CN114350828B - Specific primer for amplifying Pantoea ananatis and application thereof - Google Patents
Specific primer for amplifying Pantoea ananatis and application thereof Download PDFInfo
- Publication number
- CN114350828B CN114350828B CN202210074694.8A CN202210074694A CN114350828B CN 114350828 B CN114350828 B CN 114350828B CN 202210074694 A CN202210074694 A CN 202210074694A CN 114350828 B CN114350828 B CN 114350828B
- Authority
- CN
- China
- Prior art keywords
- pantoea ananatis
- detection
- specific primer
- primer
- pcr reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000588696 Pantoea ananatis Species 0.000 title claims abstract description 61
- 238000001514 detection method Methods 0.000 claims abstract description 55
- 238000006243 chemical reaction Methods 0.000 claims abstract description 31
- 238000000034 method Methods 0.000 claims abstract description 22
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 12
- 230000003321 amplification Effects 0.000 claims abstract description 11
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 11
- 238000004925 denaturation Methods 0.000 claims description 8
- 230000036425 denaturation Effects 0.000 claims description 8
- 239000000203 mixture Substances 0.000 claims description 6
- 238000000137 annealing Methods 0.000 claims description 5
- TWRXJAOTZQYOKJ-UHFFFAOYSA-L Magnesium chloride Chemical compound [Mg+2].[Cl-].[Cl-] TWRXJAOTZQYOKJ-UHFFFAOYSA-L 0.000 claims description 4
- 108010006785 Taq Polymerase Proteins 0.000 claims description 3
- 229910001629 magnesium chloride Inorganic materials 0.000 claims description 2
- 239000004973 liquid crystal related substance Substances 0.000 claims 2
- 244000052769 pathogen Species 0.000 abstract description 10
- 230000001717 pathogenic effect Effects 0.000 abstract description 7
- 201000010099 disease Diseases 0.000 abstract description 6
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 abstract description 6
- 208000035143 Bacterial infection Diseases 0.000 abstract description 5
- 208000015181 infectious disease Diseases 0.000 abstract description 5
- 238000011835 investigation Methods 0.000 abstract description 4
- 230000005540 biological transmission Effects 0.000 abstract description 3
- 239000000047 product Substances 0.000 description 14
- 238000012408 PCR amplification Methods 0.000 description 11
- 238000003753 real-time PCR Methods 0.000 description 9
- 241000196324 Embryophyta Species 0.000 description 8
- 241000520272 Pantoea Species 0.000 description 7
- 230000001580 bacterial effect Effects 0.000 description 7
- 239000013642 negative control Substances 0.000 description 7
- 239000000126 substance Substances 0.000 description 7
- 241000209094 Oryza Species 0.000 description 6
- 235000007164 Oryza sativa Nutrition 0.000 description 6
- 239000013641 positive control Substances 0.000 description 6
- 235000009566 rice Nutrition 0.000 description 6
- 244000052616 bacterial pathogen Species 0.000 description 5
- 241000894007 species Species 0.000 description 5
- 244000099147 Ananas comosus Species 0.000 description 4
- 235000007119 Ananas comosus Nutrition 0.000 description 4
- 239000006228 supernatant Substances 0.000 description 4
- 238000012360 testing method Methods 0.000 description 4
- 241000894006 Bacteria Species 0.000 description 3
- 235000008708 Morus alba Nutrition 0.000 description 3
- 239000003550 marker Substances 0.000 description 3
- 230000035945 sensitivity Effects 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 240000000249 Morus alba Species 0.000 description 2
- 240000008042 Zea mays Species 0.000 description 2
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 description 2
- 235000002017 Zea mays subsp mays Nutrition 0.000 description 2
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 235000005822 corn Nutrition 0.000 description 2
- 238000007865 diluting Methods 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 238000007689 inspection Methods 0.000 description 2
- 239000002773 nucleotide Substances 0.000 description 2
- 125000003729 nucleotide group Chemical group 0.000 description 2
- 238000012257 pre-denaturation Methods 0.000 description 2
- 238000002791 soaking Methods 0.000 description 2
- 238000012795 verification Methods 0.000 description 2
- -1 /or Species 0.000 description 1
- 108020004465 16S ribosomal RNA Proteins 0.000 description 1
- 235000010149 Brassica rapa subsp chinensis Nutrition 0.000 description 1
- 235000000536 Brassica rapa subsp pekinensis Nutrition 0.000 description 1
- 241000499436 Brassica rapa subsp. pekinensis Species 0.000 description 1
- 241001135516 Burkholderia gladioli Species 0.000 description 1
- 241000207199 Citrus Species 0.000 description 1
- 241000588914 Enterobacter Species 0.000 description 1
- 241000588698 Erwinia Species 0.000 description 1
- 241000218231 Moraceae Species 0.000 description 1
- 238000002944 PCR assay Methods 0.000 description 1
- 241000588912 Pantoea agglomerans Species 0.000 description 1
- 241001499142 Pantoea eucrina Species 0.000 description 1
- 241000589516 Pseudomonas Species 0.000 description 1
- 241000983652 Ralstonia pseudosolanacearum Species 0.000 description 1
- 241000907138 Xanthomonas oryzae pv. oryzae Species 0.000 description 1
- 241000626572 Xanthomonas oryzae pv. oryzicola Species 0.000 description 1
- 244000273928 Zingiber officinale Species 0.000 description 1
- 235000006886 Zingiber officinale Nutrition 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 244000000005 bacterial plant pathogen Species 0.000 description 1
- 239000012295 chemical reaction liquid Substances 0.000 description 1
- 235000020971 citrus fruits Nutrition 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000013399 early diagnosis Methods 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 235000008397 ginger Nutrition 0.000 description 1
- 208000019622 heart disease Diseases 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 239000002245 particle Substances 0.000 description 1
- 230000007918 pathogenicity Effects 0.000 description 1
- 239000013612 plasmid Substances 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 239000008223 sterile water Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific primer for amplifying Pantoea ananatis and application thereof, and belongs to the technical field of molecular detection. The specific primer for amplifying the Pantoea ananatis is provided, and the upstream primer sequence of the specific primer is shown as SEQ ID NO. 1; the downstream primer sequence of the specific primer is shown as SEQ ID NO. 2. The application method comprises the following steps: extracting DNA of a sample to be detected as a template, carrying out PCR reaction by using a specific primer, taking an amplification product of the PCR reaction for detection, and if a DNA band with the molecular weight of 182 and bp exists, proving that the sample to be detected contains Pantoea ananatis. The application method has the advantages of accuracy, rapidness, simplicity, easiness in operation and the like, and can identify the pathogen in the early stage of disease infection; the method can be used for field investigation and detection of plant products, has important significance for controlling large-area outbreaks and trans-regional transmission of various bacterial diseases caused by Pantoea ananatis, and provides technical guidance and theoretical support for detection of other pathogens.
Description
Technical Field
The invention belongs to the technical field of molecular detection, and particularly relates to a specific primer for amplifying Pantoea ananatis and application thereof.
Background
Pantoea ananatis (L.) Var. AzalPantoea ananatis) Can cause various bacterial diseases such as stem rot, corn bacterial brown rot, succulent plant bacterial brown rot, citrus wilt, chinese cabbage dry-burned heart disease, ginger bacterial yellow leaf spot and the like of riceHarmful effects occur in Liaoning, jilin, zhejiang, guangdong, anhui, hebei and other provinces in China in recent years, and the method has strong infectivity, high pathogenicity and great harm, and causes serious yield reduction of crops. At present, the types of pathogenic bacteria can be determined by separating pathogenic bacteria from samples (leaves, seeds, stems and the like), extracting DNA from strains and sequencing by using a 16s rDNA universal primer. However, the method has long time consumption, low specificity and high requirements on technicians, and is difficult to rapidly and accurately detect the pathogenic bacteria.
The prior art is as follows, for example, chinese patent application number: CN201810205789.2, publication No.: CN108342498A discloses a PCR detection method of pantoea ananatis, which comprises the following technical contents:
a PCR detection method of Pantoea ananatis uses genomic DNA of Pantoea ananatis as a PCR reaction template to carry out PCR reaction; the PCR reaction system is as follows: 10 XPCR Buffer 2.5. Mu.L; 10mM dNTP 1.0. Mu.L; 10mM upstream primer PanITS2-1F 1.0. Mu.L; 10mM downstream primer PanITS2-1R 1.0. Mu.L; template DNA 1.0. Mu.L; 2.5U/mL Taq enzyme 0.5. Mu.L; ddH 2 O18.0 μL; the reaction conditions are as follows: pre-denaturation at 94℃for 3 min, denaturation at 94℃for 30 s, annealing at 50℃for 15 s, elongation at 72℃for 25 s,25 cycles; the upstream primer PanITS2-1F is: 5'-TCGCCTGATTATACAATCTCACCTTCA-3'; the downstream primer PanITS2-1R is as follows: 5'-GTGGGTTGTGAGGTTAAGCGACTAA-3'. The invention is based on Pantoea ananatisPantoea ananatisThe specific primer pair PanITS2-1F/PanITS2-1R of the strain is designed, the primers can distinguish Pantoea ananatis from other plant pathogenic bacteria, a PCR detection method developed based on the primers can be used for rapidly detecting Pantoea ananatis, the method can rapidly, specifically and accurately detect Pantoea ananatis in plant materials, and a method is provided for early diagnosis, quarantine and early warning of diseases of corn bacterial spot diseases, and can also provide a method for rapid detection of the strain in other environments.
For another example, chinese invention patent, application number: CN201910441478.0, publication No.: CN110184365B discloses a group of PCR detection primers and application of bacterial wilt pathogen pineapple pantoea of mulberry, the technical content is as follows:
"PCR detection primer of Pantoea ananatis, its nucleotide sequence is as shown in SEQ ID NO: 1-2.
tagtactgcaggatgccgtccca(SEQ ID NO：1)；
ggcgttgtcactggtgatgacgt(SEQ ID NO：2)。
The invention further claims the application of the PCR detection primer in detection of the bacterial wilt of the pineapple pantoea and/or the mulberry. Meanwhile, the invention claims the application of the PCR detection primer in preparing a detection kit for the pantoea ananatis and/or bacterial wilt of mulberries. The invention also discloses a detection kit for Pantoea ananatis, which comprises the detection primer. Preferably, reagents for the PCR reaction are also included. Preferably, the reagent of the PCR reaction is 2×Taq Master Mix. Preferably, it also includes ddH 2 O. More preferably, the detection kit comprises a PCR reaction system of 2×Taq Master Mix 10 μl, and a nucleotide sequence shown in SEQ ID NO: 1-2 (10. Mu.M) each 0.5. Mu.L of the primer, 2. Mu.L of the sample DNA to be tested, ddH 2 O makes up 25. Mu.L. Preferably, the detection kit, the PCR reaction is as follows: pre-denaturation at 94℃for 4 min; denaturation at 94 ℃ for 1 min, annealing at 60 ℃ and extension at 72 ℃ for 2 min, and 32 cycles; extending at 72℃for 3 min. Most preferably, a detection kit for Pantoea ananatis comprises the above detection primer, 2×Taq Master mix and ddH 2 O”。
For example, chinese patent application number: CN202110909246.0, publication No.: CN113604590a discloses a fluorescent quantitative PCR detection method and a kit for the plant pathogenic bacteria pantoea ananatis, the technical contents are as follows:
the kit consists of PCR reaction enzyme premix, a pineapple pantoea specific upstream primer, a pineapple pantoea specific downstream primer, a positive control and a negative control; the upstream primer is TATCCGCGCCTTTGTTGAGT; the downstream primer is ATGCCGTCTTTCTCGGTTGA. The fluorescent quantitative PCR detection kit for the plant pathogenic bacteria Pantoea ananatis, whereinThe positive control adopts a designed and synthesized positive standard substance sequence, which is: 5-TATCCGCGCCTTTGTTGAGTACCTGAATAAAAACAAAACGCCTATTCA CCCAACCGTATTCTATTTCTCAACCGAGAAAGACGGCAT-3. The fluorescent quantitative PCR detection kit for the plant pathogenic bacteria Pantoea ananatis, wherein the positive standard substance sequence is diluted by positive standard quality particles to prepare a positive standard substance gradient when in use, so as to achieve the quantitative effect. The fluorescent quantitative PCR detection kit for the plant pathogenic bacteria Pantoea ananatis comprises the following steps of: taking 10 μl of positive standard plasmid, diluting according to 10 times gradient, and sequentially diluting 4-7 gradients to obtain positive standard gradient. After the preparation of the positive standard substance gradient is completed, performing fluorescent quantitative PCR reaction on the positive standard substance gradient and sample DNA under the same condition, drawing a standard curve by taking the concentration logarithmic value of the positive standard substance gradient as an ordinate and the Ct value of an experimental result as an abscissa, and calculating the concentration of the Pantoea ananatis in the sample according to the Ct value obtained by the sample test. The invention also provides a method for carrying out fluorescent quantitative PCR detection of the plant pathogenic bacteria Pantoea ananatis by the kit, wherein the method comprises the following steps: step 1, extracting genome DNA of a sample to be detected; and 2, taking the genome DNA obtained in the step 1 as a template, setting a positive standard substance control and a negative control, preparing a PCR reaction system with the Pantoea ananatis PCR reaction liquid and the specific primer, and carrying out fluorescent quantitative PCR reaction. The method for performing fluorescent quantitative PCR detection of the plant pathogenic bacteria Pantoea ananatis comprises the following steps of: 1XPCR buffer, 0.2-1. Mu.M each for the upstream and downstream primers, and OD of 1-10 ng/. Mu.l 260 /OD 280 Between 1.7 and 1.9. The method for performing fluorescent quantitative PCR detection of the plant pathogenic bacteria Pantoea ananatis comprises the following steps: the sample was pre-denatured at 95℃for 30 s, denatured at 95℃for 5 s, and then annealed at 60℃for 30 s for 40 cycles.
The prior art described above, analyzed, gave the following problems:
the operation is more complicated, the specificity is poor, especially the detection condition under the condition of similar strains in various same species is poor, and meanwhile, the verification test is lack in the face of the true infection condition of rice seeds.
Disclosure of Invention
Problems to be solved
Aiming at the problems of the detection technology, the invention provides a specific primer for amplifying Pantoea ananatis and application thereof, and the application method of the invention has the advantages of accuracy, rapidness, simplicity, easiness in operation and the like, and can identify the pathogen in the early stage of disease infection; the method can be used for field investigation and detection of plant products, has important significance for controlling large-area outbreaks and trans-regional transmission of various bacterial diseases caused by Pantoea ananatis, and provides technical guidance and theoretical support for detection of other pathogens.
Technical proposal
In order to solve the problems, the invention adopts the following technical scheme.
A specific primer for amplifying Pantoea ananatis,
the upstream primer sequence of the specific primer is shown as SEQ ID NO. 1;
the downstream primer sequence of the specific primer is shown as SEQ ID NO. 2.
The application of the specific primer in detecting the Pantoea ananatis.
In the application of the specific primer in the detection of the Pantoea ananatis,
extracting DNA of a sample to be detected as a template, carrying out PCR reaction by using the specific primer, taking an amplified product of the PCR reaction for detection, and if a DNA band with the molecular weight of 182 and bp exists, proving that the sample to be detected contains Pantoea ananatis.
In the application of the specific primer in the detection of the Pantoea ananatis,
the amplification system of the PCR reaction is as follows:
10×PCR buffer 2.5μL，
25mM MgCl 2 1.5μL，
25mM dNTP 1μL，
20. Mu.M upstream primer 0.5. Mu.L,
20. Mu.M downstream primer 0.5. Mu.L,
5. 5U/. Mu.L Taq DNA polymerase 0.5. Mu.L,
1. Mu.L of the template DNA,
ddH 2 O 17.5μL。
in the application of the specific primer in the detection of the Pantoea ananatis,
the PCR reaction is carried out according to the following reaction procedures:
denaturation at 94℃for 3 min; the mixture enters a cycle of denaturation at 94 ℃ for 30 s, annealing at 58 ℃ for 30 s and extension at 72 ℃ for 30 s and 35 cycles; finally, the extension is carried out for 5 min at 72 ℃.
It should be noted that, for example, a commercially available kit is used, and the kit is appropriately adjusted according to the instructions.
Beneficial effects of
Compared with the prior art, the invention has the beneficial effects that:
the method of combining PCR amplification can effectively detect the Pantoea ananatis in plant tissues by designing a pair of specific primersPantoea ananatisThe method comprises the steps of carrying out a first treatment on the surface of the The method has the advantages of accuracy, rapidness, simplicity, easiness in operation and the like, can detect the pathogen at the early stage of disease infection, can be applied to field investigation and plant product inspection in reference, and has important significance for controlling large-area outbreaks and cross-region spread of various bacterial diseases; meanwhile, the establishment of the system also provides technical guidance and theoretical basis for the detection of other pathogenic bacteria. Meanwhile, by using Pantoea ananatisPantoea ananatisAnd genome of other species, designing a pair of specific primers, and carrying out specific amplification on other pathogenic bacteria by using the primers, wherein only one 182bp band can be obtained from the genus by amplification, and no amplification band appears in other strains, thus indicating that the pair of primers has the specificity among the genus. In addition, high sensitivity is an important indicator of pathogen detection, which relates to the ability to detect rapidlyThe technology is directly applied to inspection and quarantine of plant products, and in a 25 mu L reaction system, the PCR primer can detect 1pg of genome DNA.
Drawings
FIG. 1 is a schematic diagram showing the specificity verification of the primers of the present invention, wherein: m:2000bp marker; -: ddH 2 O, negative control; +: pantoea ananatis, positive control; lanes 1-9: other strains.
FIG. 2 shows the sensitivity of the primers of the invention, wherein: m:2000bp marker; lanes 1-7: template concentrations were 100ng,10ng,1ng,100pg,10pg,1pg,100fg, respectively; -: ddH 2 O, negative control.
FIG. 3 is a PCR assay in Pantoea ananatis in rice seeds, wherein: m:2000bp marker; -: ddH 2 O, negative control; +: PCR amplification product with DNA extracted from Pantoea ananatis as template, positive control; lanes 1-8: PCR amplification products using the seed soaking supernatant as a template.
Detailed Description
The invention is further described below in connection with specific embodiments.
Specific primers for amplifying Pantoea ananatis,
the upstream primer sequence of the specific primer is shown as SEQ ID NO.1 (p 1);
the downstream primer sequence of the specific primer is shown as SEQ ID NO.2 (p 2).
The application of the specific primer in detecting the Pantoea ananatis.
In the application of the specific primer in the detection of the Pantoea ananatis,
extracting DNA of a sample to be detected as a template, carrying out PCR reaction by using the specific primer, taking an amplification product of the PCR reaction for detection, and if DNA bands with the molecular weight of 182bp exist, proving that the sample to be detected contains Pantoea ananatis.
In the application of the specific primer in the detection of the Pantoea ananatis,
the amplification system of the PCR reaction is as follows:
10×PCR buffer 2.5μL，
25mM MgCl2 1.5μL，
25mM dNTP 1μL，
20. Mu.M upstream primer 0.5. Mu.L,
20. Mu.M downstream primer 0.5. Mu.L,
5. 5U/. Mu.L Taq DNA polymerase 0.5. Mu.L,
1. Mu.L of the template DNA,
ddH 2 O 17.5μL。
in the application of the specific primer in the detection of the Pantoea ananatis,
the PCR reaction is carried out according to the following reaction procedures:
denaturation at 94℃for 3 min; the mixture enters a cycle of denaturation at 94 ℃ for 30 s, annealing at 58 ℃ for 30 s and extension at 72 ℃ for 30 s and 35 cycles; finally, the extension is carried out for 5 min at 72 ℃.
Example 1
The strains used in the present invention and the relevant information are shown in Table 1.
TABLE 1 strains used for screening for primer specificity in this example
| Sequence number | Strain | Number of strains | Amplification results with S1/S2 |
| 1 | Pantoea ananatis | 1 | + |
| 2 | Pantoea agglomerans | 1 | - |
| 3 | Pantoea eucrina | 1 | - |
| 4 | Enterobacter roggenkampii | 1 | - |
| 5 | Erwinia carovorum | 1 | - |
| 6 | Xanthomonas oryzae pv. oryzae | 1 | - |
| 7 | Xanthomonas oryzae pv. oryzicola | 1 | - |
| 8 | Burkholderia gladioli | 1 | - |
| 9 | Pseudomonas syringe pv. lachrymans | 1 | - |
| 10 | Ralstonia pseudosolanacearum | 1 | - |
In the table above: + represents a specific amplified band with primer p1/p2, 182bp in length; -indicating no amplification product.
PCR amplification system:
the specific primer designed by the invention is adopted to carry out PCR amplification on genome DNA of all the strains to be tested in the table 1, and the amplified sequence is subjected to agarose gel electrophoresis detection, the detection result is shown in the figure 1, and the figure shows that only the pantoea ananatis can be seenPantoea ananatisOne 182bp band was specifically amplified in the strain, whereas no bands were amplified from the other test strains and the blank. In the figure, lane M is 2000bp, lane ddH 2 The PCR amplified product with O as a template is used as a negative control; lane+ is PCR amplification product using DNA extracted from Pantoea ananatis as templateAs a positive control; lanes 1-9 are other strains. The result shows that the primer has species specificity and can be used for preparing Pantoea ananatisPantoea ananatisFrom other species.
Example 2
As shown in FIG. 2, the sensitivity of the detection system established above was measured in a 25. Mu.L reaction system, and primers p1 and p2 stably amplified a specific band of 182bp from a genomic template of at least 1 pg.
Example 3
Pathogen detection of rice seeds
DNA was extracted from the seed of rice with bacteria and subjected to PCR amplification test.
Sample treatment to be measured: 10 g rice seeds are weighed and placed in a container, 15 mL sterile water is added to submerge the seeds, and after 2 h, the supernatant is sucked to be used as a sample to be detected.
PCR amplification system: the specific primer designed by the invention is adopted to carry out PCR amplification on a sample to be detected, the amplified sequence is subjected to agarose gel electrophoresis detection, the detection result is shown in figure 3, and the specific primer can only specifically amplify a 182 and bp band from supernatant fluid of the seed with bacteria, but cannot amplify the band from other seeds. Lanes M are 2000bp in the figure, -lanes are blank controls without DNA as negative controls; lanes+ are PCR amplification products using DNA extracted from Pantoea ananatis as a template, as positive controls; lanes 1-8: PCR amplification products using the seed soaking supernatant as a template. The result shows that the primer is used for Pantoea ananatis in rice seedsPantoea ananatisIs a rapid molecular assay of (a).
In summary, the invention discloses a specific primer for amplifying Pantoea ananatis, which has specificity, and can specifically amplify a 182bp specific band from genomic DNA of Pantoea ananatis by PCR, but not amplify bands from genomic DNA of other bacteria of different species, so that a set of rapid, efficient, stable and reliable molecular detection method for detecting Pantoea ananatis can be established by using the specific primer. The method has the advantages of accuracy, rapidness, simplicity, easiness in operation and the like, and can identify the pathogen in the early stage of disease infection. The method can be used for field investigation and detection of plant products, has important significance for controlling large-area outbreak and trans-regional transmission of various bacterial diseases caused by Pantoea ananatis, and simultaneously provides technical guidance and theoretical support for detection of other pathogens.
The foregoing is a further elaboration of the present invention in connection with the detailed description, and it is not intended that the invention be limited to the specific embodiments shown, but rather that a number of simple deductions or substitutions be made by one of ordinary skill in the art without departing from the spirit of the invention, should be considered as falling within the scope of the invention as defined in the appended claims.
Sequence listing
<110> institute of plant protection and agricultural product quality safety at the academy of agricultural sciences of Anhui province
<120> a specific primer for amplifying Pantoea ananatis and use thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence (Pantoea ananatis)
<400> 1
tggcgcaatt tacctcatca 20
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (Pantoea ananatis)
<400> 2
acctgcggaa ggcgtaaatc 20
Claims (3)
1. The application of the specific primer in the detection of the Pantoea ananatis is characterized in that,
extracting DNA of a sample to be detected as a template, carrying out PCR reaction by using a specific primer, taking an amplification product of the PCR reaction for detection, and if a DNA band with the molecular weight of 182 and bp exists, proving that the sample to be detected contains Pantoea ananatis; wherein, the liquid crystal display device comprises a liquid crystal display device,
the upstream primer sequence of the specific primer is shown as SEQ ID NO. 1;
the downstream primer sequence of the specific primer is shown as SEQ ID NO. 2.
2. The use of specific primers according to claim 1 in the detection of pantoea ananatis, characterized in that:
the amplification system of the PCR reaction is as follows:
10×PCR buffer 2.5μL，
25mM MgCl2 1.5μL，
25mM dNTP 1μL，
20. Mu.M upstream primer 0.5. Mu.L,
20. Mu.M downstream primer 0.5. Mu.L,
5. 5U/. Mu.L Taq DNA polymerase 0.5. Mu.L,
1. Mu.L of the template DNA,
ddH2 O 17.5μL。
3. the use of specific primers according to claim 2 in the detection of pantoea ananatis, characterized in that:
the PCR reaction is carried out according to the following reaction procedures:
denaturation at 94℃for 3 min; the mixture enters a cycle of denaturation at 94 ℃ for 30 s, annealing at 58 ℃ for 30 s and extension at 72 ℃ for 30 s and 35 cycles; finally, the extension is carried out for 5 min at 72 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210074694.8A CN114350828B (en) | 2022-01-21 | 2022-01-21 | Specific primer for amplifying Pantoea ananatis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210074694.8A CN114350828B (en) | 2022-01-21 | 2022-01-21 | Specific primer for amplifying Pantoea ananatis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114350828A CN114350828A (en) | 2022-04-15 |
| CN114350828B true CN114350828B (en) | 2023-11-03 |
Family
ID=81090673
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210074694.8A Active CN114350828B (en) | 2022-01-21 | 2022-01-21 | Specific primer for amplifying Pantoea ananatis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114350828B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108342498A (en) * | 2018-03-13 | 2018-07-31 | 中国农业科学院饲料研究所 | A kind of PCR detection method of the general bacterium of pineapple |
| CN110184365A (en) * | 2019-05-24 | 2019-08-30 | 华南农业大学 | The PCR detection primer and application of one group of general bacterium of mulberry tree bacterialo wilt disease cause of disease pineapple |
| CN113604590A (en) * | 2021-08-09 | 2021-11-05 | 上海沃吉基因科技有限公司 | Fluorescent quantitative PCR detection method and kit for plant pathogenic bacteria Pantoea ananatis |
-
2022
- 2022-01-21 CN CN202210074694.8A patent/CN114350828B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108342498A (en) * | 2018-03-13 | 2018-07-31 | 中国农业科学院饲料研究所 | A kind of PCR detection method of the general bacterium of pineapple |
| CN110184365A (en) * | 2019-05-24 | 2019-08-30 | 华南农业大学 | The PCR detection primer and application of one group of general bacterium of mulberry tree bacterialo wilt disease cause of disease pineapple |
| CN113604590A (en) * | 2021-08-09 | 2021-11-05 | 上海沃吉基因科技有限公司 | Fluorescent quantitative PCR detection method and kit for plant pathogenic bacteria Pantoea ananatis |
Non-Patent Citations (1)
| Title |
|---|
| TANIA WELLER-STUART.Swimming and twitching motility are essential for attachment and virulence of Pantoea ananatis in onion seedlings.《MOLECULAR PLANT PATHOLOGY》.2016,第18卷(第5期),第734-745页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114350828A (en) | 2022-04-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110777220B (en) | Primer group, probe, RPA test strip kit and identification method | |
| CN106399490B (en) | LAMP primer group for detecting phytoplasma and kit and application thereof | |
| CN113151522A (en) | LFD-RPA technology-based rice bacterial leaf streak germ detection kit, primer probe composition and application thereof | |
| CN111321248A (en) | African swine fever virus MGF-505R gene fluorescence PCR detection reagent, kit and application thereof | |
| CN109868324A (en) | One species-specific primer and its detection method | |
| CN101831506B (en) | Kit for authenticating deletion of vaccine strain and wild strain of PRVgE | |
| CN109439800B (en) | Kit and method for detecting gene mutation of PR region and RT region of HIV-1 gene | |
| CN104745689A (en) | Primers, probe and kit used for detecting bordetella pertussis | |
| CN104830984A (en) | Fluorescence PCR detection method of Colletetrichum orbicalare, and primers and probes used for method | |
| CN114350828B (en) | Specific primer for amplifying Pantoea ananatis and application thereof | |
| CN101875974A (en) | Primer group for detecting Bordetella pertussis, detection test kit and detection method | |
| CN106435007A (en) | Primer, probe, kit and method for detecting bacillus erysipelatos-suis by fluorescent quantitative PCR (Polymerase Chain Reaction) | |
| Sharma et al. | PCR based assay for the detection of Alternaria brassicicola in crucifers | |
| CN116287391A (en) | RPA primer for detecting tobacco target spot disease, primer/probe combination and application thereof | |
| CN106868147B (en) | Molecular detection primer for sigatoka bacteria and rapid detection method thereof | |
| WO2013175365A1 (en) | Extraction control for rna | |
| CN114958835A (en) | Combination product and kit for detecting bacterial rice blight bacteria | |
| CN107460249A (en) | A kind of primer, probe and kit for being used to detect methicillin-resistant staphylococcus aureus drug resistant gene | |
| CN110157836B (en) | Primer, probe and method for detecting IBRV and BVDV | |
| CN113604590A (en) | Fluorescent quantitative PCR detection method and kit for plant pathogenic bacteria Pantoea ananatis | |
| CN103451298B (en) | Kit for detecting physiological races of brussels sprouts wilt pathogens I and II and detection method thereof | |
| CN110923344A (en) | Staphylococcus aureus and methicillin-resistant staphylococcus aureus drug-resistant gene mecA detection kit and application thereof | |
| CN113481310B (en) | LAMP primer group and LAMP kit for detecting ginger rot pathogen and application of LAMP primer group and LAMP kit | |
| CN116064852A (en) | Multiplex PCR detection primer for three rice bacterial diseases and application thereof | |
| CN115725753A (en) | Dual PCR detection primer for two rice bacterial diseases and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |