactataat tgatcttgag aaggaacccg gaaaggtccg aattgattta 5880

attgagacag aaaagcagtt agaagttaaa tctatcttct gcaataaaat gatgttgatc 5940

cgagttcttg aagatggaat ttatggagtt gaagataata tcaagatgaa gattggtgac 6000

atcaagctac ttatgacagt taaagaccag atattcgacc atgtcaatat gatcggagca 6060

gtaactgagt ggcgtcaaat ttgtcttaga aacaaggaac aagccagaaa agtctcaaag 6120

cttcagaaac taaaggaatg gattgaaggc gacacaacaa cagctctgtg tttcaagatc 6180

tttatgactt tgtgtttatt agagatcacg atcataggcg tccgctcttt tttcaactgg 6240

tactcaggtg accccgtaat tagctgtatt ttctgtaaag gttcatactc tatcacgaaa 6300

gagaatgcca aatatgtcac aaatgataga ttcgaatatt gtcttttatg taataagtgg 6360

aggctaagaa cccagccccc cacttacaac gagtgtgtag cttttcagat gtttgaagag 6420

ggtagggact accgtgtaat cgacccctgt aattatccaa gtgttagata catggaagca 6480

ctacgagacc ctttccctcc tgaaatccat cagaatcttc acgggtatga acaccagttg 6540

aaagagatgc agtctgatgt taatgatttg cattcgagag gccaggcaaa gaaacttcta 6600

gaccaacatc ggggaggagg atatgcccaa gctagacagt acattgagcg aggagctcac 6660

ttacgaccac cagaatggtc tgccaattta ttctcacacg agtcagggcc acctcaaggc 6720

acaaatagtt ccaccgccgg atttggctat tctgacccat atcagtttcc tccgcaagac 6780

ccagttcaaa aagctgttag agactttgcg aagggagcca agtttgattt agactctcat 6840

gtgaacaagt taattggcag agaactccaa agtggaagtg gtaagtttgt agatatctcc 6900

catctgcaga agaaagtaga agatgctgtt gtcactcttt ctggaggctg tgagttgcaa 6960

gggctaagga ttaaaggaaa atatgtgttg tttccattcc atttggttac acatgctaac 7020

atccaaaatt tggcaatcac cactaaagtc aatggaaaga cttatcaagt gacggacgtc 7080

catcggattg gagattgtga cgcagcaatt ggagtaatta atggaaaaga cgtagaattt 7140

gcggaagata taacacacat tttcttccca gaatccgaat taaacaacgt aaaatctgtt 7200

ggtatgtttg tatgtaagaa agaaaacgga acggttaata gagtcccaga aactttacac 7260

tcatggcaca ccaacgacca aaagggtttc ccattggaaa tccaaatccc ggtagtgggt 7320

ggtaaagtac agaccactag aggagattgt ggttctcctt attacgctat cgttgaagaa 7380

gcgcatcacg aatatttgcg gtttgttgca attcacgctg ctaaagtgag cgaacgggct 7440

tatgaaggag cagtgattac acatgagcgt attcgtgaga cgcttgacgc gatggaggga 7500

cttgagacgg cggtttcaaa catgctgaaa ccaacggttg ttgacctagg aaacaagaaa 7560

tacaatacag tagtttatgt caagaacgaa attgaaagtc tcgcatcaaa caggaaacca 7620

actttccgat acaagagtcc tcttgaattt ctcatgaaaa tagaacattt tgagtatcca 7680

caagataaat caaagagggc gccttggttt gatgagttgg cagcagagtt cgactgcccc 7740

gttcttgaag tggatgaatc tgctcctgtt ttaccaccgc aagtattagc tgtattgccc 7800

agaaacaacc atggaaagcc tgataagatt cagaatcaaa taaaccagat tcttgagaat 7860

ccaaaacatc tcaatttatc tagagatgaa tatgatgaga tgaacgcagt tttcaaggat 7920

caggtttatt tgatcaggag atcttatctt taccagtggg atgtgcaatc accagttgcg 7980

agcatgaacg cagttaaaca tcagactttc acttccaagc cgattgcagt gaacaaatca 8040

gcaggattct atggtcatct aagaaaactg ccgatgaaga accaactaat agacgtgggg 8100

cctactggaa accgcaggtt tgtgaaaggg aacgagggtg ttcttctact gaactacgtg 8160

cgaagatgtg ctgatttggt aagaagagga gactcttttc taaccgtctt ccactatatg 8220

gcaaagagag aagctttacc agccgataag gctttagctg gaaaagtaag aatgttcagc 8280

gcagctagtg tggagcttac aatcgtcgaa aggatgtttt ttatgccttt aattgcattg 8340

atttcagccg tcgacgggcc attccgcact ggttatgatg agctagtgtc tctcggtaga 8400

aagcacgcat ctctcgtgga aggatttcca aatgtggcct cattcgattt ttcgaggttt 8460

gataagtggg ccactaaagc tgaggtttat tttgctgtcc gactgctctg ctggatgaat 8520

cttctatggt gtgaaggtga tggacttatg gctgatacta tcgcagctgc tttcacaaag 8580

atctactgtg atagcccgat tctatgcaag ggcgatttgt ttagagctaa tggtactctt 8640

ccaagtggca tattacttac taatgtaatt ggctctgcta tcgtccacat gcgaactctc 8700

agggcttata aatatctgta tgaaatgaga cttggactca aagatcaata catgttccat 8760

atttatccat tagcttgcgg agatgatctg accgtatact gtactgacga agggttagta 8820

cctttggatc agttagttga aaagatgcaa gaaaatggat gcaagttgac aacgacatct 8880

aaagaagccg tcgccactga tattattgaa tgggctccat ccagtgaagg aacctcattt 8940

attagtagga ctgtctggtg gaatgacgag cagaggtgtt atttttcacc tttgaagatc 9000

agttccatag tgaaatgttt gtggtatgcg catagtttag catacgaatc accagcagac 9060

ctgcttttaa tggttattac tgaagccaga gcaataagga gatcacttga ttacaacgtg 9120

gtgatgaaga tggttaatat cattggcaga catccgctat taaagaacca tcagcagttg 9180

tcaaaattat gtgtgaaaca tgttactgct caccgacttc atgctctcta catcaaaaca 9240

ggtcagaacc ccatgagtag agaattggag ctgccttctc ccgcagcagg gaaaactgaa 9300

ttaataccct ctgacgagcc atacgtagga acgaagttca ctatcaaccc cgaaggagga 9360

tataaatttg aatataagat gctccagtac aatacctcag tcaaaaggaa ggtgcaggaa 9420

tggtgccaga agaatcctgg aaaggtgact atcaatcagg aacctaccaa gaggacagtt 9480

gtgctagcag atggtacaac taggtatatc tggctataca attacgtctg gaaggtgcaa 9540

ggcacttctc tacccaggca tacattcaag gacctggaac aagactgctg gaatgaactc 9600

tggaacgaca ttagaaaatg gtataaagtg gttgaaaaga aagatgcatt tgaccaaatg 9660

ctggacgact cagatgagaa aggatttgac ctagttcacc accgagataa tgacccagtt 9720

gttggcatca agcaaggcag aatttggact atcttcgtaa aacttgaaga tggatggcat 9780

acttcaacag ttaccggcaa gtacaatagc aaggatatgt atgatcaagc tcatacttgg 9840

cgcagagcca atccttctcc agccaatcac cactacagta tactcagaga aggagacatt 9900

ctgatgtccc atgacattga cactctccga gagtggtatg actggcataa cgtagttcaa 9960

tatgaccacg agatggagag aggggattct atgcctcctc agacgactgg cccagacgtt 10020

ggccagcccg cgattccagc cggtagctct tgccccccat tagaggcttt catcctaaag 10080

cctaaaggtc atgggcaagt gcatattgat gtttcacagc agactgattt tctcacagaa 10140

cttgccgcca tgcagacagc agtttacata ggaacacaat ccattccagg taacgtagca 10200

aacggagatg ttctcttcac ttgtggagga gatgacatca tgaaacatga gtggtttgct 10260

cagaaatatg ttacccacag taaatttgga ggtcattact atgtaatact gaagattgca 10320

ggtgcttcaa acctttgtgg tacagtttca ttcacggcta aaaatacaaa agactctgct 10380

ctcgagaagt atcagaatca gtcaattata aacattcagg acatgcttgc acaaggaatt 10440

gcaggctcca ctattgtttt gcaatgtaat ctctctaaca atagtgtgga gaaaggactg 10500

actaagctga tgtgggtagc caaagatgca actgcaacca agttcgaagt tactccaact 10560

caatgggaaa tgaaagccgt gagcggttgg ggcagtgcat tcatctctga acttactgcc 10620

tcaacagcta tgactgtgtc cacttttgtg gctcttggtc atattgaccc ggtaaaaggt 10680

tacgaactca caatggaact tggtggttgg agtccagcgg caattgaagt tgtcactgga 10740

ggtggtgaca aaggaagcat agttggtaag accattggag agctagatcc caactcgtct 10800

gtgtatgtct ggtcaacaaa gactactcca acaaataggt ttgattccat tgctgatatg 10860

gccgctaaag gacaatataa cccagatagt caattcaatg atgctttgag aggcaagtgg 10920

gttactggcg taacacctag aacatcctgg tggagaagcg ctttgttgca cgatggctca 10980

ggacagtatt tcacagttgt gagggctata tatccataca atcatccttg tgtaatggct 11040

ggaagacagc cagacaaaga atatgatgct tctcttttgg ctccagtcgc agtctacggt 11100

tcttactact gtcctaagac ttatttacga tttccatata ttaaggacac tgtgcgactg 11160

acttcaccta ccgactttgg acaactcaca gactatcttg cgaaagacgc tccagagatg 11220

attttctcat acatgagagg aaaaatggta gcttctgtga agaaagctaa agttgaagag 11280

aagaatatca ctgatgaaat cactagggtg aatgtggaca taatgagaag ttttaagtgg 11340

ggtccattca accaggcaaa gaacatggat tgttggtctt ggtcactaga aggctcatct 11400

cttgttgaca aatcaatggc aactgttctt ccaaacgtag actcagtagc tggtacagtt 11460

gtagatgagg ctagcccaga tcgcactgcc tcccaattag cagaatctac tactcacaga 11520

gacacgcgtg taggatctaa acaagcagga agtactttgt caggaacagc agaagtaatg 11580

ctagatacct cagatgttct agttgtcgaa gagatttttc ttttagatat cattgatgct 11640

ggtgcttttg acatgaaagc tgtaagtatt ggatcttcct tcccagttgt tgtgacggat 11700

ggagtagtta acgctaagat gtctgctgtc gcttctacaa attttatgca gaaagttgaa 11760

gagcaattac aagataatta taattaccgt ctcacactaa aacatccagt gttggcaaac 11820

aagatttttg aggtgtatct gcatgctcat ttgacaggag gacacacttg gcttactcaa 11880

gctactaacg agtatatgat ggcgacaaac tttgaccaat ggataatagc tgaaataaaa 11940

gaggtgcgag gaactgaagt gtttgttctt actgatactt ctaattggac ctctttcaag 12000

ttggcaaaca ttgagaaagt taaggaaaga gttcgaacaa taaggtatat tcagagagct 12060

cctatcacag cacctgtttc taacccaaga aaccaaggaa ggaaagtaca aggagtaaga 12120

actcttcaat cgggcgacaa tgagtacatg gccttcatct accacgctgc aagtagccaa 12180

gttaaaaatt caatcaactt ggtttccatg tgcatgtggc aagaccataa ggaattgtgc 12240

aagaatgtag aatggaagaa acgccatact ctccacatga ctctcgctct acttaaatca 12300

aacacagttt cagcaggagt gctcaggaaa gatctggacg accattttga ttttgatgac 12360

caatcatctt ttgctctcaa gatgaagaat ggtgctccag ttgtttcctg gttaggaagg 12420

actttggttg cagaaatcga tgaatctttc cctatggaag agaagtttaa gaagatcacc 12480

aaggaactgg cagagaaatg cactatttcc aaacctattg caactctccc agccaagcca 12540

catgtctcaa tagcttttct tcgagatgct ccgcaggaag tgagagataa gatcgcagca 12600

cagtatgtga cagaatggaa gagactcaac gaggacggag gaatgaagca catatcgcac 12660

tgttgttggt atgaagtcaa gtctatctgg acaaaagaag aaagagctgc tcaaaagcaa 12720

gtgtcaaaga ggacatataa gaatgtggaa acacagactc caatcactga caagcagaaa 12780

gcagctgcag caagagagaa gatcttctcc cagaagaata acatcgtaga accaaaggag 12840

caacaagccg agatcgccgc cttacttgga ggcagtgctc tgcaaggact tgggcaagga 12900

ctgggagcat gggcagcttc agctatgcac tttcgacagg ctaaatggat ggctaacttc 12960

caagcgcaaa catcgaaaga attactgttt cagaaatttc gccaagcaag cgccctgcaa 13020

aatcagctgt ttgaccagaa gttgtctctt gccactatgc gaggtgcaga aagagtggct 13080

actaacccaa caagacctcc tcttgaagga ccaaagacag cttccatcgg cactcaaccg 13140

atgtctcatg catcaactca ggtccaagca gctacactgt tgcaccgcga tttcaataca 13200

gagccgacga ctgccgacaa cggttcgcac attattgtgc cttttacaag agctatccag 13260

attggcagct acaaaacagg aaatgatgtt ggacttgaca ctgacgcact tatacagtcg 13320

cgtctaccac gagcagttgg cactaacgtc aatctacttg atctgtctcc acccacgaaa 13380

cacactcaga cggatgatat tagcaataat aagctactta atccttcatt tgcccccaag 13440

acagtcgaga gcgctagcgg accggagtct gtactaccag cgactagcga aaatagtaat 13500

cagacaacac ctgaaccaca tcctagcact tccggagcct caacgtctgc tgttcatcct 13560

gcagaaactc aggcttctgg agaggtcagt aaaggatcta acacaggtag tcagagtaca 13620

gaatctactt cctgggctga ggaggttgag cgaaaccctg aaccgccagc accctcaatg 13680

aaaactgcaa gtagccaggc ttcaaagcct acatatgcgt ctgtggctgg agcacctaga 13740

gtaaagagac aagctcctcc tcctcctgtg catacagaaa gcgaaccagc accctcatca 13800

cagcatggtg gtccaccagc taaccactcc atcttctaaa tttactaggc cagaaagagc 13860

ctggaatttt ggcaggtgcc tcactgagaa tttttgtttt tttttttata tcagtgagct 13920

ggcctaacta attaatgcag taacaataag aacaagatga cctagtactg cattagcacc 13980

tactaattcc aacaacactt tttgtattta ttgttgtggc tcaacttaga attaagcgca 14040

tatttaaaaa tacaaaaaaa aatataagtt tttcataatt tgaacttcta gggaaacttc 14100

ttattattta tcattattcg tttcccgtaa ttcgaaatta tacccttaga aaattaccaa 14160

aattaatgca gtaacaataa gaaaaagatg acctagtact gcattagaac ctactaattc 14220

caacaacact ttttgtattt attgttgtgg ctcaacttag aattaagcgc atatttaaaa 14280

atacaaaaaa aaatataagt ttttcataat ttgaacttct agggaaactt cttattattt 14340

atcattattc gtttcccgta attcgaaatt atacccttag aaaattacca aaattaatgc 14400

agtaacaata agaaaaagat gacctagtac tgcattagaa cctactaatt ccaacaacac 14460

tt 14462

<210> 2

<211> 1484

<212> DNA

<400> 2

tgttgtgacg gatggagtag ttaacgctaa gatgtctgct gtcgcttcta caaattttat 60

gcagaaagtt gaagagcaat tacaagataa ttataattac cgtctcacac taaaacatcc 120

agtgttggca aacaagattt ttgaggtgta tctgcatgct catttgacag gaggacacac 180

ttggcttact caagctacta acgagtatat gatggcgaca aactttgacc aatggataat 240

agctgaaata aaagaggtgc gaggaactga agtgtttgtt cttactgata cttctaattg 300

gacctctttc aagttggcaa acattgagaa agttaaggaa agagttcgaa caataaggta 360

tattcagaga gctcctatca cagcacctgt ttctaaccca agaaaccaag gaaggaaagt 420

acaaggagta agaactcttc aatcgggcga caatgagtac atggccttca tctaccacgc 480

tgcaagtagc caagttaaaa attcaatcaa cttggtttcc atgtgcatgt ggcaagacca 540

taaggaattg tgcaagaatg tagaatggaa gaaacgccat actctccaca tgactctcgc 600

tctacttaaa tcaaacacag tttcagcagg agtgctcagg aaagatctgg acgaccattt 660

tgattttgat gaccaatcat cttttgctct caagatgaag aatggtgctc cagttgtttc 720

ctggttagga aggactttgg ttgcagaaat cgatgaatct ttccctatgg aagagaagtt 780

taagaagatc accaaggaac tggcagagaa atgcactatt tccaaaccta ttgcaactct 840

cccagccaag ccacatgtct caatagcttt tcttcgagat gctccgcagg aagtgagaga 900

taagatcgca gcacagtatg tgacagaatg gaagagactc aacgaggacg gaggaatgaa 960

gcacatatcg cactgttgtt ggtatgaagt caagtctatc tggacaaaag aagaaagagc 1020

tgctcaaaag caagtgtcaa agaggacata taagaatgtg gaaacacaga ctccaatcac 1080

tgacaagcag aaagcagctg cagcaagaga gaagatcttc tcccagaaga ataacatcgt 1140

agaaccaaag gagcaacaag ccgagatcgc cgccttactt ggaggcagtg ctctgcaagg 1200

acttgggcaa ggactgggag catgggcagc ttcagctatg cactttcgac aggctaaatg 1260

gatggctaac ttccaagcgc aaacatcgaa agaattactg tttcagaaat ttcgccaagc 1320

aagcgccctg caaaatcagc tgtttgacca gaagttgtct cttgccacta tgcgaggtgc 1380

agaaagagtg gctactaacc caacaagacc tcctcttgaa ggaccaaaga cagcttccat 1440

cggcactcaa ccgatgtctc atgcatcaac tcaggtccaa gcag 1484

<210> 3

<211> 21

<212> DNA

<400> 3

tgttgtgacg gatggagtag t 21

<210> 4

<211> 21

<212> DNA

<400> 4

ctgcttggac ctgagttgat g 21

<210> 5

<211> 21

<212> DNA

<400> 5

gatgtctgct gtcgcttcta c 21

<210> 6

<211> 20

<212> DNA

<400> 6

cattcctccg tcctcgttga 20

<210> 7

<211> 22

<212> DNA

<400> 7

agccgagatc gccgccttac tt 22

<210> 8

<211> 25

<212> DNA

<400> 8

acctcgcata gtggcaagag acaac 25

Claims

1. A target gene for detecting Macrobrachium rosenbergii virus MrPV-1 is characterized in that the nucleotide sequence of the target gene is shown as SEQ ID NO. 2.

2. Use of the target gene of claim 1 for the preparation of a product for detecting macrobrachium rosenbergii virus MrPV-1.

3. A primer for detecting Macrobrachium rosenbergii virus MrPV-1, wherein the primer is used for amplifying the target gene of claim 1.

4. The primer according to claim 3, wherein the primer is a nested PCR primer, and the sequence of the nested PCR primer is shown in SEQ ID No. 3-6.

5. The primer according to claim 3, wherein the primer is a fluorescent quantitative PCR primer, and the sequence of the fluorescent quantitative PCR primer is shown as SEQ ID No. 7-8.

6. The application of the primer of any one of claims 3-5 in the preparation of a product for detecting macrobrachium rosenbergii virus MrPV-1.

7. A recombinant plasmid containing the target gene sequence of claim 1.

8. A kit for detecting Macrobrachium rosenbergii virus MrPV-1, comprising a reagent for detecting the target gene of claim 1.

9. The kit according to claim 8, wherein the reagent contains the primer according to any one of claims 3 to 5.

10. The kit according to claim 8 or 9, further comprising the recombinant plasmid according to claim 7.