CN114369152B

CN114369152B - Preparation and application of recombinant chicken interleukin-9 protein and antibody thereof

Info

Publication number: CN114369152B
Application number: CN202210076793.XA
Authority: CN
Inventors: 商绍彬; 贺双江; 郝小利; 杨奕
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2022-01-24
Filing date: 2022-01-24
Publication date: 2023-11-21
Anticipated expiration: 2042-01-24
Also published as: CN114369152A

Abstract

The invention relates to a recombinant chicken interleukin-9 protein and preparation and application of an antibody thereof, and aims to solve the technical problems of preparing recombinant chicken IL-9 prokaryotic protein and eukaryotic protein with biological functions and measuring the biological activity of the recombinant chicken IL-9 prokaryotic protein and eukaryotic protein. The invention also aims to solve the technical problems of preparing monoclonal and polyclonal antibodies for detecting chicken IL-9. And the antibodies are used for detecting the natural IL-9 protein expressed by immune cells in chicken bodies. The invention successfully solves the problem of difficult recombinant expression of chicken IL-9 cytokines, and the recombinant chicken IL-9 protein has biological activities of activating chicken macrophages and promoting chicken T cell proliferation, which indicates that the recombinant chicken IL-9 protein has an immune enhancement function. The chicken IL-9 protein and antibody are easy to produce in large quantities, and are convenient to apply to basic research of chicken raising industry and poultry immunology in later period.

Description

Preparation and application of recombinant chicken interleukin-9 protein and antibody thereof

Technical Field

The invention relates to a recombinant chicken interleukin-9 protein and preparation and application of an antibody thereof, in particular to recombinant protein expression, monoclonal and polyclonal antibody preparation and application thereof, belonging to the fields of poultry immunology, biological products and diagnostic reagents.

Background

Interleukin-9 (IL-9) is a pleiotropic cytokine belonging to the gamma-chain receptor cytokine family [1 ] with IL-2, IL-4, IL-7, IL-15 and IL-21]. IL-9 was originally found to be a growth factor secreted by Th2 type T cells, but was later found to be secreted primarily by Th9 type T cells [2, 3]]The method comprises the steps of carrying out a first treatment on the surface of the In addition to Th17, regulatory T cells, CD8 ⁺ IL-9[4 is secreted by T cells, natural killer cells, mast cells, and congenital lymphoid cells]. IL-9 can act on mast cells, B cells, T cells, hematopoietic progenitor cells, macrophages, DC cells, etc. [5 ]]. Although chicken IL-9 gene is annotated in the whole genome of chicken, its biological function is still blank at the protein level yet to be identified; the key reasons are the very difficult recombinant expression of chicken cytokines and the lack of immunological tools for specifically detecting chicken IL-9 proteins.

In humans and mice, the IL-9 gene encodes a glycoprotein consisting of 144 amino acids with a molecular weight of 14kD, comprising an 18 amino acid signal peptide. However, the native IL-9 protein is highly glycosylated and has a molecular weight between about 32 and 39kD [3]. In contrast, the chicken IL-9 gene coding region comprises 417 bases, encodes 138 amino acids, comprises a 20 amino acid signal peptide and 3 glycosylation sites. However, the true molecular weight of native chicken IL-9 is currently unknown due to the lack of corresponding detection tools.

IL-9 has a variety of functions in humans or mice. IL-9 induces autoimmune diseases such as inflammatory bowel disease, multiple sclerosis, rheumatoid arthritis, etc., and plays a role in allergic diseases such as food allergy and asthma [6]. In terms of cancer, IL-9 has a pro-tumor effect on hematological tumors and solid tumors, but exerts anti-tumor activity on melanoma, IL-9 and Th9 cells [7]. Furthermore, IL-9 has been shown to modulate immune responses or exert protective effects following bacterial, viral and parasitic infections [8]. The fowl infectious diseases such as Marek's disease, infectious bursal disease, infectious bronchitis, etc. plagued the healthy development of chicken industry in China, whether chicken IL-9 has immunoregulatory function, promote the development of fowl infectious disease vaccine and have to be studied intensively.

In the invention, we disclose a preparation method of chicken IL-9 eukaryotic and prokaryotic recombinant proteins with biological functions; and chicken IL-9 murine monoclonal antibody and rabbit polyclonal antibody were prepared. The prepared monoclonal antibody or polyclonal antibody can be used for detecting the chicken IL-9 natural protein by Western blot and other techniques. The preparation and the acquisition of the recombinant chicken IL-9 protein, the monoclonal antibody and the polyclonal antibody provide important tools and means for developing chicken IL-9 as immunopotentiator, adjuvant, novel poultry disease vaccine and basic research of poultry immunology.

Disclosure of Invention

The invention aims to solve the defects of the prior art and provide the preparation and application of recombinant chicken interleukin-9 protein and antibodies thereof; the invention aims to solve the technical problems of preparing recombinant chIL-9 prokaryotic protein and eukaryotic protein with biological functions and measuring the biological activity of the recombinant chIL-9 prokaryotic protein and eukaryotic protein. The invention also aims to solve the technical problem of preparing monoclonal and polyclonal antibodies for detecting chicken chIL-9. And the antibodies are used for detecting the natural chIL-9 protein expressed by immune cells in chickens.

The invention is realized by the following technical scheme: a prokaryotic expression method for preparing recombinant chicken IL-9 protein includes such steps as constructing the chicken IL-9 gene without signal peptide to prokaryotic expression carrier pET-32a, and expressing the recombinant plasmid (pET-32 a-chIL-9) by transform colibacillus to obtain soluble recombinant chicken IL-9 protein.

A prokaryotic expression method for preparing recombinant chicken IL-9 protein, wherein the nucleic acid sequence of chicken IL-9 gene without signal peptide is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2;

the recombinant chicken IL-9 protein has biological activity, and the recombinant chicken IL-9 protein and a chicken macrophage line are co-cultured to activate macrophages to generate inflammatory cytokines; the recombinant chicken IL-9 protein and the isolated chicken spleen cells are co-cultured for 5 days, so that proliferation of chicken T cells can be promoted.

The recombinant chicken IL-9 protein can be used as an immunopotentiator for improving the immunity of poultry, in particular chicken; can be used as an adjuvant for the development and application of vaccines for poultry, in particular chicken infectious diseases.

A eukaryotic expression method for preparing recombinant chicken IL-9 protein, the complete chicken IL-9 gene is constructed into eukaryotic expression vector pEGFP-C, recombinant plasmid (pEGFP-chIL-9) transfects DF-1 cell, obtain secretory expression recombinant chicken IL-9 protein, and have biological activity;

the nucleic acid sequence of the complete chicken IL-9 gene is shown as SEQ ID NO.3, and the amino acid sequence is shown as SEQ ID NO. 4;

co-culturing recombinant chicken IL-9 protein and chicken macrophage cell line to activate macrophage cell to produce inflammatory cell factor; the recombinant chicken IL-9 protein and the isolated chicken spleen cells are co-cultured for 5 days, so that proliferation of chicken T cells can be promoted.

An anti-chicken IL-9 protein monoclonal antibody 4H7, wherein the monoclonal antibody 4H7 can specifically bind to IL-9 protein expressed by chicken immune cells; can specifically recognize the IL-9 natural protein expressed by chicken mononuclear cells activated by phorbol ester and ionomycin.

Immunizing BALB/c mice with the recombinant chicken IL-9 protein, and screening the eukaryotic expression chicken IL-9 protein to obtain a monoclonal antibody cell strain, namely a hybridoma cell strain 4H7;

the hybridoma cell strain 4H7 is preserved in China center for type culture collection, and the addresses are as follows: chinese university of armed chinese; the preservation date is 2022, 1 month and 19 days; the preservation number is CCTCC NO: C202225.

A method for preparing anti-chicken IL-9 protein rabbit-derived polyclonal antibody, immunizing New Zealand white rabbits with the recombinant chicken IL-9 protein, and obtaining antiserum capable of recognizing eukaryotic expressed chicken IL-9 protein and activated chicken mononuclear cell expressed IL-9 natural protein.

The application of the anti-chicken IL-9 protein monoclonal antibody 4H7 is used for detecting the expression of chicken IL-9 through Western-blot, ELISA, indirect immunofluorescence and flow cytometry after being marked by fluorescein or enzyme.

The polyclonal antibody is used for detecting the expression of chicken IL-9 through Western-blot, ELISA, indirect immunofluorescence and flow cytometry after being labeled by fluorescein or enzyme.

The method is advanced and scientific, and the invention provides the preparation and application of recombinant chicken interleukin-9 protein and antibody thereof, and pET-32a-chIL-9 and pEGFP-C-chIL-9 plasmids are constructed, and chIL-9 recombinant protein is expressed in ROSETTA bacteria and DF-1 cells respectively; the effect of recombinant chIL-9 on chicken macrophage activation and T cell proliferation was detected by qPCR and CFSE staining methods, respectively. Recombinant chIL-9 prokaryotic protein immunized BALB/c mice are subjected to three times, spleen and SP2/0 cells are fused, positive hybridoma cells are screened, chIL-9 eukaryotic protein identification is carried out on antibodies secreted by different hybridoma cell strains, ascites fluid is prepared, purified antibodies are prepared, and the reactivity of the different antibodies with chIL-9 natural proteins is measured by a western blot technology.

The beneficial effects are that:

the invention successfully solves the problem of difficult recombinant expression of chicken IL-9 cytokines, and the recombinant chIL-9 protein has biological activities of activating chicken macrophages and promoting chicken T cell proliferation, which indicates that the recombinant chIL-9 protein has an immune enhancement function. The invention successfully prepares anti-chIL-9 monoclonal and polyclonal antibodies, and can efficiently and specifically identify chIL-9 natural proteins. The invention fills the blank of biological function and immunodetection knowledge and technology of chicken IL-9 protein, and provides effective tools and biological agents for the application of chIL-9 in chicken immunosuppressive diseases. The chIL-9 protein and the antibody are easy to produce in large quantities, and are convenient for later application in basic research of chicken raising industry and poultry immunology.

Drawings

FIG. 1 shows construction of pET-32a-chIL-9 plasmid, including chIL-9PCR amplification (a), plasmid map (b) and plasmid restriction enzyme identification (c); m, DNA Marker; chIL-9;2 pET-32a-chIL-9 plasmid double enzyme cutting product.

FIG. 2 shows chIL-9 prokaryotic expression (a), protein purification (b), renaturation, tag protein excision (c); a, M is Prestained Protein Ladder; control group cleavage supernatant 2: IPTG group lysate supernatant 3.Control group lysate pellet 4.IPTG group lysate pellet. b, M is Prestained Protein Ladder;5 IPTG group cleavage pellet 6: purified Trx-chIL-9 protein. c, drawing M, prestained Protein Ladder;7 chIL-9 after tev enzyme cleavage.

FIG. 3 shows construction of pEGFP-C-chIL-9 plasmid, including chIL-9PCR amplification (a), plasmid map (b) and plasmid restriction enzyme identification (C); m is DNA Marker 1:chIL-9-CDS; pEGFP-C-chIL-9 plasmid double cleavage products.

FIG. 4 is an identification of eukaryotic expression of chIL-9, including ICC (a) and western blot (b); panel a, A, pEGFP-C+ negative serum B, pEGFP-C+ chIL-9 polyclonal serum C: pEGFP-C-chul-9 + negative serum D: pEGFP-C-chIL-9+chIL-9 polyclonal antisera. Panel b, M: prestained Protein Ladder 1: pEGFP-C transfected DF-1 2: pEGFP-C-chIL-9 transfected DF-1.3 pEGFP-C transfected DF-1 culture supernatant 4 pEGFP-C-chIL-9 transfected DF-1 culture supernatant.

FIG. 5 is a graph showing the effect of recombinant chIL-9 eukaryotic proteins on the production of inflammatory factors by monocytes; a, the effect of chIL-9 on the production of HD11 inflammatory factors; panel b, effect of chIL-9 on primary monocyte inflammatory factor growth.

FIG. 6 is a recombinant chIL-9 protein versus CD3 ⁺ The effects of T cell proliferation include prokaryotic and eukaryotic recombinant chIL-9 proteins.

FIG. 7 is the recognition of eukaryotic expression of chIL-9 by 4chIL-9 mAbs.

FIG. 8 is a graph showing the response of chIL-9 murine mab and rabbit polyclonal antibody to native chIL-9 protein.

Detailed Description

For a complete understanding and appreciation of the invention, a detailed description of the invention will be provided below with reference to the accompanying examples and drawings.

EXAMPLE 1 preparation of chIL-9 recombinant protein

chIL-9 prokaryotic protein expression

Because the adaptability of chicken gene codons and escherichia coli hosts is low, the cloned chIL-9 nucleotide sequence (shown as SEQ ID NO. 1) without signal peptide is optimized into codons with higher use frequency of escherichia coli. PCR primers were designed using Primer5.0 software, and the cleavage sites BamHI and XhoI and tev protease were introduced, amplified by RT-PCR, cloned into the prokaryotic expression vector pET-32a (FIG. 1), and finally transformed into the ROSETTA expression host strain.

PCR primer sequences (SEQ ID NOS: 5 and 6):

F:5’-CGGGATCC(BamHI)GAGAACCTGTACTTCCAAGGG(tev)CAGAATTGCCAGGTT-3’

R:5’-CCGCTCGAG(XhoI)TCACACGCGGCTTTTAT-3’.

after the recombinant plasmid containing the target gene is transformed into the ROSETTA host bacterium, the recombinant plasmid is induced by IPTG in a small amount, and bacterial lysis supernatant proteins and mycoproteins are respectively extracted; SDS-PAGE analysis shows that the recombinant fusion protein of chIL-9 is expressed in a large amount in bacterial lysis precipitation. Taking 300mL of bacterial liquid, carrying out mass induction by IPTG, carrying out ice bath ultrasonic treatment for 20-30 min, centrifuging to remove supernatant, carrying out suspension and dispersion precipitation on 10mL of 8M urea, carrying out ultrasonic treatment under ice bath for 10min, centrifuging, and collecting supernatant. Purifying his-tag protein under denaturing conditions according to the specification of the Ni Sepharose column, dialyzing the purified protein with a gradient urea buffer solution, and concentrating and measuring the protein concentration. Cleavage of the trx tag with tev enzyme gives rise to a chIL-9 prokaryotic recombinant protein of about 18kD (FIG. 2).

chIL-9 eukaryotic protein expression

Chicken spleen mononuclear cells are taken, stimulated by PMA/Iono+BFA for 6 hours, RNA is extracted, and reverse transcription is carried out to obtain cDNA as a template. Designing a primer according to the sequence of the full-length coding region of the chIL-9 gene (shown as SEQ ID NO. 3), adding a T2A peptide sequence at the front end of the upstream primer, introducing EcoRI and BamHI enzyme cutting sites, performing RT-PCR amplification, cloning to pEGFP-C plasmid (figure 3), and finally extracting the ultra-pure plasmid.

PCR primer sequences (SEQ ID NOS.7 and 8):

F:5’-CCGGAATTC(EcoRI)GGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCTATGAATGCCAGCATGCTG-3’

R:5’-CGGGATCC(BamHI)TTAAACTCTAGATTTATG-3’

the plasmid of interest was transfected into DF-1 cells and, as detected by cytoimmunochemistry (ICC) and Western blot, recombinant chIL-9 protein was produced at 25kD in both DF-1 cells and in culture supernatants (FIG. 4).

EXAMPLE 2 biological function of chIL-9 recombinant protein

Activation of chicken macrophages by chIL-9 recombinant eukaryotic proteins

The test selects chicken HD11 macrophage line and primary macrophage after chicken peripheral blood mononuclear cell adhesion to detect the function of chIL-9 recombinant protein. The control group added pEGFP-C plasmid transfection supernatant, the chIL-9 group added pEGFP-C-chIL-9 plasmid transfection supernatant, and the LPS group as positive control; RNA was extracted after 6h of action, reverse transcribed into cDNA, and qPCR was performed to detect changes in the key activators IL-1. Beta., IL-6 and iNOS of macrophages. The results in FIG. 5 show that recombinant eukaryotic chIL-9 can activate chicken macrophages to produce inflammatory factors.

Proliferation of chicken T cells by chIL-9 recombinant protein

In the test, chicken Peripheral Blood Mononuclear Cells (PBMC) are selected as target cells to detect proliferation of chIL-9 recombinant protein on T cells. After the PBMC is stained with CFSE, the chicken IL-2 (100 ng/mL) and chIL-9 recombinant protein (100 ng/mL) are added for five days, and then SPRD-CD3 and FVD eFluor 780 are stained. Flow cytometry results indicated (FIG. 6) that recombinant chIL-9 can promote proliferation of chicken T cells.

EXAMPLE 3 preparation of chIL-9 murine monoclonal antibody

The main steps of the preparation of the monoclonal antibody are as follows: mouse immunity, cell fusion, hybridoma cell screening, cell monoclonalization, antibody identification, ascites preparation and purification.

1. Screening of positive hybridoma cells

A6 week old female BALB/c mouse was selected, 40. Mu.g of prokaryotic expressed chIL-9 was mixed with Freund's adjuvant and emulsified. The mice are immunized three times by intraperitoneal injection, each immunization is divided into two weeks, 7 days later, tail vein blood sampling is carried out to determine the titer, then the immunization is enhanced, the spleen cells of the mice are taken after three days, fused with SP2/0 cells under the action of 50 percent PEG-1500 and added into feeder cells containing HAT culture medium, and the mixture is placed at 37 ℃ and 5 percent CO ₂ In a cell incubator. Half-changing after 5 days, and changing into DMEM complete culture solution containing HT after 10 days.

Positive wells in 5 96-well plates are determined by ELISA, positive hybridoma wells are subcloned for 2-3 times by limiting dilution, and finally the positive hybridoma wells are expanded for culture and frozen for storage. And collecting monoclonal antibody hybridoma cell culture supernatant, and carrying out subclass identification according to the mouse antibody subtype identification kit.

2. Monoclonal antibody ascites preparation and purification method

Selecting about 10 weeks old BALB/c mice, inoculating 0.5mL pristane in the abdominal cavity, inoculating PBS diluted hybridoma cells in the abdominal cavity after 7-10 days, the cell number is 5×10 ⁵ /only. After 7 days, the abdomen swells, the abdominal cavity collects the ascites, the ascites is centrifuged to remove sediment every two days, the supernatant is collected, the titer is measured and the obtained product is stored at the temperature of minus 70 ℃. Ascites were purified using Protein a+g.

EXAMPLE 4 preparation and purification of chIL-9 Rabbit polyclonal antibodies

100 μg of prokaryotic expression chIL-9 is mixed with complete Freund's adjuvant and emulsified, and the New Zealand white rabbits are immunized by subcutaneous multipoint injection; and boosting twice with an emulsion of recombinant prokaryotic chIL-9 and incomplete freund's adjuvant, each time two weeks apart; and 7 days later, carrying out intravenous blood sampling, measuring titer, then carrying out booster immunization (200 mug), three days later, carrying out intravenous blood sampling, obtaining antisera, and purifying rabbit serum by using Protein A+G, thus finally obtaining the chIL-9 rabbit polyclonal antibody.

EXAMPLE 5chIL-9 monoclonal antibody and Rabbit polyclonal antibody reactivity with eukaryotic expressed chIL-9

The pEGFP-C-chIL-9 plasmid is transfected into DF-1 cells, the culture solution is discarded after 48 hours, PBS is used for washing twice, ice-cold acetone-ethanol mixed solution (3:2) is used for fixation, after the mixture is blocked for 1 hour by 2% BSA at room temperature, different hybridoma cell culture supernatants, igG1, kappa subtype irrelevant mouse monoclonal antibody (control) and rabbit polyclonal antibody (pAb) are incubated, the mixture is incubated overnight at 4 ℃, PBST is used for washing 3 times, HRP-conjugated anti-mouse or anti-rabit antibody is incubated at room temperature for 1 hour, PBST is used for washing 3 times, AEC color development solution is added for reaction for 15 minutes, and coloring condition is observed under the condition of bright field. The results (FIG. 7, table 1) show that different chIL-9 monoclonal antibodies and rabbit polyclonal antibodies all react with eukaryotic chIL-9, and that monoclonal antibody 4H7 and other 3-strain monoclonal antibodies are of the IgG1, kappa subtype.

EXAMPLE 6 reactivity of chIL-9 monoclonal antibodies and Rabbit polyclonal antibodies with native chIL-9

And (3) extracting protein from chicken PBMC after being stimulated by PMA/Iono+BFA for 6 hours, adding 5×loading buffer, and boiling for 10 minutes to obtain the chIL-9 natural protein sample. Performing SDS-PAGE electrophoresis on each histone, transferring onto PVDF membrane, sealing 5% skim milk at room temperature for 1h, incubating different monoclonal antibodies and rabbit polyclonal antibodies (1:1000) at 4 ℃ overnight, washing with TBST solution for 3 times, incubating HRP goat anti-mouse secondary antibody (1:8000) at 37 ℃ for 1h, washing with TBST for 3 times, and adding luminescent solution for development. The results in FIG. 8 show that different monoclonal and rabbit polyclonal antibodies react with the native chIL-9 protein, approximately 25kDa in size.

TABLE 1 identification of chIL-9 murine monoclonal antibody subtype and determination of ascites titer

Reference is made to:

1.Noelle,R.J.and E.C.Nowak,Celular sources and immune functions of interleukin-9.Nature Reviews Immunology,2010.10(10):p.683-687.

2.Veldhoen,M.,et al.,Transforming growth factor-beta'reprograms'the diferentiation of T helper 2 cels and promotes an interleukin 9-producing subset.Nature Immunology,2008.9(12):p.1341-1346.

3.Stassen,M.,E.Schmitt,and T.Bopp,From interleukin-9 to T helper 9 cels.Year in Immunology,2012.1247:p.56-68.

4.Thi,V.,et al.,Crosstalk between the Producers and Immune Targets of IL-9.Immune Network,2020.20(6).

5.Goswami,R.and M.H.Kaplan,A Brief History of IL-9.Journal of Immunology,2011.186(6):p.3283-3288.

6.Deng,Y.X.,et al.,Th9 cels and IL-9 in autoimmune disorders:Pathogenesis and therapeutic potentials.Human Immunology,2017.78(2):p.120-128.

7.Wan,J.,et al.,IL-9 and IL-9-producing cels in tumor immunity.Cell Communication and Signaling,2020.18(1).

8.Dodd,J.S.,et al.,IL-9 Regulates Pathology during Primary and Memory Responses to Respiratory Syncytial Virus Infection.Journal of Immunology,2009.183(11):p.7006-7013.

sequence listing

<110> university of Yangzhou

<120> preparation and application of recombinant chicken interleukin-9 protein and antibody thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 357

<212> DNA

<213> chicken (Gallus galus)

<400> 1

cagaattgcc aagtcagcga aattatccgc aatacaagga gtctgcttaa caagactcaa 60

gaaagttgcc catgtaggga gacagctgcc actccttgtt catgtcttcc catccctgag 120

cctggccatg aactggcatg ctttgtggaa ggaaccaagc acatgttgga gcacaacatg 180

acttcaaaca taaaacttct tctgcttaat cagtccttcc agattcaacg ggatagaaac 240

ctctgtgaaa gtctgacacg tggaaaaaaa tgcgagtaca agaccaaggg aactgtgagg 300

acgtttctgg aaaaaatcct gaaaacctat caggaaatcc ataaatctag agtttaa 357

<210> 2

<211> 118

<212> PRT

<213> chicken (Gallus galus)

<400> 2

Gln Asn Cys Gln Val Ser Glu Ile Ile Arg Asn Thr Arg Ser Leu Leu

1 5 10 15

Asn Lys Thr Gln Glu Ser Cys Pro Cys Arg Glu Thr Ala Ala Thr Pro

20 25 30

Cys Ser Cys Leu Pro Ile Pro Glu Pro Gly His Glu Leu Ala Cys Phe

35 40 45

Val Glu Gly Thr Lys His Met Leu Glu His Asn Met Thr Ser Asn Ile

50 55 60

Lys Leu Leu Leu Leu Asn Gln Ser Phe Gln Ile Gln Arg Asp Arg Asn

65 70 75 80

Leu Cys Glu Ser Leu Thr Arg Gly Lys Lys Cys Glu Tyr Lys Thr Lys

85 90 95

Gly Thr Val Arg Thr Phe Leu Glu Lys Ile Leu Lys Thr Tyr Gln Glu

100 105 110

Ile His Lys Ser Arg Val

115

<210> 3

<211> 417

<212> DNA

<213> chicken (Gallus galus)

<400> 3

atgaatgcca gcatgctgtc atacattctc ctctcttgtg tgctgctctc tgtgcaagca 60

cagaattgcc aagtcagcga aattatccgc aatacaagga gtctgcttaa caagactcaa 120

gaaagttgcc catgtaggga gacagctgcc actccttgtt catgtcttcc catccctgag 180

cctggccatg aactggcatg ctttgtggaa ggaaccaagc acatgttgga gcacaacatg 240

acttcaaaca taaaacttct tctgcttaat cagtccttcc agattcaacg ggatagaaac 300

ctctgtgaaa gtctgacacg tggaaaaaaa tgcgagtaca agaccaaggg aactgtgagg 360

acgtttctgg aaaaaatcct gaaaacctat caggaaatcc ataaatctag agtttaa 417

<210> 4

<211> 138

<212> PRT

<213> chicken (Bacillus) and method for producing the same

<400> 4

Met Asn Ala Ser Met Leu Ser Tyr Ile Leu Leu Ser Cys Val Leu Leu

1 5 10 15

Ser Val Gln Ala Gln Asn Cys Gln Val Ser Glu Ile Ile Arg Asn Thr

20 25 30

Arg Ser Leu Leu Asn Lys Thr Gln Glu Ser Cys Pro Cys Arg Glu Thr

35 40 45

Ala Ala Thr Pro Cys Ser Cys Leu Pro Ile Pro Glu Pro Gly His Glu

50 55 60

Leu Ala Cys Phe Val Glu Gly Thr Lys His Met Leu Glu His Asn Met

65 70 75 80

Thr Ser Asn Ile Lys Leu Leu Leu Leu Asn Gln Ser Phe Gln Ile Gln

85 90 95

Arg Asp Arg Asn Leu Cys Glu Ser Leu Thr Arg Gly Lys Lys Cys Glu

100 105 110

Tyr Lys Thr Lys Gly Thr Val Arg Thr Phe Leu Glu Lys Ile Leu Lys

115 120 125

Thr Tyr Gln Glu Ile His Lys Ser Arg Val

130 135

<210> 5

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

cgggatccga gaacctgtac ttccaagggc agaattgcca ggtt 44

<210> 6

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

ccgctcgagt cacacgcggc ttttat 26

<210> 7

<211> 90

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ccggaattcg gaagcggaga gggcagagga agtctgctaa catgcggtga cgtcgaggag 60

aatcctggac ctatgaatgc cagcatgctg 90

<210> 8

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

cgggatcctt aaactctaga tttatg 26

Claims

1. An anti-chicken IL-9 protein monoclonal antibody 4H7, wherein the monoclonal antibody 4H7 can specifically bind to IL-9 protein expressed by chicken immune cells; the natural IL-9 protein expressed by chicken mononuclear cells activated by phorbol ester and ionomycin can be specifically identified;

2. The use of the anti-chicken IL-9 protein monoclonal antibody 4H7 of claim 1 for non-diagnostic and therapeutic purposes, wherein the antibody is labeled with fluorescein or an enzyme for Western blot, ELISA, indirect immunofluorescence and flow cytometry to detect chicken IL-9 expression.