CN114317785A - Primer probe composition, kit and method for detecting gonococcus - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, and particularly provides a primer probe composition, a kit and a method for detecting gonococci. The primer probe composition for detecting gonococcus provided by the invention can be used for quickly amplifying a target gene, and the designed internal standard is used as an internal control in a PCR amplification system, so that false negative caused by interference substances possibly existing in a sample can be prevented; the kit and the detection method which take the primer probe composition as the main component have the advantages of simple sample treatment process, strong specificity on gonococcus nucleic acid, short time consumption, capability of accurately detecting the gonococcus nucleic acid in unknown samples such as genital secretion and the like, no cross reaction with other pathogens which can be propagated by sex and easily cause the same or similar clinical symptoms, and the problems of complicated sample treatment, poor specificity and the like in the prior art are solved. In addition, the kit has high sensitivity, the detection limit is 200copies/ml, and reliable experimental basis is provided for diagnosing gonococcus.

Description

Primer probe composition, kit and method for detecting gonococcus

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a primer probe composition, a kit and a method for detecting gonococci.

Background

Gonococci (Neisseria gonorrhoeae, NG), commonly known as gonococci, were discovered by Neisser in 1987 and are the causative pathogens of human gonorrhea, belonging to the genus Neisseria. Gonococci have strict human parasitism and strong adaptability and invasion capacity to human bodies, and main pathogenic substances of the gonococci comprise pili, outer membrane protein, protease, lipopolysaccharide and the like, so the gonococci are one of sexually transmitted diseases with high morbidity. NG is primarily infected directly by sexual contact, but also by infection of the fetus at birth through the birth canal.

At present, the laboratory diagnosis methods of gonococci mainly comprise a separation culture method, a smear microscopy method, an immunological method, a detection method based on a PCR technology and the like. The isolation culture method is simple to operate, has high specificity, is considered as a gold standard for diagnosing gonococci, but has long culture time, low sensitivity and easy delay of illness; the smear microscopy method is simple and easy to implement and low in cost, but the specificity of the smear microscopy method is influenced by various factors such as material taking, smear and staining, and the gonococci under the smear are easily confused with other gram negative diplococci, so that misdiagnosis and missed diagnosis are easy to occur; the immunological method mainly comprises immune colloid and enzyme-linked immune method, and has simple operation and better sensitivity than culture method. In recent years, the fluorescence PCR method gradually shows the advantages of the fluorescence PCR method in detection, is a more sensitive, specific and accurate nucleic acid detection technology, can dynamically reflect the dynamic change of pathogens before and after treatment of a patient and the clinical relation, provides more accurate and objective detection results for clinical application, and timely learns the disease condition and prognosis.

At present, kits for detecting NG-DNA based on real-time fluorescence quantitative PCR technology are applied to clinical detection at home and abroad, the sensitivity is about 500-.

Disclosure of Invention

The invention aims to solve the problems of low gonococcus detection sensitivity, lack of a perfect quality control system and the like in the prior art.

Therefore, the invention provides a primer probe composition for detecting gonococcus, which comprises a target gene primer probe composition; the target gene primer probe composition comprises:

the sequence of the target gene upstream primer is as follows: ACGCTCCATATCGCTATGAAC, respectively;

the sequence of the target gene downstream primer is as follows: TATCTGTGGAGCTTGCTAGGTATA, respectively;

the target gene probe has the sequence as follows: CTATGACTATCAACCCTGCCGCC are provided.

Specifically, the primer probe composition for detecting gonococci further comprises an internal standard primer probe composition; the internal standard primer probe composition comprises:

an internal standard upstream primer with the sequence as follows: TGACAATGTTGGCAAGACTGTTG, respectively;

an internal standard downstream primer with the sequence as follows: GCCGACAAACTGGGAATGAAC, respectively;

an internal standard probe, the sequence of which is: TGGAGATCGTTTTGTGGCTTGTGA are provided.

Specifically, the internal standard is a recombinant plasmid and is used as an internal control in a PCR amplification system to prevent false negative caused by PCR interfering substances possibly existing in a sample, and the sequence of the internal standard is TGACAATGTTGGCAAGACTGTTGATGGAGAGCCTTTTGTGGCTTGTGATTTTTG TTCATTCCCAGTTTGTCGGC.

The invention also provides a kit for detecting gonococci, which comprises PCR reaction liquid; the PCR reaction solution comprises the primer probe composition for detecting gonococci.

Specifically, the PCR reaction solution further includes 10 XPCR reaction buffer solution and dNTP.

Specifically, the kit for detecting gonococci further comprises a nucleic acid extracting solution, wherein the nucleic acid extracting solution comprises 10-50mM of Tris, 0.1-1M of NaCl, 0.1-1mM of EDTA, 10-50mM of NaOH, 0.01-0.5mM of sanskaton, 5-20% of Chelex-100 and 0.01-2% of sodium dodecyl sulfate. The nucleic acid extracting solution greatly simplifies the steps of nucleic acid detection and greatly improves the sensitivity.

Specifically, the kit for detecting gonococci further comprises enzyme mixed liquor, wherein the enzyme mixed liquor comprises 5U/mu l of DNA polymerase and 1U/mu l of hot start modified antibody, and can effectively inhibit non-specific annealing of primers and non-specific amplification caused by primer dimers under a low-temperature condition.

Specifically, the kit for detecting gonococci further comprises a positive control and a negative control; the positive control is a gonococcus strong positive sample; the negative control is an inactivated negative sample without gonococci, herpes simplex virus and chlamydia trachomatis.

The invention also provides a method for detecting gonococci, comprising the following steps:

(1) extracting DNA of a sample to be detected;

(2) carrying out fluorescence quantitative PCR reaction by taking DNA of a sample to be detected as a template, wherein the PCR reaction system comprises any one of the primer probe composition for detecting gonococcus;

(3) after the PCR reaction is finished, the detection result is judged according to the Ct value.

Specifically, the PCR reaction procedure in step (2) is as follows: at 95 ℃ for 3 min; 94 ℃, 15sec, 60 ℃, 30sec, 40 cycles.

Compared with the prior art, the invention has the following advantages and beneficial effects:

the primer probe composition for detecting gonococcus provided by the invention can be used for quickly amplifying a target gene, and the designed internal standard is used as an internal control in a PCR amplification system, so that false negative caused by PCR interfering substances possibly existing in a sample can be prevented. The kit and the detection method for detecting the gonococcal nucleic acid, which take the primer probe composition as the main component, have the advantages of simple sample treatment process, strong specificity on the gonococcal nucleic acid, less time consumption of the detection method, capability of accurately detecting the gonococcal nucleic acid in unknown samples such as genital secretion and the like, no cross reaction with other pathogens which can be propagated by sex and easily cause the same or similar clinical symptoms, and the problems of complicated sample treatment method, poor kit specificity and the like in the prior art are solved. In addition, the kit has high sensitivity, the detection limit is 200copies/ml, and reliable experimental basis is provided for diagnosing gonococcus.

The present invention will be described in further detail below with reference to the accompanying drawings.

Drawings

FIG. 1 shows the results of PCR reaction in example 2 of the present invention.

Detailed Description

The technical solutions in the present invention will be described clearly and completely with reference to the following embodiments, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Although representative embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes may be made thereto without departing from the scope of the invention. Therefore, the scope of the present invention should not be limited to the embodiments, but should be defined by the appended claims and equivalents thereof.

The invention provides a primer probe composition for detecting gonococcus, which comprises a target gene primer probe composition; the target gene primer probe composition comprises:

the sequence of the target gene upstream primer is as follows: ACGCTCCATATCGCTATGAAC, respectively;

the sequence of the target gene downstream primer is as follows: TATCTGTGGAGCTTGCTAGGTATA, respectively;

the target gene probe has the sequence as follows: CTATGACTATCAACCCTGCCGCC are provided.

In order to prevent false negatives caused by PCR interfering substances that may be present in the sample, the primer probe composition further comprises an internal standard primer probe composition; the internal standard primer probe composition comprises:

an internal standard upstream primer with the sequence as follows: TGACAATGTTGGCAAGACTGTTG, respectively;

an internal standard downstream primer with the sequence as follows: GCCGACAAACTGGGAATGAAC, respectively;

an internal standard probe, the sequence of which is: TGGAGATCGTTTTGTGGCTTGTGA are provided.

The sequence of the internal standard is:

TGACAATGTTGGCAAGACTGTTGATGGAGAGCCTTTTGTGGCTTGTGATTT TTGTTCATTCCCAGTTTGTCGGC。

the invention also provides a kit for detecting gonococcus, which comprises PCR reaction liquid, nucleic acid extracting solution, enzyme mixed liquid, positive control and negative control.

Wherein, the PCR reaction solution comprises the primer probe composition for detecting the gonococcus, 10 XPCR reaction buffer solution and dNTP.

The nucleic acid extract comprises 10-50mM Tris, 0.1-1M NaCl, 0.1-1mM EDTA, 10-50mM NaOH, 0.01-0.5mM cyperantin, 5% -20% Chelex-100 and 0.01-2% sodium dodecyl sulfate.

The enzyme mixture comprises 5U/. mu.l of DNA polymerase and 1U/. mu.l of hot start modified antibody, and can effectively inhibit the non-specific annealing of primers and the non-specific amplification caused by primer dimer under low temperature condition.

The positive control is a gonococcus strong positive sample; the negative control is an inactivated negative sample without gonococcus, herpes simplex virus and chlamydia trachomatis.

The invention also provides a method for detecting gonococci, comprising the following steps:

(1) extracting DNA of a sample to be detected;

(2) carrying out fluorescence quantitative PCR reaction by taking DNA of a sample to be detected as a template, wherein the PCR reaction system comprises any one of the primer probe composition for detecting gonococcus; the PCR reaction program is: at 95 ℃ for 3 min; 94 ℃, 15sec, 60 ℃, 30sec, 40 cycles.

(3) After the PCR reaction is finished, the detection result is judged according to the Ct value.

The effect of the primer probe composition, the kit and the method for detecting gonococci of the present invention will be examined by the following specific examples.

Example 1:

the embodiment provides a kit for detecting gonococci, which comprises the following components:

(1) nucleic acid extracting solution: 25mM Tris, 0.5M NaCl, 0.5mM EDTA, 25mM NaOH, 0.25mM sansantine, 12% Chelex-100, 1% sodium dodecyl sulfonate and 5X 10 concentration⁵Internal standard template of copies/ml(ii) a The internal standard is a recombinant plasmid of a synthetic DNA sequence with the length of 74 base pairs inserted into a pUC18T vector, and the sequence is as follows:

TGACAATGTTGGCAAGACTGTTGATGGAGAGCCTTTTGTGGCTTGTGATTT TTGTTCATTCCCAGTTTGTCGGC；

(2) PCR reaction solution: 5 mul 10 XPCR reaction buffer solution, 0.2mM dNTP, 0.2 muM target gene upstream primer, 0.2 muM target gene downstream primer, 0.2 muM target gene probe, 0.2 muM internal standard upstream primer, 0.1 muM internal standard probe; wherein the 10 XPCR reaction buffer comprises 200mM Tris-cl solution at pH 7.5, 30mM magnesium chloride solution, 500mM potassium chloride solution; the dNTPs include dATP, dCTP, dTTP and dGTP;

the sequence of the target gene upstream primer is as follows: ACGCTCCATATCGCTATGAAC, respectively;

the sequence of the target gene downstream primer is as follows: TATCTGTGGAGCTTGCTAGGTATA, respectively;

the target gene probe sequence is as follows: CTATGACTATCAACCCTGCCGCC, respectively;

the internal standard upstream primer sequence is as follows: TGACAATGTTGGCAAGACTGTTG, respectively;

the internal standard downstream primer sequence is as follows: GCCGACAAACTGGGAATGAAC, respectively;

the internal standard probe sequence is as follows: TGGAGATCGTTTTGTGGCTTGTGA, respectively;

(3) enzyme mixture liquid: 5U/. mu.l of DNA polymerase and 1U/. mu.l of hot start modified antibody;

(4) a positive control; a gonococcus strong positive sample collected in a clinical hospital;

(5) negative control: does not contain inactivated negative clinical samples of gonococcus, herpes simplex virus and chlamydia trachomatis.

Example 2:

this example provides a method of detecting gonococci using the kit of example 1, comprising the steps of:

(1) adding 35.2 mul of PCR reaction solution and 0.8 mul of enzyme mixed solution into a test tube, mixing uniformly, and centrifuging instantly to obtain a PCR-mix part for later use;

(2) adding 1ml of sterile normal saline into a sample test tube to be tested, fully shaking and shaking up, sucking liquid, transferring the liquid into a 1.5ml centrifuge tube, and centrifuging for 5 minutes at 12000 rpm; discarding the supernatant, adding 50 μ l of nucleic acid extractive solution (because the nucleic acid extractive solution contains solid precipitate particulate matter, the particles are distributed uniformly, and repeatedly sucking with a suction head during each sampling), mixing, centrifuging at 2000rpm for 10sec, water bath at 100 deg.C for 10min, centrifuging at 12000rpm for 10min, and collecting the supernatant of the sample; respectively taking 50 mul of negative control and 50 mul of positive control, adding 50 mul of nucleic acid extracting solution into the negative control and the 50 mul of positive control, uniformly mixing, carrying out water bath at 100 ℃ for 10min, and centrifuging at 12000rpm for 10min for later use;

(3) respectively adding 4 mu l of the supernatant, the negative control and the positive control of the sample to be detected, which are processed in the step (2), into three PCR-mix parts, and putting the test tube into a fluorescence quantitative PCR instrument for PCR amplification, wherein the reaction program is as follows: at 95 ℃ for 3 min; 94 ℃, 15sec, 60 ℃, 30sec, 40 cycles; the detection fluorescence of the target gene is FAM, and the detection fluorescence of the internal standard is HEX/VIC; the results are shown in FIG. 1.

The threshold setting principle is that the threshold line just exceeds the highest point of the normal negative control.

The positive control Ct value is less than 38, the negative control Ct value is countless and the internal standard CT value is less than 40; the fluorescence curve above the threshold should have a pronounced sigmoidal curve, otherwise the experiment should be considered invalid and errors in instrumentation, reagents, amplification conditions, etc. should be checked.

When the method provided by the invention is adopted to detect the gonococcus, the judgment standard is as follows:

1. the sample with Ct less than or equal to 38.0 is judged to be positive;

2. the detection sample with Ct more than 38.0 and less than or equal to 40 is recommended to be redone, if the Ct value of the redone result is less than 40, the redone result is positive, otherwise, the redone result is negative;

3. if the CT value measured by the detection sample has no data, the internal standard CT value needs to be checked, the sample with the internal standard CT value less than 40 is a negative sample, and if the internal standard CT value has no data, the false negative condition is suspected, and the test should be repeated.

The above list is merely illustrative of the present invention and should not be construed as limiting the scope of the present invention, any design similar or equivalent to the present invention is within the scope of the present invention.

Claims (10)

1. A primer probe composition for detecting gonococcus comprises a target gene primer probe composition; the target gene primer probe composition is characterized by comprising the following components:

the sequence of the target gene upstream primer is as follows: ACGCTCCATATCGCTATGAAC, respectively;

the sequence of the target gene downstream primer is as follows: TATCTGTGGAGCTTGCTAGGTATA, respectively;

the target gene probe has the sequence as follows: CTATGACTATCAACCCTGCCGCC are provided.

2. The primer-probe composition for detecting gonococci of claim 1, further comprising an internal standard primer-probe composition; the internal standard primer probe composition comprises:

an internal standard upstream primer with the sequence as follows: TGACAATGTTGGCAAGACTGTTG, respectively;

an internal standard downstream primer with the sequence as follows: GCCGACAAACTGGGAATGAAC, respectively;

an internal standard probe, the sequence of which is: TGGAGATCGTTTTGTGGCTTGTGA are provided.

3. The primer probe composition for detecting gonococci of claim 2, wherein the internal standard has a sequence of:

TGACAATGTTGGCAAGACTGTTGATGGAGAGCCTTTTGTGGCTTGTGATTTTTGTTCATTCCCAGTTTGTCGGC。

4. a kit for detecting gonococci, characterized in that: comprises a PCR reaction solution; the PCR reaction solution comprises the primer probe composition for detecting gonococci according to any one of claims 1 to 3.

5. The kit for detecting gonococci according to claim 4, wherein: the PCR reaction solution also comprises 10 XPCR reaction buffer solution and dNTP.

6. The kit for detecting gonococci according to claim 4, wherein: also comprises nucleic acid extracting solution; the nucleic acid extracting solution comprises 10-50mM Tris, 0.1-1M NaCl, 0.1-1mM EDTA, 10-50mM NaOH, 0.01-0.5mM cyperantin, 5% -20% Chelex-100 and 0.01-2% sodium dodecyl sulfate.

7. The kit for detecting gonococci according to claim 4, wherein: also comprises nucleic acid extracting solution; the enzyme mixture comprises 5U/. mu.l of DNA polymerase and 1U/. mu.l of hot start modified antibody.

8. The gonococcus detection kit according to claim 4, wherein: positive and negative controls are also included; the positive control is a gonococcus strong positive sample; the negative control is an inactivated negative sample without gonococci, herpes simplex virus and chlamydia trachomatis.

9. A method for detecting gonococci, comprising the steps of:

(1) extracting DNA of a sample to be detected;

(2) performing a fluorescent quantitative PCR reaction by using DNA of a sample to be detected as a template, wherein the PCR reaction system comprises the primer probe composition for detecting gonococci as claimed in any one of claims 1 to 3;

(3) after the PCR reaction is finished, the detection result is judged according to the Ct value.

10. The method for detecting gonococci according to claim 9, wherein the PCR reaction procedure in step (2) is: at 95 ℃ for 3 min; 94 ℃, 15sec, 60 ℃, 30sec, 40 cycles.

Images