CN114350668B

CN114350668B - PH-responsive intelligent anticoagulation nucleic acid aptamer, application and medicine thereof

Info

Publication number: CN114350668B
Application number: CN202111200113.2A
Authority: CN
Inventors: 刘建宇; 高庆杰; 张文科
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2021-10-14
Filing date: 2021-10-14
Publication date: 2023-07-18
Anticipated expiration: 2041-10-14
Also published as: CN114350668A

Abstract

The invention relates to an intelligent anticoagulation nucleic acid aptamer with pH response, which is an HD1-HD22 bivalent aptamer, wherein the HD1 aptamer or a derivative thereof is connected with the HD22 aptamer or a derivative thereof by a bridge arm, and the bridge arm is a sequence with pH response characteristics; the bridge arm sequence is 5'-TTCCTATCCGTTCCGATCCG-3' or 5'-TTCCTATCCGTTCCAATCCG-3'; the bridge arm is rich in nucleic acid sequences of C bases, can be folded under an acidic condition to shorten the length, can not form base complementation with G bases in the HD1 and HD22 sequences and damage the structure and the function of a single-chain aptamer, and is connected with the HD22 through the bridge arm thrombin aptamer HD1 to obtain the pH response intelligent anticoagulation bivalent aptamer, which not only has the excellent characteristics of the common bivalent aptamer, but also can solve the problems of massive hemorrhage caused by pressing the weak part of a blood vessel by a cancer focus or more bleeding caused by pressing the blood vessel by a cancer focus due to thrombocytopenia while anticancer suppository treatment.

Description

PH-responsive intelligent anticoagulation nucleic acid aptamer, application and medicine thereof

Technical Field

The invention relates to the technical field of biological medicines, in particular to an intelligent anticoagulation nucleic acid aptamer with pH response, and application and a medicine thereof.

Background

Cancer embolism is one of the common complications of tumors. In recent years, research has found that the coagulation abnormality exists in malignant tumor patients, and the hypercoagulability is easy to form thrombus, so that the malignant tumor is second to the death of the patients. Cancer embolism refers to tumor complications of a series of pathophysiological changes caused by invasion or accumulation of blood vessels and lymphatic system or blood coagulation abnormality in the growth, propagation and metastasis processes of cancer cells, which leads to vascular dysfunction and blood circulation disorder, abnormal coagulation and thrombosis. Over 90% of patients with malignant tumors may develop coagulation system related index abnormalities. This condition affects the survival and quality of life of the patient suffering from the tumor, and cancer plugs occurring in important tissues and organs of the human body more seriously endanger the life of the patient suffering from the tumor, and even cause the patient to die quickly. Cancer embolism can occur in the large and small arteriovenous, lymphatic vessels, microcirculation, and the clinical symptoms and signs caused by the cancer embolism are complex. Shortly after surgery, cancer patients are four times as likely to die from pulmonary embolism as normal surgical patients. In fact, 10% of early deaths in cancer patients are due to pulmonary embolism. However, in the postoperative treatment of cancer patients, the problems of massive hemorrhage caused by pressing the weak part of the blood vessel by the cancer focus or more than hemorrhage caused by pressing the blood vessel by the cancer focus due to thrombocytopenia are also prevented while the anti-cancer suppository is treated. It is by this factor that warfarin, while reducing thromboembolic events by 85%, has not been widely adopted due to concerns about bleeding. Therefore, there is a strong need to provide an intelligent antithrombotic agent that can normally exert an antithrombotic effect at non-focal sites and reduce the risk of bleeding at cancer focal sites.

HD1, HD22, HD1-HD22 are thrombin nucleic acid aptamers that have been reported to date. The HD1 thrombin aptamer comprises a single-stranded nucleic acid sequence 5'-GGTTGGTGTGGTTGG-3' of fifteen nucleotides, which interacts with the external enzyme catalytic site I of human α -thrombin, which is originally intended for binding fibrinogen, so that when HD1 is bound to catalytic site I of thrombin, it acts to inhibit platelet aggregation, fibrinogen activation, etc. HD1 shows good specificity and affinity for thrombin with a binding constant of about twenty-five to two hundred nano-mouses per milliliter. In purified fibrinogen, HD1 extends clotting time from 25 seconds to 169 seconds, and in real human plasma, from 25 seconds to 43 seconds. The IC50 for HD1 to inhibit platelet aggregation (0.5U/mL thrombin) is about seventy to eighty nanomoles per liter, well below 1.7 micromoles per liter of hirudin. Studies have demonstrated that thrombin aptamer HD1 is more effective in inhibiting clot binding to thrombin than heparin.

HD22 is a second thrombin binding aptamer found by the company NeXstar Pharmaceuticals, 1997, diane m.tasset and university of corradon molecular cell and developmental biology system Walter stepiner and their colleagues, comprising an optimized aptamer of 29 nucleotide sequence (5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACT-3') or 27 nucleotide sequence (lacking the first and last nucleotides in the form of 29 mers). The binding constant of HD22 to thrombin can reach 500 nanomoles per milliliter. HD22 recognizes thrombin external site II. Nucleotides G23, T24, G25, a26, C27 of the double-stranded portion of HD22 and the T9, T18, T19, G20 nucleotides of the G4 portion contribute to the interaction with external site II of thrombin. Since thrombin external site II is a positively charged motif, it generates many ion pairs with the HD22 backbone, especially in the duplex region. Hydrophobic interactions were observed in the G4 region (T9, T18 and T10), which stabilized the formation of complexes. Furthermore, the interaction with thrombin improves the thermal stability of the HD22 structure and results in an increase in melting temperature from 36 ℃ to 48 ℃.

HD1-HD22 is a bivalent aptamer, thrombin has two catalytically active sites, the exosite I and the exosite II, respectively, to which thrombin fibrinogen binds, and HD1-HD22 is an aptamer obtained by bridge-linking the 15nt aptamer HD1 (5'-GGTTGGTGTGGTTGG-3') of the thrombin fibrinogen binding site with the 29nt aptamer HD22 (5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACT-3') or the 27nt (lacking the first and last nucleotides in the 29 mer form) aptamer HD2 of the thrombin heparin binding site. The 15nt aptamer of the thrombin fibrinogen binding site (HD 1) has high specificity and high anticoagulation. The 29nt aptamer (HD 22) of thrombin heparin locus has high affinity, and the HD1-HD22 bivalent aptamer integrates the common advantages of the two thrombin aptamers, has extremely high target specificity, biological innocuity, obvious drug effect and low cost of short-chain nucleic acid, has high affinity and high anticoagulation effect on thrombin, and is a medical drug truly having clinical prospect. Studies show that the bivalent thrombin aptamer has potassium-dependent inhibition effect on fibrin gel formation mediated by thromboxane, which is two times higher than that of a typical single-chain fibrin aptamer on average, so that the HD1-HD22 has good application capability and potential.

Although studies on thrombin aptamers such as HD1, HD22, and HD1-HD22 have been disclosed, no reports have been made on intelligent thrombin aptamers.

Disclosure of Invention

First, the technical problem to be solved

In view of the above-mentioned shortcomings and disadvantages of the prior art, the present invention provides a pH-responsive intelligent anticoagulation nucleic acid aptamer, which has pH response characteristics, and can exert normal anticoagulation effect in normal neutral pH blood to prevent thrombosis, and simultaneously reduce anticoagulation effect in acidic blood with pH of about 5, and avoid acid sites such as cancer lesions from bleeding greatly, thereby realizing anticancer suppository treatment while preventing cancer lesions from pressing weak blood vessel sites to cause massive bleeding or cancer lesions from pressing blood vessel sites to bleed more than once due to thrombocytopenia.

(II) technical scheme

In order to achieve the above purpose, the main technical scheme adopted by the invention comprises the following steps:

in a first aspect, the present invention provides a pH-responsive intelligent anti-coagulant aptamer having pH-responsive properties that exert normal anti-coagulant function in neutral pH blood and decline in anti-coagulant function in acidic pH blood; the anticoagulant nucleic acid aptamer is an HD1-HD22 bivalent aptamer, the HD1 aptamer or a derivative thereof is connected with the HD22 aptamer or a derivative thereof through a bridge arm, and the bridge arm is a sequence with pH response characteristics; the bridge arm sequence is

5'-TTCCTATCCGTTCCGATCCG-3' (shown as SEQ ID NO. 1) or

5'-TTCCTATCCGTTCCAATCCG-3' (SEQ ID NO. 2).

According to a preferred embodiment of the invention, the sequence of the anti-coagulant aptamer is

SEQ ID NO.3 shows

GGTTGGTATGGTTGGTTCCTATCCGTTCCGATCCGAGTCCGTGGTAGGGCAGGTTGGGGTGACT; or alternatively

SEQ ID NO.4

GGTTGGTGTGGTTGGTTCCTATCCGTTCCAATCCGAGTCCGTGGTAGGGCAGGTTGGGGTGACT。

In a second aspect, the invention provides the use of any one of the above-described pH-responsive intelligent anti-thrombotic nucleic acid aptamers as a medicament for the anti-thrombotic treatment of tumors.

In a third aspect, the present invention also provides a tumor anti-thrombotic DNA nucleic acid drug, wherein the tumor anti-thrombotic DNA nucleic acid drug comprises a segment of anti-thrombotic nucleic acid aptamer, and the sequence of the anti-thrombotic nucleic acid aptamer is as follows:

as shown in SEQ ID NO.3

As shown in SEQ ID NO.4

GGTTGGTGTGGTTGGTTCCTATCCGTTCCAATCCGAGTCCGTGGTAGGGCAGGTTGGGGTGACT。

In a fourth aspect, the invention provides a method for screening a pH-responsive intelligent anti-coagulant aptamer, comprising:

s1, analyzing base mismatch and space structure by designing an experimental sequence, removing base complementary pairing and sequences which can form mismatch, and selecting an anticoagulant nucleic acid sequence which can stably exist in the three-dimensional structure of the anticoagulant aptamer at room temperature;

s2, testing intelligent efficiency of each anticoagulation nucleic acid sequence; the testing method comprises the following steps:

Bis-tris/CaCl with pH=7.4 and pH=5.3, respectively ₂ Mixing with each anticoagulation nucleic acid sequence incubated at 37 ℃, adding plasma, and recording plasma clotting time;

the clotting time at ph=7.4 is the normal clotting time T _7.4 The clotting time at ph=5.3 is the clotting time T in an acidic environment _5.3 The intelligent efficiency is calculated according to the following formula:

intelligent efficiency = [ (T) _7.4 -T _5.3 )/T _5.3 ]*100％；

S3, selecting an anticoagulant nucleic acid sequence with intelligent efficiency of more than or equal to 80%.

Based on the above method, two pH responsive intelligent anticoagulation nucleic acid aptamers shown as SEQ ID NO.3 and SEQ ID NO.4 are obtained.

(III) beneficial effects

The pH response intelligent anticoagulation nucleic acid aptamer screened by the invention has pH response intelligence, can exert normal anticoagulation effect in normal neutral pH blood to prevent thrombosis, can reduce anticoagulation effect in acidic blood with pH of about 5, and can avoid large bleeding at acidic sites such as cancer focus, thereby realizing the anti-cancer suppository treatment and simultaneously preventing the problems of massive bleeding caused by compression of the cancer focus on the weak vascular site or insufficient bleeding caused by compression of the cancer focus on the blood vessel site due to thrombocytopenia. The intelligent anticoagulation nucleic acid aptamer with pH response is a bivalent aptamer, has the advantages of both HD1 and HD22 aptamers, has extremely high binding target specificity, is biologically nontoxic, has obvious drug effect and low cost of short-chain nucleic acid, has high affinity for thrombin and high anticoagulation effect, has good application prospect, and can be particularly used as an anticancer suppository therapeutic drug.

The bridge arm sequence of the bivalent aptamer provided by the invention is

5'-TTCCTATCCGTTCCGATCCG-3' (shown as SEQ ID NO. 1) or

5'-TTCCTATCCGTTCCAATCCG-3' (shown as SEQ ID NO. 2)

The bridge arm is rich in nucleic acid sequences of C bases, can be folded under an acidic condition to shorten the length, does not form base complementation with G bases in HD 1/derivatives and HD22 sequences and damage the structure and the function of a single-chain aptamer, and is connected with HD22 through the bridge arm thrombin aptamer HD1 to obtain the pH response intelligent anticoagulation bivalent aptamer.

Drawings

FIG. 1 is a graph showing intelligent efficiency statistics of anticoagulation time in neutral and acidic environments for 59 anticoagulated nucleic acids screened in accordance with the present invention.

Detailed Description

The present invention will be described in detail below with reference to specific embodiments for better explaining the present invention.

Example 1

This example relates to a pH-responsive screening process for intelligent anticoagulation nucleic acid aptamers.

The design idea of the invention is based on the characteristic that some nucleic acid sequences rich in C base can be folded to shorten the length under the acidic condition, and the purpose of pH response is achieved by changing bridge arms between bivalent aptamers into nucleic acid sequences rich in C sequence. Based on the method, the base of the HD1-HD22 bivalent aptamer is modified, and a sequence with pH response is introduced into the bivalent aptamer, so that the anticoagulation effect of the bivalent aptamer can be reduced by acidic pH-5 at the focus of cancers and the like, and the large bleeding of the cancer is avoided; normal anticoagulation at normal parts, and the like, and the specific effects of anticoagulation and thrombus prevention are reflected. However, since HD1 and HD22 sequences contain a large number of G bases, base complementarity is very easily formed with C bases in acid response sequences, thereby destroying the structure and function of single-stranded aptamers and bridge arms, and thus, there is a difficulty in obtaining aptamer drugs. The target nucleic acid aptamer is obtained through screening in the following mode.

Firstly, by designing an experimental sequence, analyzing base mismatch and space structure, excluding base complementary pairing and sequences which can form mismatch, selecting anticoagulant nucleic acid sequences which can stably exist in the three-dimensional structure of the anticoagulant aptamer at room temperature, and finally obtaining 59 anticoagulant nucleic acid sequences, wherein the 59 anticoagulant nucleic acid sequences are listed in the following tables respectively:

secondly, the above 59 anticoagulation nucleic acid sequences were tested for clotting time in neutral plasma and acid plasma, respectively, to calculate intelligent efficiency, and the method was as follows:

clean glass test tubes were placed in a 37℃water bath with light, and Bis-tris/CaCl at pH=7.4 or pH=5.3 was added ₂ 100uM of the anticoagulant nucleic acid sequence to be tested, incubated at 0.2mol/L and 37℃0.9mL of plasma was withdrawn with a pipette gun, the tube was slightly tilted and the plasma was passed into the tube along the tube wall.

Starting timing, slightly and horizontally and remotely controlling the time for 3 times in a clockwise direction and a anticlockwise direction, and generating no bubbles. After 5 minutes, the tube was slowly tilted 45 degrees every 5 seconds to see if the surface blood was moving along the tube, stopping timing until clotting time, and recording clotting time. The clotting time at ph=7.4 is the normal clotting time T _7.4 The clotting time at pH=5.3 is the clotting time T in acid environment of cancer and other parts _5.3 . The reduction of clotting time at the cancer site reflects its intelligent regulation, and its phase difference time is intelligent efficiency.

Intelligent efficiency = [ (T) _7.4 -T _5.3 )/T _5.3 ]*100％。

The clotting time is the time from the mixing of the drug solution (anticoagulant aptamer of different sequence) with blood until the blood does not flow in the test tube. When blood coagulation or hemolysis occurs, the observation is ended.

A blank (plasma recalcification time re-calcium time, RT) was also set:

the blood plasma is obtained by anticoagulation of whole blood leaving blood vessel, and centrifugal precipitation to obtain body fluid without cell components, which contains fibrinogen (which can be converted into fibrin and has clotting effect), if Ca is added into blood plasma ²⁺ The plasma will re-coagulate, so the plasma will not contain free Ca ²⁺ . When the natural blood coagulation time of the blood plasma is measured, a blood plasma calcium recovery experiment is carried out, and CaCl is added into the deionized blood plasma again ₂ (0.2 mol/L), the endogenous coagulation process is restored, and the time required for the endogenous coagulation process is the plasma decalcification time.

Placing the clean glass test tube in a water bath at 37deg.C and at bright light, adding Bis-tris/C at 37deg.C into the test tubeaCl ₂ 53uL (0.2 mol/L), 0.9mL of plasma was withdrawn with a pipette, and the tube was slightly tilted to allow plasma to pass along the tube wall into 3 tubes. Starting timing, slightly and horizontally and remotely controlling the time for 3 times in a clockwise direction and a anticlockwise direction, and generating no bubbles. After 5 minutes, the tube was slowly tilted 45 degrees every 5 seconds to see if the surface blood was moving along the tube, stopping timing until clotting time, and recording clotting time.

Third step, screening pH responsive intelligent anticoagulation nucleic acid aptamer

The intelligent efficiencies of 59 anticoagulated nucleic acid sequences were tested and calculated, respectively, as shown in the statistical results of fig. 1, with bar graphs showing the intelligent efficiencies.

Further, the anticoagulation nucleic acid sequence with the efficiency below 5.1% (the nucleic acid with the F-20T-H bridge arm being 20T bases) is regarded as an intelligent-efficiency-free anticoagulation nucleic acid sequence, the sequence with the intelligent efficiency below 50% is regarded as an intelligent-efficiency-free anticoagulation nucleic acid, the intelligent is regarded as an intelligent-efficiency-intelligent anticoagulation nucleic acid with the intelligent efficiency being more than or equal to 80%, and the anticoagulation nucleic acid is expected to be applied to anticoagulation treatment.

Screening results the following two pH-responsive intelligent anti-coagulant nucleic acid aptamers were obtained:

the number 1 in the above table

GGTTGGTATGGTTGGTTCCTATCCGTTCCGATCCGAGTCCGTGGTAGGGCAGGTTGGGGTGACT (shown as SEQ ID NO. 3) and

and number 2 in the above table

GGTTGGTGTGGTTGGTTCCTATCCGTTCCAATCCGAGTCCGTGGTAGGGCAGGTTGGGGTGACT (SEQ ID NO. 4).

Wherein, the highest intelligent efficiency is the sequence of sequence No. 1.F7-i14-H (namely, the sequence shown as SEQ ID NO. 3). The blood coagulation time of the aptamer in the plasma with the pH value of 7.4 is prolonged to 1877.0 +/-15.6 s, so that the blood coagulation is effectively prolonged. The blood coagulation time in the blood plasma with the pH value of=5.3 is automatically shortened to 874.5 +/-19.1 s, the intelligent efficiency is as high as 114.6%, and the hidden danger of more than one bleeding of the cancer focus part can be effectively prevented.

Secondly, the suboptimal sequence is F-i44-H (namely the sequence shown as SEQ ID NO. 4) with the sequence number of 2 in the table, and the blood coagulation time of the aptamer in plasma with the pH value of 7.4 is prolonged to 2264.5 +/-33.2 s, so that blood coagulation is effectively prolonged. The blood coagulation time in the blood plasma with the pH value of=5.3 is automatically shortened to 1215.5 +/-38.9 s, the intelligent efficiency is up to 86.3 percent, and the hidden danger of bleeding of a cancer focus part can be effectively prevented.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention.

Sequence listing

<110> Jilin university

<120> an intelligent anticoagulation nucleic acid aptamer with pH response, application and medicament thereof

<130> EJS211138I

<141> 2021-10-13

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 1

ttcctatccg ttccgatccg 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 2

ttcctatccg ttccaatccg 20

<210> 3

<211> 64

<212> DNA

<213> Artificial Sequence

<400> 3

ggttggtatg gttggttcct atccgttccg atccgagtcc gtggtagggc aggttggggt 60

gact 64

<210> 4

<211> 64

<212> DNA

<213> Artificial Sequence

<400> 4

ggttggtgtg gttggttcct atccgttcca atccgagtcc gtggtagggc aggttggggt 60

gact 64

Claims

1. A pH-responsive intelligent anti-thrombotic nucleic acid aptamer characterized in that the anti-thrombotic nucleic acid aptamer has pH response characteristics, exhibits normal anti-thrombotic function in neutral pH blood and decreases anti-thrombotic function in acidic pH blood; the anticoagulant nucleic acid aptamer is an HD1-HD22 bivalent aptamer, the HD1 aptamer or a derivative thereof is connected with the HD22 aptamer or a derivative thereof through a bridge arm, and the bridge arm is a sequence with pH response characteristics;

the anticoagulant aptamer is a nucleotide of any one of the following sequences:

GGTTGGTATGGTTGGTTCCTATCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGTGGTTGGTTCCTATCCGTTCCAATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGTGGTTGGTTCCTATCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGTGGTTGGTTCCAGTCCGTTCCGTTCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGGTGGTGTGGTTGGTTCCTATCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTTTGGTTGGTTCCTATCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGAGTGGTTGGTTCCTATCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGTGGTAGGTTCCTATCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGAGGTTGGTTCCTATCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTCTGGTTGGTTCCTATCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGTGGTTGGTTCCTTTCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGTGGTTGGTTCCTTGCCGTTCCGTTCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGTGGGTGGTTCCTATCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGTGGTTGGTTCCAATCCGTTCCAAGCCGAGTCCGTG GTAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGTGGTTGGTTCCTCTCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGTGGTTGGTTCCATTCCGTTCCGTTCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGTGGTTGGTTCCTTGCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT; or (b)

GGTTGGTGTGGTTGGTTCCCGTCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT。

2. A pH-responsive intelligent anti-thrombotic nucleic acid aptamer, characterized in that the anti-thrombotic nucleic acid aptamer has the sequence:

GGTTGGTATGGTTGGTTCCTATCCGTTCCGATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT as shown in SEQ ID NO. 3; or alternatively

GGTTGGTGTGGTTGGTTCCTATCCGTTCCAATCCGAGTCCGTGG TAGGGCAGGTTGGGGTGACT as shown in SEQ ID NO. 4.

3. Use of a pH-responsive intelligent anti-thrombotic aptamer according to claim 1 or 2 for the preparation of a medicament for the anti-thrombotic treatment of tumors.

4. A tumor antithrombotic DNA nucleic acid drug, characterized in that the tumor antithrombotic DNA nucleic acid drug comprises a segment of anticoagulation nucleic acid aptamer, the anticoagulation nucleic acid aptamer has the sequence: