CN114317813A - Detection primer of swine influenza virus and kit thereof - Google Patents

Abstract

The invention provides a detection primer of swine influenza virus, which belongs to the technical field of gene detection, wherein the detection primer comprises a forward primer, a reverse primer and a probe primer for amplifying swine influenza virus genes; the kit can detect a swine influenza virus nucleic acid sample with low concentration, has high specificity and sensitivity and high primer amplification efficiency, greatly improves the detection rate of the swine influenza virus, and provides a reliable method for clinically detecting the swine influenza virus.

Description

Detection primer of swine influenza virus and kit thereof

Technical Field

The invention relates to the technical field of gene detection, in particular to primers and a kit for detecting swine influenza virus by digital PCR.

Background

Swine Influenza (SI) is an acute respiratory infectious disease of Swine caused by Swine Influenza Virus (SIV), and not only brings great harm to the Swine industry, but also seriously harms human health, thus drawing public health attention in the world. Infection with Swine Influenza Virus (SIV) can cause respiratory diseases characterized by respiratory diseases such as coughing, sneezing, runny nose, increased rectal temperature, drowsiness, dyspnea and loss of appetite. The virus is sensitive to heat, disinfectants, and is highly resistant to dryness and low temperatures. Swine influenza virus can be propagated on cells of various animals, but in virus isolation and vaccine production, chick embryo inoculation is often employed. The virus has hemagglutinating activity, but the antigenicity of different strains is not obviously distinguished. Because viruses are subjected to great stress by antibodies, viruses are subject to frequent mutation, the mechanisms of which involve antigenic drift and antigenic shift at the molecular level.

The swine influenza virus belongs to the genus influenza A virus of the family Orthomyxoviridae, and the virus particle is polymorphic. The genome comprises eight segmented negative strand RNAs encoding at least 12-13 proteins. Influenza a viruses can be classified into 16 HA subtypes (H1 to H16) and 9 NA subtypes (N1 to N9) according to the difference in virus surface glycoproteins. Influenza a viruses infect a variety of hosts including birds, pigs, and humans, among others. Because the respiratory epithelial cells of the pigs have receptors which are combined with the avian influenza virus and the human influenza virus, the human influenza virus and the avian influenza virus can infect the pigs. Also, more and more reports indicate that SIV can be transmitted back to birds and humans. Since 1974, SIV infected people have been reported worldwide and caused death in some cases. More importantly, influenza pandemic strains in 1957, 1968 and 2009 were all presumed to be associated with swine influenza virus. Three-source reassortment of swine influenza subtype variant strain H3N2/H1N2, which has received global attention since 8 months of 2011, caused infection of 318 persons in 13 areas of the United states, of which 1 person died and 16 persons were hospitalized.

In recent years, fluorescence quantitative PCR (polymerase chain reaction, QPCR) is a commonly used technical means for detecting and quantifying swine influenza virus, and the technique is characterized in that a fluorescence-labeled probe (such as TaqMan) is added into a PCR reaction system, a fluorescence signal accumulated in real time is utilized to monitor the whole amplification process, and finally, an unknown template is quantitatively analyzed through a standard curve so as to evaluate the amplification effect of PCR. Fluorescent quantitative PCR is a relatively quantitative method, which relies mainly on a standard curve prepared from a calibrator to determine the concentration of an unknown sample. There are numerous disadvantages to this technique: 1. the difference in background between the calibrator and the sample is liable to affect the efficiency and measurement response of PCR; 2. a low copy number of the target nucleic acid molecule cannot be detected by amplification; 3. the PCR amplification efficiency of the sample may be different from the amplification efficiency of the calibrator; impurities introduced into the RNA solution during RNA extraction or RNA degradation affect the PCR dynamic amplification process. Therefore, the detection and absolute quantification of the swine influenza virus with low copy number can hardly be achieved by the fluorescent quantitative PCR.

Digital polymerase chain reaction (dPCR) is a new technique for absolute quantification of single-molecule target nucleic acids. The technology is that a PCR solution containing a DNA template is diluted and then distributed to a large number of independent reaction chambers (such as chips), liquid molecules follow Poisson distribution, single molecules are separated by dilution, and PCR amplification is carried out independently, the distribution of the sample can greatly reduce the influence of background signals, improve the amplification sensitivity of low-abundance targets, finally each amplification product is analyzed, and the original copy number of the DNA template is calculated by a Poisson probability distribution formula without adopting a reference standard substance or an external standard substance. The detection rate is greatly improved, and the false negative detection level (single DNA template is present in the reaction chamber and is not detected) is very low. The method has the advantages of convenient operation, high detection flux, strong specificity, high sensitivity, accurate quantification and the like.

As a new technology for nucleic acid quantification, the digital PCR overcomes a series of defects of real-time fluorescence quantification PCR and realizes absolute quantification of single nucleic acid molecules. The problems that the standard curve used by the fluorescent quantitative PCR affects the measurement result and the like are avoided. The technology can replace fluorescent quantitative PCR to be applied to the quantitative detection of the swine influenza virus.

Disclosure of Invention

Based on the technical problems, the invention provides a group of PCR primers and probes with strong specificity and high amplification efficiency, and a high-sensitivity digital PCR technology is combined to achieve the purpose of detecting and absolutely quantifying the low-copy-value swine influenza virus.

The invention provides a detection primer of swine influenza virus, which comprises a forward primer, a reverse primer and an amplification probe primer of swine influenza virus, wherein the forward primer and the reverse primer are positioned at 34-54 and 115-135 basic groups of swine influenza virus genes, and the sequences of the forward primer and the reverse primer are shown as SEQ ID NO: 001 and SEQ ID NO: 002.

The amplification probe primer is positioned at 66-84 bases of a swine influenza virus gene, and the sequence of the amplification probe primer is shown as SEQ ID NO: 003. The primer amplification gene sequence is located at 34-135 bases of a new coronavirus gene, and the size of an amplification fragment is 102 bases, such as SEQ ID NO: 004.

In the above-mentioned swine influenza virus detection primer, the swine influenza virus primer sequence is selected from the group consisting of 34-54 and 115-135 bases of swine influenza virus genes in PubMed database, and the sequence thereof is shown as SEQ ID NO: 001 and SEQ ID NO: 002. The 3' end of the primer does not have self-complementary overlapping sequence, so that the generation of hairpin structure and primer dimer can be avoided.

In the swine influenza virus detection primer, the forward primer and the reverse primer are respectively shown as SEQ ID No.001 and SEQ ID No. 002.

SIV-forward: CTTTCTATCATCCCGTCAGGC (SEQ ID NO.001)

SIV-reverse: CCATTCCATGAGAGCCTCAAG (SEQ ID NO.002)

The sequence of the amplification probe primer is shown as SEQ ID NO. 003.

SIV-Probe: CGAGATCGCGCAGAGACTG (SEQ ID NO.003)

The sequence of the amplification region is shown as SEQ ID NO. 004.

Primer amplification sequence:

CTTTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTGGAAA GTGTCTTTGCAGGAAAGAACACAGATCTTGAGGCTCTCATGGAATGG(SEQ ID NO.004)

in the swine influenza virus detection primer, the use method of the detection primer comprises the following steps:

1) extracting sample RNA;

2) reverse transcription of RNA into cDNA;

3) using SEQ ID NO: the positive and reverse amplification primers and the amplification probe primer shown in 001-003-;

4) scanning and analyzing the amplification product in the step 3) by using a biochip reader to obtain a copy value of the amplification product.

The invention also provides a kit for detecting swine influenza virus, which comprises the detection primer.

Further, the detection kit comprises a sample RNA extraction reagent, an RNA reverse transcription reagent, absolute ethyl alcohol, a detection system PCR reaction solution, a positive reference substance and a negative reference substance;

wherein the PCR reaction solution of the detection system comprises: 1 pair of amplification primers and 1 probe primer, and the sequences are shown as SEQ ID NO: 001-.

Preferably, the detection system PCR reaction solution further comprises: 2x Multiplex PCR Plus Buffer; dNTP Mix; HotStar Taq Plus DNA Polymerase.

The invention designs the forward primer, the reverse primer and the probe primer for detecting the swine influenza virus, and can be simultaneously used for fluorescent quantitative PCR and digital PCR amplification reaction. The amplification efficiency of the primer is better than that of other primers through fluorescent quantitative PCR amplification comparison. The absolute copy value of the swine influenza virus can be accurately detected by performing digital PCR detection on the plasmid standard product and the submission sample. The amplification efficiency can be optimized by adjusting the reaction conditions such as the concentration of forward and reverse primers and probes, the annealing temperature and the like.

The invention has the following beneficial effects: the designed forward and reverse amplification primers for the swine influenza virus can efficiently amplify a target gene, have high specificity and accuracy, and have higher amplification efficiency than other amplification primers; the method for amplifying the target gene by adopting the digital PCR method has the advantages of high sensitivity, absolute quantification and the like. Greatly improves the detection efficiency of the swine influenza virus and provides a reliable method for clinically detecting the swine influenza virus.

Description of the drawings:

FIG. 1 is a comparison of the amplification of an example of the invention with a literature reporter primer;

Detailed Description

The following preferred embodiments are merely illustrative of the technical solutions of the present invention and are not restrictive, and although the present invention has been described in detail with reference to the following preferred embodiments, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the present invention as defined by the appended claims.

Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings. It should be noted that the embodiments and features of the embodiments in the present application may be arbitrarily combined with each other without conflict.

Example 1

Primer sequence for detecting amplification of swine influenza virus

Comprises the amino acid sequence of SEQ ID NO: 001-003 is a sequence of a forward primer, a reverse primer and a probe primer for amplifying the swine influenza virus.

The forward and reverse primers designed by the invention have random base distribution, 3 'ends of the primers do not have continuous 3 or more GC base aggregation, and the 3' ends do not have self-complementary overlapping sequences, so that hairpin structures and primer dimers can be avoided. Related literature (PMC7119756) reports primers as set forth in SEQ ID NO: 005-007, the forward and reverse primers have too high GC content, so that primer dimers are easily generated, which is not favorable for the fluorescent quantitative PCR amplification.

The literature reports forward primers: TCAGGCCCCCTCAAAGCCGA (SEQ ID NO.005)

The literature reports reverse primers: GGGCACGGTGAGCGTGAACA (SEQ ID NO.006)

The literature reports that probes: CGCGCAGAGACTGGAAAGTGTC (SEQ ID NO.007)

In the detection, the forward and reverse primers and the probe primers described in the above claims are compared with the primer probes of the related literature, the artificial synthetic swine influenza virus gene (Shanghai bioengineering GmbH) is used as a template, and simultaneously, the fluorescence quantitative PCR amplification is carried out to obtain an amplification curve chart (figure 1), and the amplification efficiency of the primers described in the above claims is obviously better than that of the primers reported in the literature.

Example 2

Detection kit for testing swine influenza virus based on digital PCR technology

The method comprises the following steps: a sample RNA extraction kit (Kajie's RNA extraction kit, cat No. 52904); absolute ethyl alcohol; RNA reverse transcription kit (Kajie's reverse transcription kit, cat # 205411); digital PCR micro-drop chip kit (chip kit provided by Hangzhou navigation Gene Co., Ltd., product number D1); a detection system PCR reaction solution, a positive control substance and a negative control substance. Wherein the PCR reaction solution of the detection system comprises: 2x Multiplex PCR Plus Buffer; dNTP Mix; HotStar Taq Plus DNA Polymerase; SEQ ID NO: 001-003 of the sequence of the primer pair.

Example 3

Method for detecting swine influenza virus based on microdroplet digital PCR technology

(1) Extraction of genomic RNA from throat swab standards

1) 560. mu.L of Buffer AVL primed with Carrier RNA was pipetted into a 1.5ml centrifuge tube.

2) Add 140. mu.L throat swab standard and vortex mix for 15 s.

3) Incubate at room temperature for 10 min.

4) A brief centrifugation concentrates the adhering droplets on the inner wall of the centrifuge tube to the bottom of the tube.

5) Add 560. mu.l of absolute ethanol and mix by vortexing for 15 s.

6) Aspirate 630. mu.l of step 5, add to the filter column in a 2ml collection tube, cap, and centrifuge at 6000Xg (8000 rpm) for 1 minute.

7) And 6, repeating the step.

8) Add 500. mu.l Buffer AW1, 6000Xg (8000 rpm) and centrifuge for 1 min.

9) Add 500. mu.l Buffer AW2, 20000Xg (14000 rpm) and centrifuge for 3 minutes.

10) The filter column was placed in a fresh 1.5ml sterile centrifuge tube and 60. mu.l Buffer AVE added and incubated for 1min at room temperature.

11) The sample lysates were collected by centrifugation at 6000Xg (8000 rpm) for 1 minute.

(2) Reverse transcription of RNA

1) The RNA sample, Reverse Transcription Mix and RNase-free water were thawed at room temperature, and gDNA remove Mix and Reverse Transcription Enzyme were placed on ice in advance.

2) A genome DNA-free reaction liquid system was prepared as follows

3) Incubate at 45 ℃ for 2min and immediately place on ice for use.

4) The reverse transcription reaction liquid system is prepared according to the following table

Name of reagent	Dosage of
		Reverse Transcription Enzyme	1μl
Reverse Transcription Mix	4μl
		Template RNA(step 3)	15μl
Total of	20μl

5) After mixing, the reaction is carried out according to the following procedure

Step	Time	Temperature
			Annealing step	3min	25℃
Reverse-transcription step	10min	45℃
			Inactivation of reaction	5min	85℃

(3) Preparing a reagent:

the detection system PCR reaction solution is prepared as follows:

name of reagent	Dosage of
		2X Multiplex PCR Master Mix	12.5μl
Forward primer (6. mu.M)	2.5μl
		Reverse primer (6. mu.M)	2.5μl
Probe primer (3. mu.M)	2.5μl
		Sample cDNA template	5.0μl
Total of	25.0μl

Wherein, the base sequences of the forward and reverse amplification primers and the probe primers are shown as SEQ ID NO: 001-.

Preparing PCR reaction liquid X mu l according to the parts of detected samples, and subpackaging 20 mu l of each part:

x20. mu.l reaction solution X (n specimen +1 part positive control +1 part negative control)

And n is the number of detected samples.

(4) Sample adding: adding 5 mu l of the cDNA sample obtained in the step (2) into a PCR reaction solution of a detection system; for positive control experiments, 5 mul of positive control substance is directly added; for the negative control experiment, 5. mu.l ddH2O was added directly.

(5) Loading a chip: and (3) sucking 14 mu l of the PCR reaction solution prepared in the step (4) by using a pipette, loading the sample into a chip, adding 16 mu l of glycerin to seal the chip, and placing the chip on a droplet generator to generate droplets.

(6) Digital PCR amplification: the amplification was performed on a PCR instrument dedicated to the droplet chip, using a TC1.0 PCR instrument (Hangzhou navigation Gene technology Co., Ltd.). The reaction conditions were as follows: pre-denaturation at 95 ℃ for 5 min and 30 sec; 45 cycles of 95 ℃ for 30 seconds, 55 ℃ for 90 seconds, and 72 ℃ for 30 seconds; storing at 4 ℃.

(7) Fluorescence scanning and image analysis:

and (4) placing the chip amplified in the step (6) in a biochip reader for fluorescence scanning photographing and data analysis, and calculating the absolute copy number of the swine influenza virus molecules in the sample after the analysis is finished.

Example 4

The swine influenza virus detection kit based on the digital PCR technology is adopted to detect clinical specimens.

12 samples of the pharyngeal swab were taken, 7 positive samples and 5 negative samples were confirmed clinically. The 12 samples were reverse transcribed by RNA extraction, reagent preparation and detection as described in example 3. Each sample is added into 5 mul of PCR reaction solution of the detection system, and positive and negative controls are performed at the same time. Each sample was repeated 2 times. The detection results of the digital PCR primers show that 7 positive cases and 5 negative cases are consistent with the diagnosis result, and the accuracy rate is 100%. The result of primer detection reported in literature shows 4 positive cases and 8 negative cases, and the accuracy rate is 75.0%. The detection result of the digital PCR primer is obviously higher than that of a primer reported in the literature.

The test results are shown in the following table 1:

the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (6)

1. The detection primer of the swine influenza virus is characterized by comprising a forward primer, a reverse primer and an amplification probe primer of the swine influenza virus, wherein the sequence of the swine influenza virus primer is derived from 34-54 and 115-135 basic groups of a swine influenza virus genome in an international PubMed database, and the NCBI code of the genome number is FJ 966975.

2. The detection primer as claimed in claim 1, wherein the forward primer and the reverse primer are located at bases 34-54 and 115-135 of the swine influenza virus gene, and the sequences are shown as SEQ ID NO: 001 and SEQ ID NO: 002 shows that the amplification probe primer is located at 66-84 bases of swine influenza virus gene, and the sequence is shown as SEQ ID NO: 003.

3. The detection primer according to claim 1, wherein the detection primer is used by a method comprising:

1) extracting sample RNA;

2) reverse transcription of RNA into cDNA;

3) using SEQ ID NO: the positive and reverse amplification primers and the amplification probe primer shown in 001-003-;

4) scanning and analyzing the amplification product in the step 3) by using a biochip reader to obtain a copy value of the amplification product.

4. A kit for detecting swine influenza virus, comprising the detection primer of any one of claims 1 to 3.

5. The swine influenza virus detection kit of claim 4, wherein the detection kit comprises a sample RNA extraction reagent, an RNA reverse transcription reagent, absolute ethanol, a detection system PCR reaction solution, a positive control and a negative control;

wherein the PCR reaction solution of the detection system comprises: 1 pair of amplification primers and 1 probe primer, and the sequences are shown as SEQ ID NO: 001-.

6. The kit according to claim 4, wherein the detection system PCR reaction solution further comprises: 2x Multiplex PCR Plus Buffer; dNTP Mix; HotStar Taq Plus DNA Polymerase.

Images