CN114369610A - T7 phage virus-like particle self-assembly method based on single plasmid - Google Patents
T7 phage virus-like particle self-assembly method based on single plasmid Download PDFInfo
- Publication number
- CN114369610A CN114369610A CN202111456514.4A CN202111456514A CN114369610A CN 114369610 A CN114369610 A CN 114369610A CN 202111456514 A CN202111456514 A CN 202111456514A CN 114369610 A CN114369610 A CN 114369610A
- Authority
- CN
- China
- Prior art keywords
- phage
- virus
- particle
- gp10a
- particles
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/385—Haptens or antigens, bound to carriers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/46—Ingredients of undetermined constitution or reaction products thereof, e.g. skin, bone, milk, cotton fibre, eggshell, oxgall or plant extracts
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5258—Virus-like particles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
- A61K2039/6031—Proteins
- A61K2039/6075—Viral proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2795/00—Bacteriophages
- C12N2795/00011—Details
- C12N2795/10011—Details dsDNA Bacteriophages
- C12N2795/10211—Podoviridae
- C12N2795/10222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2795/00—Bacteriophages
- C12N2795/00011—Details
- C12N2795/10011—Details dsDNA Bacteriophages
- C12N2795/10211—Podoviridae
- C12N2795/10223—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2795/00—Bacteriophages
- C12N2795/00011—Details
- C12N2795/10011—Details dsDNA Bacteriophages
- C12N2795/10211—Podoviridae
- C12N2795/10234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2795/00—Bacteriophages
- C12N2795/00011—Details
- C12N2795/10011—Details dsDNA Bacteriophages
- C12N2795/10211—Podoviridae
- C12N2795/10251—Methods of production or purification of viral material
- C12N2795/10252—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Botany (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention belongs to the technical field of Virus-like particles (VLPs) self-assembly, and discloses a T7 phage Virus-like particle self-assembly method based on a single plasmid, which comprises the following steps: constructing an expression plasmid pRSFDuet-1-gp9-gp10A, transferring the expression plasmid into escherichia coli BL21(DE3), and obtaining T7 phage virus-like particles through induction, expression, in-vivo self-assembly and primary purification; wherein the expression plasmid pRSFDuet-1-gp9-gp10A contains a T7 phage capsid protein coding gene gp10A and a T7 phage scaffold protein coding gene gp 9. The invention provides a novel strategy for preparing T7 phage virus-like particles, and lays a foundation for the subsequent construction of vector vaccines or targeted drugs based on T7 phage virus-like particles.
Description
Technical Field
The invention belongs to the technical field of Virus-like particles (VLPs) self-assembly, and particularly relates to a T7 phage Virus-like particle self-assembly method based on a single plasmid.
Background
The T7 bacteriophage is a virulent bacteriophage whose host is Escherichia coli, and the capsid (Procapsid) of the bacteriophage is a regular icosahedral lattice structure with T ═ 7L conformation, and is composed of a major capsid protein (Gp10), a scaffold protein (Gp9), a connexin (Gp18) and a core stacking protein (Gp14/Gp15/Gp 16). Among these, capsid protein Gp10 has two forms: gp10A and Gp 10B. Gp10B results from the translational frameshift of amino acid 341 of Gp10A, and represents approximately 10% of the total capsid protein.
Virus-like particles (VLPs) are a particulate material of proteins assembled from one or more viral proteins and having a Virus-like morphology, lacking genetic material within it, being incapable of replication and therefore not infectious. VLPs reported in the literature have diameters of 25-100 nm. As a biological nanoparticle, a virus-like particle has the following advantages:
(1) determining components;
(2) the diameter is small, and the antigen can be effectively taken up by antigen presenting cells in lymph nodes to activate immune response;
(3) the interior is hollow, and antigen or medicine can be loaded to realize targeted delivery;
at present, no method for preparing T7 phage virus-like particles by using single plasmids to co-express gp10A and gp9 genes is available. Only the literature reports that the T7 phage gp10 complete gene and gp9 gene are cloned to two separate plasmids respectively, and the expression and in vitro autonomous assembly are carried out, specifically as follows:
technique 1: mario E et al cloned the T7 phage gp9 gene into the MSC of plasmid pAR441, the gp10 gene into the MSC of plasmid pAR3625, followed by co-transduction of E.coli BL21(DE3) pLysS strain, and obtained T7 phage virus-like particles by induction, lysis, in vitro self-assembly and purification.
However, expression of the Gp10 gene can form virus-like particles containing two capsid proteins (Gp10A and Gp10B), and the structural components of the virus-like particles are not determined enough to be favorable for preparing vector vaccines by embedding antigens on the surface; in addition, multiple expression plasmids are also not genetically stable as a single expression plasmid. Therefore, there is a need to construct a simpler and more stable self-assembly method of T7 phage virus-like particles to compensate for the short plates in the prior art.
Through the above analysis, the problems and defects of the prior art are as follows:
(1) the virus-like particles obtained by expressing the T7 bacteriophage gp10 gene and gp9 gene have insufficiently single and definite components, which can increase the difficulty in constructing subsequent capsid protein fusion antigens (vector vaccine antigens).
(2) The genetic stability of the multiple plasmids is poor.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a method for co-expressing the gp10A and gp9 genes of T7 bacteriophage by using a single plasmid and forming T7 bacteriophage virus-like particles through self-assembly in an escherichia coli BL21(DE3) strain.
The invention is realized in such a way that a single plasmid-based T7 phage virus-like particle self-assembly method comprises the following steps:
transferring into Escherichia coli BL21(DE3), inducing, expressing, self-assembling in vivo, and primarily purifying to obtain T7 phage virus-like particles;
wherein the expression plasmid pRSFDuet-1-gp9-gp10A contains a T7 phage capsid protein coding gene gp10A and a T7 phage scaffold protein coding gene gp 9.
Further, the method for self-assembling the T7 bacteriophage virus-like particle based on the single plasmid comprises the following steps:
step one, synthesizing T7 bacteriophage gp9 and gp10A genes
The function is as follows: provides the "raw material" for the self-assembly of the T7 bacteriophage virus-like particle.
Step two, constructing T7 phage virus-like particle expression plasmids and bacterial strains;
the function is as follows: provides a "place" for the self-assembly of the T7 bacteriophage virus-like particle.
Step three, induction, expression and in vivo self-assembly of T7 phage virus-like particles;
the function is as follows: provides a "catalyst" for the self-assembly of the T7 bacteriophage virus-like particle.
Step four, primary purification of the T7 phage virus-like particles;
the function is as follows: impurity interference is eliminated, and the observation of the T7 phage virus-like particles is facilitated.
And step five, observing the T7 phage virus-like particles by an electron microscope.
The function is as follows: self-assembled T7 phage virus-like particles were identified.
Further, in step one, the nucleic acid sequence of gp9 is SEQ ID NO: 1, the nucleic acid sequence of gp10A is SEQ ID NO: 2.
further, in step two, the construction of the T7 phage virus-like particle expression plasmid and strain includes:
(1) inserting the synthesized gp9 gene sequence into BamH I and Sac I restriction endonuclease sites of pRSFDuet-1 plasmid MCS 1 to obtain an expression plasmid containing a T7 bacteriophage gp9 gene, which is named as pRSFDuet-1-gp 9;
(2) inserting the synthesized gp10A gene sequence into Nde I and Xho I restriction endonuclease sites of pRSFDuet1-gp9 plasmid MCS 2 to obtain a T7 phage virus-like particle expression plasmid, which is named as pRSFDuet-1-gp9-gp 10A;
(3) pRSFDuet-1-gp9-gp10A was transformed into E.coli BL21(DE3) to obtain a T7 phage virus-like particle expression strain, which was designated TT-103.
Further, in step three, the induction, expression and in vivo self-assembly of the T7 phage virus-like particle comprises:
(1) the TT-103 strain is inoculated in an LB solid culture medium containing kanamycin (the final concentration is 0.1mg/mL), and single colony is obtained at 37 ℃ for 18-24 h;
(2) selecting TT-103 single colony, inoculating into 10mL LB liquid culture solution containing kanamycin (final concentration is 0.1mg/mL), culturing at 180rpm/min and 37 ℃ overnight;
(3) taking 5mL of the bacterial liquid cultured in the step (2), adding 500mL of LB liquid culture solution containing kanamycin (the final concentration is 0.1mg/mL), culturing at the temperature of 37 ℃ at 180rpm/min until OD600 is about 0.5, adding isopropyl-BETA-D-thiogalactoside (IPTG) with the final concentration of 0.1mM, inducing at the temperature of 30 ℃ at 100rpm/min for 4 hours;
(4) after induction is finished, centrifuging for 20min at 4 ℃ at 18000g/min, collecting thalli, washing for 2 times by using Phosphate Buffer Solution (PBS) with the same volume, and then suspending the thalli in PBS containing 1mM PMSF protease inhibitor;
(5) carrying out high-pressure homogenizing and crushing on the thallus suspension prepared in the step (4), wherein the set pressure is 600bar, the treatment time is 12min, and the homogenizing temperature is 4 ℃; then, the mixture is centrifuged for 20min at 18000g/min and 4 ℃, and precipitates and supernatant are collected;
(6) and (3) determining the bacterial liquid not induced in the step (3) and the bacterial high-pressure homogeneous precipitation and the target protein in the supernatant of the bacterial body obtained in the step (5) by SDS-PAGE. (see FIG. 2)
Further, in step four, the preliminary purification of the T7 phage virus-like particle comprises:
(1) and (3) centrifuging 35% (w/v) of sucrose cushion buffer at an ultra-high speed, wherein the volume of the sucrose buffer and the supernatant is 1: 2, 100000g, centrifuging for 1h at 4 ℃, collecting supernatant, and suspending the precipitate by using buffer solution A; wherein the buffer A contains 20mM Tris-HCl, 250mM KCl and has the pH value of 4.0.
(2) The target proteins in the supernatant and the precipitate collected in step (1) were determined by SDS-PAGE. (see FIG. 2)
Further, in the fifth step, the electron microscope observation of the T7 phage virus-like particle includes:
20ul of sample was dropped on a copper mesh, negatively stained with 3% phosphotungstic acid and excess stain was aspirated, dried, and analyzed by transmission electron microscopy.
By combining all the technical schemes, the invention has the advantages and positive effects that: the invention provides a single plasmid-based T7 phage virus-like particle self-assembly method, aims to perfect a T7 phage virus-like particle self-assembly method, and provides a new strategy for preparing T7 phage virus-like particles, which comprises the following steps: a single plasmid is utilized to co-express genes of T7 bacteriophage gp10A and gp9 in escherichia coli BL21(DE3) to form virus-like particles with uniform size, determined components and similar shapes to T7 bacteriophage, and a foundation is laid for the subsequent construction of a vector vaccine or a targeted drug based on the T7 bacteriophage virus-like particles.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments of the present invention will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without creative efforts.
FIG. 1 is a flow chart of a method for self-assembly of T7 phage virus-like particles based on single plasmid according to an embodiment of the present invention.
FIG. 2 is a SDS-PAGE electrophoresis chart showing the results of the centrifugation of the uninduced cells, the high-pressure homogenized precipitates and supernatant, and the 35% sucrose cushion buffer at ultra high speed.
FIGS. 3(a) -3 (c) are schematic diagrams of the observation results of the T7 phage virus-like particle by electron microscopy, provided by the example of the present invention;
in the figure: the arrow head is divided into T7 phage virus-like particle electron microscope pictures.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
In view of the problems of the prior art, the present invention provides a method for self-assembly of T7 bacteriophage virus-like particles based on single plasmid, which is described in detail below with reference to the accompanying drawings.
As shown in FIG. 1, the self-assembly method of the T7 bacteriophage virus-like particle based on single plasmid provided by the embodiment of the invention comprises the following steps:
s101, synthesizing T7 phage gp9 and gp10A genes;
s102, constructing a T7 phage virus-like particle pRSFDuet-1-gp9-gp10A expression plasmid and a strain;
s103, induction, expression and in vivo self-assembly of the T7 phage virus-like particles;
s104, primary purification of the T7 phage virus-like particles;
s105, electron microscopy of the T7 phage virus-like particles.
The technical solution of the present invention will be further described with reference to the following explanation of terms.
Virus-like particles (VLPs) are a particulate material of proteins assembled from one or more viral proteins and having a Virus-like morphology, lacking genetic material within it, being incapable of replication and therefore not infectious.
The technical solution of the present invention is further described below with reference to specific examples. The specific experimental conditions and methods are not noted in the examples and are generally performed according to conventional conditions or conditions recommended by the manufacturer.
The invention co-expresses T7 bacteriophage Gp10A and Gp9 genes on pRSFDuet-1 plasmid, and the T7 bacteriophage virus-like particle with single capsid protein (Gp10A) is formed by self-assembly in Escherichia coli BL21(DE3) strain. Therefore, the present invention aims to perfect the self-assembly method of T7 phage virus-like particle, and provide a new strategy for preparing T7 phage virus-like particle, namely: the single plasmid is utilized to co-express genes of T7 bacteriophage gp10A and gp9 in escherichia coli BL21(DE3) to form virus-like particles with uniform size, determined components and similar shapes to T7 bacteriophage, and a foundation is laid for the subsequent construction of a vector vaccine or a targeted drug based on the T7 bacteriophage virus-like particles.
First, synthesizing T7 bacteriophage gp9 and gp10A genes
The target sequence is:
1.gp9：
atggctgaatctaatgcagacgtatatgcatcttttggcgtgaactccgctgtgatgtctggtggttccgttgaggaac atgagcagaacatgctggctcttgatgttgctgcccgtgatggcgatgatgcaatcgagttagcgtcagacgaagtggaaa cagaacgtgacctgtatgacaactctgacccgttcggtcaagaggatgacgaaggccgcattcaggttcgtatcggtgatg gctctgagccgaccgatgtggacactggagaagaaggcgttgagggcaccgaaggttccgaagagtttaccccactgg gcgagactccagaagaactggtagctgcctctgagcaacttggtgagcacgaagagggcttccaagagatgattaacatt gctgctgagcgtggcatgagtgtcgagaccattgaggctatccagcgtgagtacgaggagaacgaagagttgtccgccg agtcctacgctaagctggctgaaattggctacacgaaggctttcattgactcgtatatccgtggtcaagaagctctggtgga gcagtacgtaaacagtgtcattgagtacgctggtggtcgtgaacgttttgatgcactgtataaccaccttgagacgcacaac cctgaggctgcacagtcgctggataatgcgttgaccaatcgtgacttagcgaccgttaaggctatcatcaacttggctggtg agtctcgcgctaaggcgttcggtcgtaagccaactcgtagtgtgactaatcgtgctattccggctaaacctcaggctaccaa gcgtgaaggctttgcggaccgtagcgagatgattaaagctatgagtgaccctcggtatcgcacagatgccaactatcgtcg tcaagtcgaacagaaagtaatcgattcgaacttctga
2.gp10A：
Atggctagcatgactggtggacagcaaatgggtactaaccaaggtaaaggtgtagttgctgctggagataaactg gcgttgttcttgaaggtatttggcggtgaagtcctgactgcgttcgctcgtacctccgtgaccacttctcgccacatggtacgt tccatctccagcggtaaatccgctcagttccctgttctgggtcgcactcaggcagcgtatctggctccgggcgagaacctc gacgataaacgtaaggacatcaaacacaccgagaaggtaatcaccattgacggtctcctgacggctgacgttctgatttat gatattgaggacgcgatgaaccactacgacgttcgctctgagtatacctctcagttgggtgaatctctggcgatggctgcgg atggtgcggttctggctgagattgccggtctgtgtaacgtggaaagcaaatataatgagaacatcgagggcttaggtactg ctaccgtaattgagaccactcagaacaaggccgcacttaccgaccaagttgcgctgggtaaggagattattgcggctctga ctaaggctcgtgcggctctgaccaagaactatgttccggctgctgaccgtgtgttctactgtgacccagatagctactctgc gattctggcagcactgatgccgaacgcagcaaactacgctgctctgattgaccctgagaagggttctatccgcaacgttat gggctttgaggttgtagaagttccgcacctcaccgctggtggtgctggtaccgctcgtgagggcactactggtcagaagca cgtcttccctgccaataaaggtgagggtaatgtcaaggttgctaaggacaacgttatcggcctgttcatgcaccgctctgcg gtaggtactgttaagctgcgtgacttggctctggagcgcgctcgccgtgctaacttccaagcggaccagattatcgctaagt acgcaatgggccacggtggtcttcgcccagaagctgctggtgcagtggttttcaaagtggagtaa。
second, construct T7 phage virus-like particle expression plasmid and bacterial strain
1. The synthesized gp9 gene was inserted into BamH I and Sac I restriction sites of pRSFDuet-1 plasmid MCS 1, designated pRSFDuet-1-gp 9;
2. inserting the synthesized gp10A gene into Nde I and Xho I restriction endonuclease sites of pRSFDuet1-gp9 plasmid MCS 2 to obtain a T7 phage virus-like particle expression plasmid, which is named as pRSFDuet-1-gp9-gp 10A;
3. pRSFDuet-1-gp9-gp10A was transformed into E.coli BL21(DE3) to obtain a T7 phage virus-like particle expression strain, which was designated TT-103.
Third, induction, expression, in vivo self-assembly of T7 phage virus-like particle
Inoculating the TT-103 strain to an LB solid culture medium containing kanamycin (the final concentration is 0.1mg/mL), and carrying out treatment at 37 ℃ for 18-24 h to obtain a single colony;
2. selecting TT-103 single colony, inoculating into 10mL LB liquid culture solution containing kanamycin (final concentration is 0.1mg/mL), culturing at 180rpm/min and 37 ℃ overnight;
3. adding 5mL of the bacterial liquid cultured in the step 2 into 500mL of LB liquid culture solution containing kanamycin (the final concentration is 0.1mg/mL), culturing at the speed of 180rpm/min and 37 ℃ until the OD600 is about 0.5, adding isopropyl-BETA-D-thiogalactoside (IPTG) with the final concentration of 0.1mM, and inducing at the speed of 100rpm/min and the temperature of 30 ℃ for 4 hours;
4. after induction is finished, centrifuging for 20min at 4 ℃ at 18000g/min, collecting thalli, washing for 2 times by using Phosphate Buffer Solution (PBS) with the same volume, and then suspending the thalli in PBS containing 1mM PMSF protease inhibitor;
5. carrying out high-pressure homogenization and crushing on the thallus suspension prepared in the step 4, wherein the set pressure is 600bar, the treatment time is 12min, and the homogenization temperature is 4 ℃; then, 18000g/min, 4 ℃, centrifuging for 20min, and collecting the supernatant of the precipitate;
6. and (3) determining the bacterial liquid which is not induced in the step (3), the thalli high-pressure homogeneous precipitation obtained in the step (5) and the target protein in the supernatant by SDS-PAGE. (see FIG. 2) SDS-PAGE electrophoresis: lane 1 uninduced cells; lane 2 high pressure homogeneous pellet; lane 3, high pressure homogenized supernatant; lane 4: 35% sucrose post-pad supernatant; lane 5 post-pad precipitation with 35% sucrose; note: the size of the protein expressed by the gp10A gene is about 36.6 kDa; the protein expressed by the gp9 gene has a size of about 33.9 kDa.
Fourth, preliminary purification of T7 phage virus-like particles
1.35% sucrose cushion buffer (w/v) ultracentrifugation, sucrose buffer to supernatant volume ratio 1: 2, 100000g, 4 ℃, 1h, collecting supernatant, and suspending the precipitate by using buffer solution A; wherein the buffer A contains 20mM Tris-HCl, 250mM KCl and has the pH value of 4.0.
2. The target proteins in the supernatant and pellet collected in step 1 were determined by SDS-PAGE. (see FIG. 2)
Fifthly, electron microscope observation of the T7 phage virus-like particle, as shown in figure 3(a) -figure 3(c)
20ul of sample was dropped on a copper mesh, negatively stained with 3% phosphotungstic acid and excess stain was aspirated, dried, and analyzed by transmission electron microscopy.
The key points and points to be protected of the invention include: 1) the self-assembly of T7 phage virus-like particle, the virus-like particle is obtained by the constructed expression plasmid pRSFDuet-1-gp9-gp10A through induction, expression, in vivo self-assembly and preliminary purification; 2) the expression plasmid pRSFDuet-1-gp9-gp10A contains a T7 phage capsid protein gp10A gene; 3) the expression plasmid pRSFDuet-1-gp9-gp10A contains a T7 phage scaffold protein gp9 gene; 4) the T7 bacteriophage virus-like particle can be used as a chimeric virus-like particle vaccine and a targeting drug carrier.
According to the invention, the capsid protein Gp10A and the scaffold protein Gp9 are successfully expressed by pRSFDuet-1-Gp9-Gp10A, and the virus-like particles which are uniform in size, determined in components and similar to T7 phage in shape are assembled, so that a foundation is laid for the subsequent construction of a vector vaccine or a targeted drug based on the T7 phage virus-like particles.
The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.
Gene sequence table
<110> Sichuan university
<120> a single plasmid-based T7 phage virus-like particle self-assembly method
<160>2
<210>1
<211>924
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atggctgaatctaatgcagacgtatatgcatcttttggcgtgaactccgctgtgatgtctggtggttccgttgaggaac atgagcagaacatgctggctcttgatgttgctgcccgtgatggcgatgatgcaatcgagttagcgtcagacgaagtggaaa cagaacgtgacctgtatgacaactctgacccgttcggtcaagaggatgacgaaggccgcattcaggttcgtatcggtgatg gctctgagccgaccgatgtggacactggagaagaaggcgttgagggcaccgaaggttccgaagagtttaccccactgg gcgagactccagaagaactggtagctgcctctgagcaacttggtgagcacgaagagggcttccaagagatgattaacatt gctgctgagcgtggcatgagtgtcgagaccattgaggctatccagcgtgagtacgaggagaacgaagagttgtccgccg agtcctacgctaagctggctgaaattggctacacgaaggctttcattgactcgtatatccgtggtcaagaagctctggtgga gcagtacgtaaacagtgtcattgagtacgctggtggtcgtgaacgttttgatgcactgtataaccaccttgagacgcacaac cctgaggctgcacagtcgctggataatgcgttgaccaatcgtgacttagcgaccgttaaggctatcatcaacttggctggtg agtctcgcgctaaggcgttcggtcgtaagccaactcgtagtgtgactaatcgtgctattccggctaaacctcaggctaccaa gcgtgaaggctttgcggaccgtagcgagatgattaaagctatgagtgaccctcggtatcgcacagatgccaactatcgtcg tcaagtcgaacagaaagtaatcgattcgaacttctga
<210>2
<211>1038
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
atggctagcatgactggtggacagcaaatgggtactaaccaaggtaaaggtgtagttgctgctggagataaactgg cgttgttcttgaaggtatttggcggtgaagtcctgactgcgttcgctcgtacctccgtgaccacttctcgccacatggtacgtt ccatctccagcggtaaatccgctcagttccctgttctgggtcgcactcaggcagcgtatctggctccgggcgagaacctcg acgataaacgtaaggacatcaaacacaccgagaaggtaatcaccattgacggtctcctgacggctgacgttctgatttatg
Gene sequence table
atattgaggacgcgatgaaccactacgacgttcgctctgagtatacctctcagttgggtgaatctctggcgatggctgcgga tggtgcggttctggctgagattgccggtctgtgtaacgtggaaagcaaatataatgagaacatcgagggcttaggtactgct accgtaattgagaccactcagaacaaggccgcacttaccgaccaagttgcgctgggtaaggagattattgcggctctgact aaggctcgtgcggctctgaccaagaactatgttccggctgctgaccgtgtgttctactgtgacccagatagctactctgcga ttctggcagcactgatgccgaacgcagcaaactacgctgctctgattgaccctgagaagggttctatccgcaacgttatgg gctttgaggttgtagaagttccgcacctcaccgctggtggtgctggtaccgctcgtgagggcactactggtcagaagcacg tcttccctgccaataaaggtgagggtaatgtcaaggttgctaaggacaacgttatcggcctgttcatgcaccgctctgcggt aggtactgttaagctgcgtgacttggctctggagcgcgctcgccgtgctaacttccaagcggaccagattatcgctaagtac gcaatgggccacggtggtcttcgcccagaagctgctggtgcagtggttttcaaagtggagtaa
<110> Sichuan university
<120> a single plasmid-based T7 phage virus-like particle self-assembly method
<160>2
<210>1
<211>924
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atggctgaatctaatgcagacgtatatgcatcttttggcgtgaactccgctgtgatgtctggtggttccgttgaggaacatgagcagaacatgctggctcttgatgttgctgcccgtgatggcgatgatgcaatcgagttagcgtcagacgaagtggaaacagaacgtgacctgtatgacaactctgacccgttcggtcaagaggatgacgaaggccgcattcaggttcgtatcggtgatggctctgagccgaccgatgtggacactggagaagaaggcgttgagggcaccgaaggttccgaagagtttaccccactgggcgagactccagaagaactggtagctgcctctgagcaacttggtgagcacgaagagggcttccaagagatgattaacattgctgctgagcgtggcatgagtgtcgagaccattgaggctatccagcgtgagtacgaggagaacgaagagttgtccgccgagtcctacgctaagctggctgaaattggctacacgaaggctttcattgactcgtatatccgtggtcaagaagctctggtggagcagtacgtaaacagtgtcattgagtacgctggtggtcgtgaacgttttgatgcactgtataaccaccttgagacgcacaaccctgaggctgcacagtcgctggataatgcgttgaccaatcgtgacttagcgaccgttaaggctatcatcaacttggctggtgagtctcgcgctaaggcgttcggtcgtaagccaactcgtagtgtgactaatcgtgctattccggctaaacctcaggctaccaagcgtgaaggctttgcggaccgtagcgagatgattaaagctatgagtgaccctcggtatcgcacagatgccaactatcgtcgtcaagtcgaacagaaagtaatcgattcgaacttctga
<210>2
<211>1038
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atggctagcatgactggtggacagcaaatgggtactaaccaaggtaaaggtgtagttgctgctggagataaactggcgttgttcttgaaggtatttggcggtgaagtcctgactgcgttcgctcgtacctccgtgaccacttctcgccacatggtacgttccatctccagcggtaaatccgctcagttccctgttctgggtcgcactcaggcagcgtatctggctccgggcgagaacctcgacgataaacgtaaggacatcaaacacaccgagaaggtaatcaccattgacggtctcctgacggctgacgttctgatttatgatattgaggacgcgatgaaccactacgacgttcgctctgagtatacctctcagttgggtgaatctctggcgatggctgcggatggtgcggttctggctgagattgccggtctgtgtaacgtggaaagcaaatataatgagaacatcgagggcttaggtactgctaccgtaattgagaccactcagaacaaggccgcacttaccgaccaagttgcgctgggtaaggagattattgcggctctgactaaggctcgtgcggctctgaccaagaactatgttccggctgctgaccgtgtgttctactgtgacccagatagctactctgcgattctggcagcactgatgccgaacgcagcaaactacgctgctctgattgaccctgagaagggttctatccgcaacgttatgggctttgaggttgtagaagttccgcacctcaccgctggtggtgctggtaccgctcgtgagggcactactggtcagaagcacgtcttccctgccaataaaggtgagggtaatgtcaaggttgctaaggacaacgttatcggcctgttcatgcaccgctctgcggtaggtactgttaagctgcgtgacttggctctggagcgcgctcgccgtgctaacttccaagcggaccagattatcgctaagtacgcaatgggccacggtggtcttcgcccagaagctgctggtgcagtggttttcaaagtggagtaa
Claims (9)
1. A method for self-assembly of a single plasmid-based T7 phage virus-like particle, comprising:
constructing an expression plasmid pRSFDuet-1-gp9-gp10A, transferring into escherichia coli BL21(DE3), and obtaining T7 phage virus-like particles through induction, expression, in-vivo self-assembly and primary purification;
wherein the expression plasmid pRSFDuet-1-gp9-gp10A contains a T7 phage capsid protein coding gene gp10A and a T7 phage scaffold protein coding gene gp 9.
2. The method of claim 1, wherein the steps comprise:
synthesizing T7 phage gp9 and gp10A genes;
secondly, constructing T7 phage virus-like particle pRSFDuet-1-gp9-gp10A expression plasmid and strain;
step three, induction, expression and in vivo self-assembly of T7 phage virus-like particles;
step four, primary purification of the T7 phage virus-like particles;
and step five, observing the T7 phage virus-like particles by an electron microscope.
3. The method for self-assembling a single plasmid-based T7 phage virus-like particle of claim 2, wherein in step one, the nucleic acid sequence of the gp9 gene of T7 phage is SEQ ID NO: 1, the nucleic acid sequence of the gp10A gene is SEQ ID NO: 2.
4. the method for self-assembly of a single-plasmid-based T7 phage virus-like particle according to claim 2, wherein in step two, the construction of the expression plasmid and strain for the T7 phage virus-like particle pRSFDuet-1-gp9-gp10A comprises:
(1) inserting the synthesized gp9 gene sequence into BamH I and Sac I restriction endonuclease sites of pRSFDuet-1 plasmid MCS 1 to obtain an expression plasmid containing a T7 bacteriophage gp9 gene, which is named as pRSFDuet-1-gp 9;
(2) inserting the synthesized gp10A gene sequence into Nde I and Xho I restriction endonuclease sites of pRSFDuet1-gp9 plasmid MCS 2 to obtain a T7 phage virus-like particle expression plasmid, which is named as pRSFDuet-1-gp9-gp 10A;
(3) pRSFDuet-1-gp9-gp10A was transformed into E.coli BL21(DE3) to obtain a T7 phage virus-like particle expression strain, which was designated TT-103.
5. The method for self-assembly of T7 phage virus-like particles based on single plasmid as claimed in claim 2, wherein the step three, the induction, expression, self-assembly in vivo of the T7 phage virus-like particle expression strain comprises:
(1) the TT-103 strain is inoculated in an LB solid culture medium containing kanamycin (the final concentration is 0.1mg/mL), and single colony is obtained at 37 ℃ for 18-24 h;
(2) selecting TT-103 single colony, inoculating into 10mL LB liquid culture solution containing kanamycin (final concentration is 0.1mg/mL), culturing at 180rpm/min and 37 ℃ overnight;
(3) taking 5mL of the bacterial liquid cultured in the step (2), adding 500mL of LB liquid culture solution containing kanamycin (the final concentration is 0.1mg/mL), culturing at 180rpm/min and 37 ℃ until OD600 is about 0.5, adding isopropyl-beta-D-thiogalactoside isopropyl-BETA-D-thiogalactoside (IPTG) with the final concentration of 0.1mM, 100rpm/min and 30 ℃, and inducing for 4 hours;
(4) after induction is finished, centrifuging for 20min at 4 ℃ at 18000g/min, collecting thalli, washing for 2 times by using Phosphate Buffer Solution (PBS) with the same volume, and then suspending the thalli in PBS containing 1mM PMSF protease inhibitor;
(5) carrying out high-pressure homogenizing and crushing on the thallus suspension prepared in the step (4), wherein the set pressure is 600bar, the treatment time is 12min, and the homogenizing temperature is 4 ℃; subsequently, the mixture is centrifuged for 20min at 18000g/min and 4 ℃, and precipitates and supernatant are collected;
(6) and (3) determining the bacterial liquid not induced in the step (3) and the bacterial high-pressure homogeneous precipitation and the target protein in the supernatant of the bacterial body obtained in the step (5) by SDS-PAGE.
6. The method for self-assembling single-plasmid based T7 phage virus-like particles of claim 2, wherein in step four, the preliminary purification of T7 phage virus-like particles comprises:
(1) and (3) carrying out ultra-high speed centrifugation on 35% (w/v) sucrose cushion buffer solution, wherein the volume ratio of the sucrose buffer solution to the supernatant is 1: 2,100000 g, centrifuging at 4 ℃ for 1h, collecting supernatant, and suspending the precipitate with buffer solution A; wherein the buffer A comprises 20mM Tris-HCl, 250mM KCl, and the pH value is 4.0;
(2) the target proteins in the supernatant and the precipitate collected in step (1) were determined by SDS-PAGE.
7. The method for self-assembling T7 phage virus-like particles based on single plasmid as claimed in claim 2, wherein in step five, the electron microscope observation of the T7 phage virus-like particles comprises: 20ul of sample was dropped on a copper mesh, negatively stained with 3% phosphotungstic acid and excess stain was aspirated, dried, and analyzed by transmission electron microscopy.
8. The T7 phage virus-like particle obtained by the method for inducing and expressing self-assembly of the virus-like particle based on the gp10A gene and the gp9 gene mediated simple substance particles according to any one of claims 1 to 7.
9. Use of the T7 phage virus-like particle of claim 8 in the preparation of chimeric virus-like particle vaccines and targeted drug vectors.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111456514.4A CN114369610B (en) | 2021-12-01 | 2021-12-01 | T7 bacteriophage virus-like particle self-assembly method based on single plasmid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111456514.4A CN114369610B (en) | 2021-12-01 | 2021-12-01 | T7 bacteriophage virus-like particle self-assembly method based on single plasmid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114369610A true CN114369610A (en) | 2022-04-19 |
| CN114369610B CN114369610B (en) | 2023-01-31 |
Family
ID=81139712
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111456514.4A Active CN114369610B (en) | 2021-12-01 | 2021-12-01 | T7 bacteriophage virus-like particle self-assembly method based on single plasmid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114369610B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115261340A (en) * | 2022-05-20 | 2022-11-01 | 四川大学 | GH-1 phage virus-like particle, preparation method and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101921733A (en) * | 2010-01-05 | 2010-12-22 | 华中科技大学同济医学院附属协和医院 | Preparation method and application of Qbeta-2aa phage virus-like particle protein |
| CN102337251A (en) * | 2011-06-24 | 2012-02-01 | 华中科技大学同济医学院附属协和医院 | Chimaera for HK97 bacteriophage virus-like particle and application of chimaera |
| CN110157723A (en) * | 2019-05-10 | 2019-08-23 | 四川大学 | Application of the one step homologous recombination method in the necessary gene knockout of Salmonella typhimurtum |
| CN113462699A (en) * | 2021-06-16 | 2021-10-01 | 长春工业大学 | Preparation of virus-like particles autonomously assembled by using escherichia coli to express cat fine VP2 protein |
-
2021
- 2021-12-01 CN CN202111456514.4A patent/CN114369610B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101921733A (en) * | 2010-01-05 | 2010-12-22 | 华中科技大学同济医学院附属协和医院 | Preparation method and application of Qbeta-2aa phage virus-like particle protein |
| CN102337251A (en) * | 2011-06-24 | 2012-02-01 | 华中科技大学同济医学院附属协和医院 | Chimaera for HK97 bacteriophage virus-like particle and application of chimaera |
| CN110157723A (en) * | 2019-05-10 | 2019-08-23 | 四川大学 | Application of the one step homologous recombination method in the necessary gene knockout of Salmonella typhimurtum |
| CN113462699A (en) * | 2021-06-16 | 2021-10-01 | 长春工业大学 | Preparation of virus-like particles autonomously assembled by using escherichia coli to express cat fine VP2 protein |
Non-Patent Citations (2)
| Title |
|---|
| CERRITELLI ME, STUDIER FW.: "Assembly of T7 capsids from independently expressed and purified head protein and scaffolding protein", 《JOURNAL OF MOLECULAR BIOLOGY》 * |
| 徐悦等: "T7 噬菌体p10 融合蛋白表达及自组装VLP观察", 《江西农业学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115261340A (en) * | 2022-05-20 | 2022-11-01 | 四川大学 | GH-1 phage virus-like particle, preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114369610B (en) | 2023-01-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9523101B2 (en) | Protein and nucleic acid delivery vehicles, components and mechanisms thereof | |
| US9187765B2 (en) | In vitro and In vivo delivery of genes and proteins using the bacteriophage T4 DNA packaging machine | |
| EP4019636A1 (en) | Processes using vlps with capsids resistant to hydrolases | |
| CN108611359B (en) | Preparation method and application of porcine circovirus type 3 virus-like particles | |
| CN109528653B (en) | Membrane vesicle with gene editing function and preparation method, pharmaceutical composition and application thereof | |
| JP2022512617A (en) | Simultaneous surface expression vector of two target proteins using two promoters derived from Lactobacillus casei, and microbial surface expression method of protein using this | |
| CN114369610B (en) | T7 bacteriophage virus-like particle self-assembly method based on single plasmid | |
| Hou et al. | Construction of Lactobacillus casei ghosts by Holin-mediated inactivation and the potential as a safe and effective vehicle for the delivery of DNA vaccines | |
| CN114480441B (en) | Nucleotide sequence and application of recombinant protein nanoparticles expressed by nucleotide sequence in canine distemper virus vaccine | |
| CN116323944B (en) | Phage-based artificial virus design for human genome remodeling | |
| CN113462699A (en) | Preparation of virus-like particles autonomously assembled by using escherichia coli to express cat fine VP2 protein | |
| CN111303251B (en) | Method for in-vitro assembly of foot-and-mouth disease virus-like particles and application thereof | |
| WO2023165467A1 (en) | Ferritin nanocage vector loaded with small nucleic acid drug in inner cavity and use | |
| CN110846326A (en) | Raccoon parvovirus VP2 gene, expression vector, recombinant strain, method for preparing VP2 protein and assembly method | |
| Yang et al. | Exploration on the expression and assembly of virus-like particles | |
| CN116376948B (en) | Plasmid vector and preparation method of MS2 phage similar particles for displaying exogenous proteins | |
| CN113388585B (en) | Phage high-titer culture method and application | |
| CN115927214B (en) | Method for efficiently changing phage preparation host range based on double-element system and application thereof | |
| CN116355937A (en) | Preparation method of double targeting minicell nano-carrier | |
| WO2023221938A1 (en) | Protein-encapsulated self-replicating rna and preparation method therefor | |
| CN115028744B (en) | Foot-and-mouth disease virus VP1 chimeric nanoparticle and preparation method and application thereof | |
| WO2023061338A1 (en) | Extracellular vesicle induced by coronavirus envelope protein e, and preparation method for extracellular vesicle and application thereof | |
| CN109851661B (en) | Recombinant virus capsid structural protein and preparation method and application thereof | |
| CN115261340A (en) | GH-1 phage virus-like particle, preparation method and application | |
| CN117106810A (en) | MS2 virus-like particle, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |