CN114350782A - Method for positioning gene mutation site - Google Patents
Method for positioning gene mutation site Download PDFInfo
- Publication number
- CN114350782A CN114350782A CN202111675710.0A CN202111675710A CN114350782A CN 114350782 A CN114350782 A CN 114350782A CN 202111675710 A CN202111675710 A CN 202111675710A CN 114350782 A CN114350782 A CN 114350782A
- Authority
- CN
- China
- Prior art keywords
- umi
- nucleic acid
- template
- acid fragment
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention belongs to the technical field of biology, and discloses a method for positioning a gene mutation site, which comprises the following steps: configuring the nucleic acid fragments N1-N2-UMI-N3 into different first microreactors, so that the nucleic acid fragments configured in each first microreactor comprise different UMI tag sequences; configuring each template and nucleic acid fragment N1-N2-UMI-N3 in the sample containing the gene mutation site into a different second microreactor; and amplifying the template to obtain an amplification product, so that the amplification product in a second microreactor carries the same UMI tag sequence, and judging whether the amplification product is from the same template or not by comparing the UMI tag sequences so as to judge the positioning of the gene mutation site on the template, thereby solving the problem that whether different mutation sites are from the same template or not cannot be judged in the sequencing process.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method for positioning a gene mutation site.
Background
Genetic mutations are sudden, heritable variations of genomic DNA molecules. The gene mutation is the main cause of many genetic diseases, with the development of gene sequencing technology, it is possible to obtain specific gene mutation sites by sequencing, and the accurate prediction of the association between the gene mutation sites and the genetic diseases undoubtedly provides a new idea for the diagnosis of the genetic diseases, which needs to be positioned first.
When multiple gene mutations are present in a sample and it is desirable to locate whether they originate from the same template: if the positions of multiple gene mutations on the genome are hundreds of bp apart, first-generation sequencing can judge whether the gene mutations are from the same template; if the positions of multiple gene mutations on the template are thousands to tens of thousands of bp apart, Pacbio third-generation sequencing can judge whether the gene mutations are from the same template, but the market popularity of the Pacbio third-generation sequencer is far less than that of the second-generation sequencer at present, and when the Pacbio third-generation sequencer is used for sequencing a target region to judge the mutation positions, the library building steps are complex, the cost is high, and the initial template investment is high; if the positions of multiple gene mutations on the template reach hundreds of thousands of bp, a relatively mature and accurate method for judging whether the gene mutations are from the same template does not exist. Based on this, it is important to provide a method for locating a gene mutation site.
Disclosure of Invention
The present invention is directed to solving at least one of the problems of the prior art described above. Therefore, the invention provides a method for positioning gene mutation sites, which enables amplification products from different templates to carry different specific molecular labels UMI, carries out second-generation sequencing, can distinguish whether each amplification product is amplified from the same template by judging the sequence of the UMI label carried by different amplification products, and can further position the gene mutation sites.
The reverse directions of the nucleic acid fragments mentioned in the specification are all 5 '-3'.
According to one aspect of the present invention, a method for locating a mutation site of a gene is provided, which comprises the following steps:
s1: providing a first oil phase and a first aqueous phase, wherein the first aqueous phase is a reaction system for preparing nucleic acid fragments N1-N2-UMI-N3(5 '-3'), mixing the first oil phase and the first aqueous phase to form a first microreactor, configuring the nucleic acid fragments N1-N2-UMI-N3 in different first microreactors, and enabling the sequence of UMI tags on the nucleic acid fragments configured in each first microreactor to be different; wherein the UMI tag sequence is a random sequence comprising 8-12 bases, and N1, N2 and N3 are fixed sequences comprising 13-20 bases respectively;
s2: providing a sample comprising gene mutation sites, and configuring each template and the nucleic acid fragment N1-N2-UMI-N3 in the sample into different second microreactors;
s3: amplifying the template to obtain an amplification product, enabling the amplification product in one second microreactor to carry the same UMI tag sequence, and comparing the UMI tag sequences, wherein if the UMI tag sequences are the same, the amplification product is derived from the same template; if the UMI tag sequences are different, the amplification product is derived from a different said template; and then judging the location of the gene mutation site on the template.
According to a preferred embodiment of the present invention, at least the following advantages are provided:
according to the invention, each template in a sample is configured in different microreactors, and each microreactor is configured with a UMI tag sequence, so that an amplification product (from the same template) in each microreactor carries the same UMI tag sequence, amplification products (from different templates) among the microreactors carry different UMI tag sequences, and gene mutation sites can be distinguished from which template according to the UMI tag sequences, and the problem that whether different mutation sites are from the same template or not can not be judged in a sequencing process is solved.
In some embodiments of the invention, the nucleic acid fragment N1-N2-UMI-N3 is obtained by emulsion PCR using the nucleic acid fragment N2-UMI-N3 as a template, the vector-N1-N2 as an upstream primer, and the nucleic acid fragment N3' as a downstream primer.
In some embodiments of the invention, the support is configured as a magnetic bead.
In some embodiments of the invention, the nucleic acid fragment N3 'is a fixed sequence comprising 13-20 bases, and the nucleic acid fragment N3' is reverse complementary paired with the N3.
In some preferred embodiments of the present invention, the UMI tag sequence is configured as a random sequence comprising 8 bases.
In some preferred embodiments of the present invention, N1 is a fixed sequence comprising 20 bases, and the sequence information is shown in SEQ ID NO. 1.
In some preferred embodiments of the present invention, N2 is a fixed sequence comprising 13 bases, and the sequence information is shown in SEQ ID NO. 2.
In some preferred embodiments of the present invention, N3 is a fixed sequence comprising 16 bases, and the sequence information is shown in SEQ ID NO 3.
In some preferred embodiments of the present invention, the nucleic acid fragment N3' is a fixed sequence comprising 16 bases, and the sequence information is shown in SEQ ID NO. 4.
In some embodiments of the invention, the nucleic acid fragment N1-N2-UMI-N3 is disposed on the vector, which is ligated to the 5' end of the nucleic acid fragment.
In some embodiments of the present invention, the first microreactor is a water-in-oil emulsion particle, and the volume ratio of the first oil phase to the first aqueous phase is (3-3.5): 1, and preparing the composition.
In some embodiments of the invention, the first oil phase is stabilized in a stabilizer 1: stabilizer 2: emulsifier 75: 4: (800-1000) by volume ratio; the stabilizer 1 comprises at least one of span 80, tween 60 or tween 20; the stabilizer 2 comprises at least one of TritonX-100 or TritonX-114; the emulsifier comprises at least one of triglycerol monostearate or glyceryl stearate.
In some embodiments of the present invention, the template in step S2 is each DNA template in the sample, and the template contains the gene mutation site.
In some embodiments of the invention, the method of configuring each template and the nucleic acid fragment N1-N2-UMI-N3 in the sample into a different second microreactor in step S2 is emulsion PCR, comprising preparing the second microreactor and PCR amplification.
In some embodiments of the invention, a method of making the second microreactor comprises formulating a second oil phase, a second aqueous phase, mixing the second oil phase and the second aqueous phase;
a method of formulating the second oil phase: according to the weight ratio of the stabilizer 1: stabilizer 2: emulsifier 75: 4: (800-1000) by volume ratio; the stabilizer 1 comprises at least one of span 80, tween 60 or tween 20; the stabilizer 2 comprises at least one of TritonX-100 or TritonX-114; the emulsifier comprises at least one of triglycerol monostearate or glyceryl stearate;
the second aqueous phase comprises primer pairs, the template in the sample, the nucleic acid fragment N1-N2-UMI-N3;
the second oil phase and the second water phase are prepared according to the following formula (3-3.5): 1 by volume.
In some embodiments of the invention, the primer pair comprises an upstream primer and a downstream primer.
In some embodiments of the invention, in the 5 '-3' direction, the upstream primer is F1: n3-a, wherein a is an upstream primer sequence required for amplification of the template in the sample; the downstream primer is R1: N4-N2-B, wherein B is a downstream primer sequence required for amplification of the template in the sample, and N4 is an immobilized sequence comprising 20-23 bases.
In some preferred embodiments of the invention, N4 is a fixed sequence comprising 21 bases and the sequence information is shown in SEQ ID NO 5.
In some embodiments of the invention, in the 5 'to 3' direction, the nucleic acid fragment of the amplification product is N1-N2-UMI-N3-Insert-N2 '-N4', wherein Insert is the Insert introduced for amplification and is derived from the template in the sample; n2 'is a fixed sequence comprising 13-20 bases, and the N2' is in reverse complementary pairing with the N2; n4 'is a fixed sequence comprising 20-23 bases, and the N4' is in reverse complementary pairing with the N4.
In some preferred embodiments of the invention, N2' is a fixed sequence comprising 13 bases.
In some preferred embodiments of the invention, N4' is a fixed sequence comprising 21 bases.
Drawings
The invention is further described with reference to the following figures and examples, in which:
FIG. 1 is a schematic structural diagram of a magnetic bead-N1-N2-UMI-N3 prepared according to an embodiment of the present invention;
FIG. 2 is a schematic representation of a second microreactor formed in accordance with an embodiment of the present invention;
FIG. 3 is a schematic diagram of an emulsion PCR process incorporating UMI tag sequences according to an embodiment of the present invention;
FIG. 4 is a schematic diagram showing the structure of an amplification product obtained by emulsion PCR according to an embodiment of the present invention;
FIG. 5 is a schematic diagram of PCR amplification with a second primer pair F2 and R2 according to an embodiment of the present invention;
FIG. 6 is a schematic diagram of the structure of the final amplification product according to the embodiment of the present invention.
Reference numerals:
11-magnetic beads; 12-N1-N2-UMI-N3 nucleic acid fragment; 13-DNA sample; 14-a first forward primer; 15-a first downstream primer; 16-a second microreactor; 21-N1-N2-UMI-N3-Insert-N2 '-N4' nucleic acid fragment; 31-a second upstream primer; 32-second downstream primer.
Detailed Description
The embodiments of the invention will be described in detail hereinafter, examples of which are illustrated in the accompanying drawings, and the embodiments described hereinafter with reference to the drawings are illustrative only and are not to be construed as limiting the invention.
In the description of the present invention, if there are first and second described only for the purpose of distinguishing technical features, it is not understood that relative importance is indicated or implied or that the number of indicated technical features or the precedence of the indicated technical features is implicitly indicated or implied.
In the description of the present invention, unless otherwise specifically limited, terms such as amplification, ligation and the like should be understood in a broad sense, and those skilled in the art can reasonably determine the specific meanings of the above terms in the present invention by combining the specific contents of the technical solutions.
Reference in the description of the invention to the terms "one embodiment," "some embodiments," and the like, means that a particular feature or material described in connection with the embodiment is included in at least one embodiment of the invention. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment. Furthermore, the particular features or materials described may be combined in any suitable manner in any one or more embodiments.
The test methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.
Example 1
The nucleic acid sequences mentioned below are all in the 5 '-3' orientation.
In the embodiment, the gene mutation site in the sample to be detected is located, and the specific process is as follows:
(1) and (3) extracting DNA: taking 1mL of alveolar lavage fluid of asthma patients, adding a grinding ball and 1mL of lysate, and carrying out shaking incubation at 65 ℃ for 15-25 min; standing at room temperature for 10min, adding 1.5mL of isopropanol and 50 μ L of XP magnetic beads, and incubating for 10min with shaking; putting on a magnetic frame, removing reaction liquid, adding 1mL of washing liquid, uniformly mixing, putting on the magnetic frame, removing the washing liquid, and repeatedly washing once; adding 1mL of 80% absolute ethyl alcohol, uniformly mixing, putting on a magnetic rack, and removing liquid; after air drying, adding 100 mu L of nuclease-free water, uniformly mixing, incubating at room temperature for 5-10 min, loading on a magnetic frame, transferring the solution to a new centrifugal tube to obtain a DNA sample, and using ddH2The DNA sample was diluted to a concentration of 0.88 ng/. mu.L.
(2) Configuring a nucleic acid fragment N1-N2-UMI-N3 in a first microreactor:
preparing a first oil phase: according to the weight ratio of Tween 80: TritonX-100: triglycerol monostearate 75: 4: 920, preparing a volume ratio;
preparing a first water phase: preparing according to the following table 1;
TABLE 1
N1 is a fixed sequence, and the sequence information is ACACTCTTTCCCTACACGAC; n2 is a fixed sequence, and the sequence information is GCTCTTCCGATCT; n3 is a fixed sequence, and the sequence information is GGTCTTAGGAAGACAA; UMI is a random sequence of 8 bases; n3 ' and N3 are subjected to reverse complementary pairing, the sequence information is TTGTCTTCCTAAGACC, and the 5 ' end of N3 ' is subjected to biotin modification;
forming and amplifying a first microreactor: adding 320 mu L of first oil phase into each 100 mu L of first water phase system, and oscillating for 5min at the maximum rotating speed of a vortex mixer to prepare a first microreactor; and performing emulsion PCR (polymerase chain reaction) on one tube of 50 mu L, and obtaining the nucleic acid fragment comprising the UMI tag sequence after the PCR is finished, wherein each first microreactor comprises one UMI tag sequence, and the UMI tag sequences contained in the first microreactors are different. The amplification procedure is shown in table 2;
TABLE 2
And (3) purifying an amplification product: taking an emulsion PCR amplification product, adding washed M270 magnetic Beads (which are magnetic Beads modified with streptavidin and can be combined with the amplification product with biotin), incubating at room temperature for 45min, mounting a magnetic frame, removing reaction liquid and unadsorbed magnetic Beads, cleaning twice by using 1 xBeads Wash Buffer, and washing by ddH2Cleaning O once and redissolving to ddH2Obtaining magnetic beads-N1-N2-UMI-N3-M270 magnetic beads (wherein the magnetic beads are connected with the 5 ' end of N1, and the M270 magnetic beads are connected with the 5 ' end of N3 ' in a complementary strand) in O; taking the purified product, denaturing at 90 deg.C for 5min, and quickly transferring to magnetic frameTransferring the liquid and unadsorbed magnetic beads to a new centrifuge tube, centrifuging, removing the supernatant, and adding ddH2Cleaning twice with O, and redissolving to ddH2And O, obtaining a nucleic acid fragment magnetic bead-N1-N2-UMI-N3, wherein as shown in FIG. 1, the N1-N2-UMI-N3 nucleic acid fragment 12 is single-stranded DNA and is connected with the magnetic bead 11 through the 5' end of N1, each first microreactor comprises a magnetic bead-N1-N2-UMI-N3, and the nucleic acid fragment in each first microreactor is different due to different UMI tag sequences.
(3) Preparing a second oil phase: according to the weight ratio of Tween 80: TritonX-100: triglycerol monostearate 75: 4: 920, preparing a volume ratio;
preparing a second water phase: compounding as shown in Table 3;
TABLE 3
The sequence of the upstream primer F1 is N3-A, wherein A is the upstream primer required for amplifying the DNA region containing the gene mutation, and comprises A1 and A2 … … An which respectively correspond to different gene mutation DNA templates; the sequence of the downstream primer R1 is N4-N2-B, wherein B is a downstream primer required for amplifying a gene mutation DNA template, and comprises B1 and B2 … … Bn which respectively correspond to A1 and A2 … … An; sequence information of N1, N2 and N3 as described in (2), N4 is a fixed sequence, and sequence information is GTGACTGGAGTTCAGACGTGT;
forming and amplifying a second microreactor: adding 320 mu L of second oil phase into each 100 mu L of second water phase system, oscillating for 5min at the maximum rotation speed of a vortex mixer to prepare a second microreactor 16 (shown in figure 2), which comprises magnetic beads 11, N1-N2-UMI-N3 nucleic acid fragments 12, a DNA sample 13, a first upstream primer 14 and a first downstream primer 15; emulsion PCR (shown in FIG. 3) is performed in one tube of 100. mu.L, after the PCR is finished, the amplification of the DNA sample is completed, and the UMI tag sequence is introduced into the amplification product. The amplification procedure is shown in table 4;
TABLE 4
And (3) purifying an amplification product: taking the amplification product, centrifuging, removing reaction liquid, washing twice by using 80% ethanol, airing at room temperature for 1-2 min until the surface is matt, and redissolving to 20 mu L ddH2In O, an amplification product (shown in FIG. 4) was obtained: magnetic bead-N1-N2-UMI-N3-Insert-N2 '-N4' (5 '-3'), composed of magnetic bead 11 and N1-N2-UMI-N3-Insert-N2 '-N4' nucleic acid fragment 21; wherein Insert is introduced by amplification and is derived from a DNA sample, N2 'is in reverse complementary pairing with N2, N4' is in reverse complementary pairing with N4, the amplification product has a UMI tag sequence, the UMI tag sequences carried by the amplification products in the same second microreactor are the same, and the UMI tag sequences carried by the amplification products in different second microreactors are different, so that whether the amplification products are derived from the same DNA template can be judged according to the UMI tag sequences, namely the amplification products carrying the same UMI tag sequence are obtained by amplifying the same DNA template.
(4) Preparing a PCR reaction system according to the following table 5;
TABLE 5
| Template: purified emulsion PCR amplification product | 20μL |
| 2×Kapa Hifi Mix | 25μL |
| Upstream primer F2 (5. mu.M) | 2.5μL |
| Downstream primer R2 (5. mu.M) | 2.5μL |
| General ofProduct of large quantities | 50μL |
The sequence of the upstream primer F2 is P1-Index1-N1, P1 is a fixed sequence, the sequence information is shown as SEQ ID NO. 6, specifically AATGATACGGCGACCACCGAGATCTACAC, and Index1 is a tag sequence 1 for distinguishing samples; the sequence of the downstream primer R2 is P2-Index2-N4, P2 is a fixed sequence, the sequence information is shown as SEQ ID NO. 7, specifically CAAGCAGAAGACGGCATACGAGAT, and Index2 is a tag sequence 2 for distinguishing samples;
performing PCR (as shown in FIG. 5), wherein N1-N2-UMI-N3-Insert-N2 '-N4' nucleic acid fragment 21 connected with magnetic beads 11 is used as a template, a second upstream primer 31 and a second downstream primer 32 are used as primer pairs for amplification, and after the amplification is finished, a sample tag sequence is introduced to each of two ends of an amplification product; following the amplification procedure of Table 6;
TABLE 6
And (3) purifying an amplification product: taking 50 mu L of amplification product, adding 60 mu L of XPBeads, incubating for 5min at room temperature, putting on a magnetic frame, removing reaction liquid and unadsorbed magnetic Beads, washing twice with 80% ethanol, airing for 1-2 min at room temperature until the surface is matt, and redissolving to 20 mu L of ddH2In O, the magnetic frame is reapplied to obtain the final amplification product (as shown in FIG. 6): P1-Index1-N1-N2-UMI-N3-Insert-N2 '-N4' -Index2 '-P2' (5 '-3'), wherein Index2 'is reverse complementary paired with Index2 and P2' is reverse complementary paired with P2.
At the moment, the amplified products simultaneously carry sample tag sequences Index and UMI tag sequences, so that each amplified product can be added with a sample tag belonging to the amplified product, and sequencing data from each sample can be obtained through the tag after multi-sample mixed sequencing; and the amplified product amplified in the same template carries the same UMI label, and the source of the amplified product can be judged through the label, namely the gene mutation site in a certain amplified product is judged to come from which DNA template, so that the gene mutation site is positioned.
(5) Illumina sequencer sequencing and bioinformatics analysis
Sequencing the final amplification product, performing data resolution according to the library Index, and performing bioinformatics analysis. During emulsion PCR, the input amount of the template and the drop number of the microreactors (which are far greater than the number of the templates) are controlled, so that only 1 or 0 template is contained in one microreactor, and the microreactors are isolated from each other in the emulsion PCR process. The microreactor containing 0 template can not be amplified, and the microreactor containing 1 template completes amplification, so that amplification products of different mutation sites carry the same UMI tag sequence.
When bioinformatics analysis is carried out, the UMI tag sequences in the sequencing read length are intercepted, and whether different gene mutation sites are from the same template can be judged according to whether the UMI tag sequences are the same.
The method for positioning the gene mutation site can be applied to pathogen drug-resistant site detection and invisible genetic mutation detection.
Pathogen drug-resistant site detection:
pathogen specific sites and drug resistant sites need to be detected simultaneously: detecting pathogen specific sites for determining which pathogens are infected; and detecting the drug-resistant site for judging whether the pathogen generates the drug-resistant site or not, and if so, which pathogen generates the drug-resistant site.
When the resistance site is far away from the specific site on the genome and homologous pathogens may be present: the first-generation sequencing and the second-generation sequencing cannot simultaneously cover a specific site and a drug-resistant site on one read due to read length limitation; sometimes, due to the existence of homologous sequences or incomplete pathogen sequencing data, a drug-resistant site and a specific site cannot be spliced to a long sequence through splicing of a large amount of sequencing data, so that the detection of the pathogen drug-resistant site has technical defects. When Pacbio third-generation sequencing is adopted, the read length can reach thousands of bp to tens of thousands of bp, the problem of sequence splicing can be effectively solved, but the market popularity of the Pacbio third-generation sequencer is too low, the requirement on the pathogen detection report period is too high, a large number of samples cannot be sent for detection in a centralized manner, and when the Pacbio third-generation sequencer is used for detecting target gene mutation, the library building process is complex, the experiment cost is high, the input amount of initial samples is low, and when the pathogen carrying capacity is low, detection omission is easily caused.
By utilizing the method for positioning the gene mutation site, only one round of emulsion PCR and one round of common PCR are needed in the library building process, two rounds of purification are needed, the library building cost is low, the gene mutation positioning can be completed by short read length and extremely small data volume, and the applicable sequencing platform has high market popularity.
Detection of invisible genetic mutation:
when a plurality of pathogenic mutations exist on a recessive genetic gene of a subject and are all heterozygotes, whether the plurality of pathogenic mutations are from the same chromosome needs to be judged: when a plurality of pathogenic mutations are all from the same chromosome, because all the pathogenic mutations are heterozygotes, the corresponding gene of the other chromosome is a wild type, and the gene is invisible heredity, so that diseases cannot be caused; when a plurality of pathogenic mutations are distributed in two sets of chromosomes, the corresponding genes of the two sets of chromosomes are mutant, and then diseases are caused.
Because two genes on the homologous chromosomes are highly homologous, when a plurality of genes are mutated and are far away from each other on a genome, the first-generation sequencing and the second-generation sequencing have the splicing problem due to the limitation of reading length, so that the judgment on whether the two genes are from the same chromosome cannot be made. When Pacbio three-generation sequencing is adopted, the read length can reach thousands of bp to tens of thousands of bp, the problem of sequence splicing can be effectively solved, and the genetic mutation detection has no strict report cycle. However, because the human genome is too complex, the mutation conditions of the detected persons are greatly different, and almost customized detection schemes are needed, and the Pacbio for detecting the mutation of the target gene needs a large amount of customized capture probes, so that the experiment cost is high.
The method for positioning the gene mutation site has simple experiment, only needs to synthesize corresponding primers according to different mutation conditions, has low library construction cost, can complete gene mutation positioning by short read length and extremely small data volume, and has high market popularity of an applicable sequencing platform.
The invention is not limited to the above sequencing platform, but can also be used for other sequencing platforms such as Life and MGI.
The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present invention. Furthermore, the embodiments of the present invention and the features of the embodiments may be combined with each other without conflict.
SEQUENCE LISTING
<110> Shenzhen nuclear gene technology Limited
<120> method for locating gene mutation site
<130> 1
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> N1
<400> 1
acactctttc cctacacgac 20
<210> 2
<211> 13
<212> DNA
<213> N2
<400> 2
<210> 3
<211> 16
<212> DNA
<213> N3
<400> 3
<210> 4
<211> 16
<212> DNA
<213> N3'
<400> 4
<210> 5
<211> 21
<212> DNA
<213> N4
<400> 5
<210> 6
<211> 29
<212> DNA
<213> P1
<400> 6
aatgatacgg cgaccaccga gatctacac 29
<210> 7
<211> 24
<212> DNA
<213> P2
<400> 7
caagcagaag acggcatacg agat 24
Claims (10)
1. A method for locating a gene mutation site, which is characterized by comprising the following steps:
s1: providing a first oil phase and a first aqueous phase, wherein the first aqueous phase is a reaction system for preparing nucleic acid fragments N1-N2-UMI-N3, mixing the first oil phase and the first aqueous phase to form a first microreactor, configuring the nucleic acid fragments N1-N2-UMI-N3 in different first microreactors, and enabling UMI tag sequences on the nucleic acid fragments configured in each first microreactor to be different; wherein the UMI tag sequence is a random sequence comprising 8-12 bases, and N1, N2 and N3 are fixed sequences comprising 13-20 bases respectively;
s2: providing a sample comprising gene mutation sites, and configuring each template and the nucleic acid fragment N1-N2-UMI-N3 in the sample into different second microreactors;
s3: amplifying the template to obtain an amplification product, enabling the amplification product in one second microreactor to carry the same UMI tag sequence, and comparing the UMI tag sequences, wherein if the UMI tag sequences are the same, the amplification product is derived from the same template; if the UMI tag sequences are different, the amplification product is derived from a different said template; and then judging the location of the gene mutation site on the template.
2. The method for localization according to claim 1, wherein the nucleic acid fragment N1-N2-UMI-N3 is obtained by emulsion PCR using the nucleic acid fragment N2-UMI-N3 as a template, the vector-N1-N2 as an upstream primer, and the nucleic acid fragment N3' as a downstream primer; the support is configured as a magnetic bead.
3. The method according to claim 2, wherein the nucleic acid fragment N3 'is a fixed sequence comprising 13-20 bases, and the nucleic acid fragment N3' is reverse complementary paired with the N3.
4. The method according to claim 2, wherein the nucleic acid fragment N1-N2-UMI-N3 is disposed on the vector, and the vector is linked to the 5' end of the nucleic acid fragment.
5. The positioning method according to claim 1, wherein the first microreactor is a water-in-oil emulsion particle, and the volume ratio of the first oil phase to the first aqueous phase is (3-3.5): 1, preparing;
the first oil phase is prepared by mixing a stabilizer 1: stabilizer 2: emulsifier 75: 4: (800-1000) by volume ratio; the stabilizer 1 comprises at least one of span 80, tween 60 or tween 20; the stabilizer 2 comprises at least one of TritonX-100 or TritonX-114; the emulsifier comprises at least one of triglycerol monostearate or glyceryl stearate.
6. The method of claim 1, wherein the step S2, the step of configuring each template and the nucleic acid fragment N1-N2-UMI-N3 in the sample into different second microreactors is emulsion PCR, comprising preparing the second microreactors and PCR amplification.
7. The method of claim 6, wherein the method of making the second microreactor comprises formulating a second oil phase, a second aqueous phase, mixing the second oil phase and the second aqueous phase;
a method of formulating the second oil phase: according to the weight ratio of the stabilizer 1: stabilizer 2: emulsifier 75: 4: (800-1000) by volume ratio; the stabilizer 1 comprises at least one of span 80, tween 60 or tween 20; the stabilizer 2 comprises at least one of TritonX-100 or TritonX-114; the emulsifier comprises at least one of triglycerol monostearate or glyceryl stearate;
the second aqueous phase comprises primer pairs, the template in the sample, the nucleic acid fragment N1-N2-UMI-N3;
the second oil phase and the second water phase are prepared according to the following formula (3-3.5): 1 by volume.
8. The method of claim 7, wherein the primer pair comprises an upstream primer and a downstream primer.
9. The method according to claim 8, wherein in the primer pair, in the 5 '-3' direction, the upstream primer is F1: n3-a, wherein a is an upstream primer sequence required for amplification of the template in the sample; the downstream primer is R1: N4-N2-B, wherein B is a downstream primer sequence required for amplification of the template in the sample, and N4 is an immobilized sequence comprising 20-23 bases.
10. The method of claim 9, wherein the nucleic acid fragment of the amplification product is N1-N2-UMI-N3-Insert-N2 '-N4' in the 5 '-3' direction, wherein Insert is an Insert introduced for amplification and is derived from the template in the sample; n2 'is a fixed sequence comprising 13-20 bases, and the N2' is in reverse complementary pairing with the N2; n4 'is a fixed sequence comprising 20-23 bases, and the N4' is in reverse complementary pairing with the N4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111675710.0A CN114350782A (en) | 2021-12-31 | 2021-12-31 | Method for positioning gene mutation site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111675710.0A CN114350782A (en) | 2021-12-31 | 2021-12-31 | Method for positioning gene mutation site |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114350782A true CN114350782A (en) | 2022-04-15 |
Family
ID=81106110
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111675710.0A Pending CN114350782A (en) | 2021-12-31 | 2021-12-31 | Method for positioning gene mutation site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114350782A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102758026A (en) * | 2012-06-29 | 2012-10-31 | 深圳华大基因科技有限公司 | HiSeq sequencing technology-based method for detecting hepatitis B virus type and drug resistance gene |
| CN110656156A (en) * | 2019-10-14 | 2020-01-07 | 湖南大地同年生物科技有限公司 | Ultralow frequency mutation nucleic acid fragment detection method, library construction method, primer design method and reagent |
| US10774377B1 (en) * | 2017-10-05 | 2020-09-15 | Verily Life Sciences Llc | Use of unique molecular identifiers for improved sequencing of taxonomically relevant genes |
-
2021
- 2021-12-31 CN CN202111675710.0A patent/CN114350782A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102758026A (en) * | 2012-06-29 | 2012-10-31 | 深圳华大基因科技有限公司 | HiSeq sequencing technology-based method for detecting hepatitis B virus type and drug resistance gene |
| US10774377B1 (en) * | 2017-10-05 | 2020-09-15 | Verily Life Sciences Llc | Use of unique molecular identifiers for improved sequencing of taxonomically relevant genes |
| CN110656156A (en) * | 2019-10-14 | 2020-01-07 | 湖南大地同年生物科技有限公司 | Ultralow frequency mutation nucleic acid fragment detection method, library construction method, primer design method and reagent |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Salk et al. | Enhancing the accuracy of next-generation sequencing for detecting rare and subclonal mutations | |
| US20220033901A1 (en) | Universal sanger sequencing from next-gen sequencing amplicons | |
| Mou et al. | Multiple genotyping based on multiplex PCR and microarray | |
| JP2022036975A (en) | Rapid Sequencing of Short DNA Fragments Using Nanopore Technology | |
| CN105934523A (en) | Multiplex detection of nucleic acids | |
| WO2019144582A1 (en) | Probe and method for high-throughput sequencing targeted capture target region used for detecting gene mutations as well as known and unknown gene fusion types | |
| CN111808854B (en) | Balanced joint with molecular bar code and method for quickly constructing transcriptome library | |
| CN102333890B (en) | The gene group selection and sequencing carried out using the microcarrier of coding | |
| CN108753954B (en) | Capture probe set of dementia-related gene, kit, library construction method and application | |
| CN110886021B (en) | Construction method of single-cell DNA library | |
| US11591646B2 (en) | Small RNA detection method based on small RNA primed xenosensor module amplification | |
| CN112877403B (en) | Method for constructing sequencing library of target sequence | |
| WO2020007089A1 (en) | Construction and sequencing data analysis method for ctdna library for simultaneously detecting various common mutations in liver cancer | |
| AU2022275409A1 (en) | Systems and methods for identifying and distinguishing genetic samples | |
| CN106191311B (en) | A kind of multiple liquid phase genetic chip method and reagent of quick detection cavy LCMV, SV, PVM, Reo-3 virus | |
| CN106554955A (en) | Build method and kit of the sequencing library of PKHD1 gene mutations and application thereof | |
| CN112725410A (en) | Primer group for detecting pathogenic microorganisms | |
| CN108517567A (en) | Connector, primer sets, kit and the banking process in library are built for cfDNA | |
| CN106520917A (en) | Gene large fragment deletion/duplication detection method | |
| Kramná et al. | Virome sequencing of stool samples | |
| WO2019001187A1 (en) | Multi-liquid phase gene chip detection primer, kit and method for rapidly distinguishing five pathogens in mouse respiratory tracts | |
| WO2021243271A2 (en) | Methods and compositions for pathogen detection in plants | |
| CN109252224A (en) | A kind of cycling probe and the sequencing library construction method based on cycling probe capture | |
| CN111549109A (en) | High-throughput pathogen microorganism gene detection screening method | |
| He et al. | Applications of Oxford nanopore sequencing in Schizosaccharomyces pombe |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |