CN114317470A

CN114317470A - Compound oxalicine B biosynthesis gene cluster and C-15 hydroxylase OxaL and application

Info

Publication number: CN114317470A
Application number: CN202111627219.0A
Authority: CN
Inventors: 余利岩; 张涛; 张德武; 谷国威; 苏静
Original assignee: Institute of Medicinal Biotechnology of CAMS
Current assignee: Institute of Medicinal Biotechnology of CAMS
Priority date: 2021-12-28
Filing date: 2021-12-28
Publication date: 2022-04-12
Anticipated expiration: 2041-12-28
Also published as: CN114317470B

Abstract

The invention discloses a biosynthetic gene cluster of a compound oxalicine B, C-15 hydroxylase OxaL and application thereof. The invention provides an application of OxaL protein shown in a sequence 3 or related biological materials thereof: use as hydroxylase; (a2) application in preparing hydroxylase. The invention also protects a 15-deoxyyoxaline B biosynthesis gene cluster shown in the sequence 1. The invention also protects the application of the 15-deoxyoxalicine B biosynthetic gene cluster in synthesizing the compound oxalicine B. All gene and protein information provided by the invention can help people to understand the biosynthesis mechanism of a-pyrone heteroterpene family natural products, and provide materials and knowledge for further genetic modification. The gene and the protein thereof provided by the invention can also be used for searching and discovering compounds or genes and proteins which can be used for medicine, industry or agriculture.

Description

Compound oxalicine B biosynthesis gene cluster and C-15 hydroxylase OxaL and application

Technical Field

The invention belongs to the fields of microbial gene resources, genetic engineering and biological enzyme development, and particularly relates to an anti-HIV (human immunodeficiency Virus) -compound oxalicine B biosynthetic gene cluster and C-15 hydroxylase OxaL and application thereof.

Background

Oxalicine B has a unique chemical structure, is a novel structural compound with a six-ring system framework and is formed by polymerizing a pyridyl-alpha-pyrone unit and a diterpene unit, and the molecular formula is C₃₀H₃₃NO₇And the molecular weight is 519.

Oxalicine B belongs to a-pyrone-containing hetero terpene compound family (the structural schematic diagram of the a-pyrone-containing hetero terpene compound family is shown in figure 1). With the discovery and identification of other compounds of this family, this unique chemical structure has attracted many organic chemists to engage in their chemical synthesis studies. Oxalicines are secondary metabolites of fungi, mainly isolated from the genus Penicillium, and were first extracted from the mycelium of Penicillium oxalicum (Penicillium oxalicum) by Ubillas in 1989. To date, researchers have isolated oxalicines class of molecules from penicillium sp. The oxalicines compound mainly has insect-resistant activity, and researches show that the oxalicines B compound has strong insecticidal activity on Spodoptera frugiperda and also has certain cytotoxic activity. Meanwhile, early-stage research in laboratories finds that the oxalicine compound has antiviral activity, oxalicine B has anti-HIV (HIV-1) activity, and oxalicine A has good anti-influenza A virus (H1N1) activity.

The 15-deoxyoxalicine B was identified in 2015 by Yaegashi, J et al from Penicillium sp.canescens ATCC 10419The gene cluster (olc) is synthesized, and the 15-deoxyoxalicine B biosynthetic pathway is elucidated and analyzed by using bioinformatics and gene knockout strategies. The biosynthetic pathway of the biosynthetic gene cluster of 15-deoxyoxalicine B is shown in FIG. 2. The source of the non-terpene moieties (a-pyrone and nicotinamide elements) in the biosynthesis of the heteroterpene molecule 15-deoxyoxalicine B is the same as for pyripyropene A, but a significant difference occurs after the formation of the intermediate compound molecule 4-hydroxy-6- (3-pyridinyl) -2H-pyran-2-one (HPPO). Geranyl pyrophosphate (GGPP) is used as a donor, and is connected with HPPO under the action of Ubia protein isopentenyl transferase Olch, and the GGPP is completed by diterpene synthase coded by olcC gene. Subsequently, the flavin FAD dependent monooxygenase OlcE, which participates in the oxidation of the terminal double bond of a long-chain diterpene to form a ternary oxygen ring, and the diterpene cyclase OlcD, which cyclizes the long-chain diterpene, act in combination to form the key five-membered ring intermediate compound molecule predecaturerin E. P450 oxidase OlcG participates in the spiro formation of the right side of the 15-deoxyoxalicine B molecule to generate a decaturin E intermediate. Thereafter, a cascade reaction system involving a plurality of oxidoreductases comprises P450 oxidase (OlcJ) and short-chain dehydrogenase/reductase (OlcF) to generate the intermediate compound decaturin C with a hemiacetal structure. Finally, in dependence on Fe²⁺Under the combined action of alpha-KG dioxygenase (OlcK), transmembrane protein drug-resistant pump (OlcL) and P450 oxidase (OlcB), the target compound molecule 15-deoxyyoxaline B is generated.

Disclosure of Invention

The invention aims to provide a compound oxalicine B biosynthesis gene cluster and C-15 hydroxylating enzyme OxaL and application thereof.

The invention provides an OxaL protein or an OxaL protein-related biomaterial, which is (a1) or (a 2):

(a1) use of an OxaL protein or an OxaL protein-related biomaterial as a hydroxylase;

(a2) use of OxaL protein or an OxaL protein-related biomaterial in the preparation of a hydroxylase;

the OxaL protein is a protein shown in a sequence 3 in a sequence table;

the OxaL protein-related biomaterial is a gene encoding the OxaL protein, an expression cassette expressing the OxaL protein, an expression vector expressing the OxaL protein or a recombinant microorganism expressing the OxaL protein.

Illustratively, the hydroxylase has the following functions: compound 3 was converted to compound 8.

Illustratively, the hydroxylase has the following functions: compound 2 was converted to compound 9.

Illustratively, the hydroxylase has the following functions: converting compound 4 to the compound oxalicine B.

The invention also protects a 15-deoxyyoxaline B biosynthetic gene cluster, which comprises the following 13 genes: an oxaM gene, an oxaE gene, an oxaD gene, an oxaC gene, an oxaF gene, an oxaG gene, an oxaL gene, an oxaH gene, an oxaA gene, an oxaI gene, an oxaJ gene, an oxaK gene, and an oxaB gene;

the oxaM gene (coding strand) is shown as 409-1287 in the sequence 1 of the sequence table; the oxaE gene (template strand) has four exons, which correspond to the 1819-1889 th site, 1966-2227 th site, 2280-2650 th site and 2717-3392 th site of the sequence 1 in the sequence table in sequence; the oxaD gene (template strand) has two exons, which sequentially correspond to the 3699-3900 th site and the 3965-4476 th site of the sequence 1 in the sequence table; the oxaC gene (coding strand) has four exons and sequentially corresponds to the 4847-4897 th site, 4956-5110 th site, 5165-5491 th site and 5551-6001 th site of the sequence 1 in the sequence table; the oxaF gene (template strand) has four exons, which sequentially correspond to the 6024-6250 th site, the 6311-6397 th site, the 6453-6891 th site and the 6945-6971 th site of the sequence 1 in the sequence table; the oxaG gene (coding strand) has five exons and sequentially corresponds to the 7344-7568 th site, the 7620-7736 th site, the 7800-7971 th site, the 8033-8647 th site and the 8706-9145 th site of the sequence 1 of the sequence table; the oxaL gene (template strand) has three exons, which correspond to the 9903-th 10063-th, 10112-th 10563-th and 10625-th 11535-th sites of the sequence 1 in the sequence table in sequence; the oxaH gene (coding strand) has two exons and sequentially corresponds to the 11801-11912 th site and the 11971-12911 th site of the sequence 1 in the sequence table; the oxaA gene (coding strand) is shown as 13529-20836 in the sequence 1 of the sequence table; the oxaI gene (coding strand) has two exons and sequentially corresponds to the 21517-21729 th site and 21798-23435 th site of the sequence 1 in the sequence table; the oxaJ gene (template strand) has two exons, which correspond to the 23483 th and 24757 th sites and 24824 th and 25174 th sites of the sequence 1 in the sequence table in sequence; the oxaK gene (template strand) is shown as the 25296-26171 site in the sequence 1 of the sequence table; the oxaB gene (coding strand) has two exons and corresponds to position 26443-27567 and 27628-27975 in sequence No. 1 of the sequence table.

The 15-deoxyoxalicine B biosynthetic gene cluster is specifically shown as a sequence 1 in a sequence table.

The invention also protects the application of the 15-deoxyoxalicine B biosynthetic gene cluster in synthesizing the compound oxalicine B.

In said application, the synthesis of the compound oxalicine B is carried out in Penicillium.

In said application, the synthesis of the compound oxalicine B is carried out in Penicillium oxalicum.

In the application, the synthesis of the compound oxalicine B is carried out in P.oxalicium 114-2.

The invention also protects the OxaL protein, which is shown as a sequence 3 in a sequence table.

The invention also protects the gene encoding the OxaL protein.

The gene for coding the OxaL protein can be specifically shown as a sequence 2 in a sequence table.

The gene (template strand) encoding the OxaL protein has three exons, which correspond to sequence No. 9903-10063, No. 10112-10563, and No. 10625-11535 of the sequence listing in this order.

The invention also protects a recombinant microorganism expressing the OxaL protein.

The recombinant microorganism is specifically a recombinant microorganism obtained by introducing a gene encoding the OxaL protein into a host microorganism.

The host microorganism may be a yeast, in particular saccharomyces cerevisiae, more in particular s.

The gene encoding the OxaL protein can be specifically introduced into the host microorganism through an expression vector expressing the OxaL protein.

The expression vector for expressing the OxaL protein can be specifically an oxaL gene overexpression vector.

The expression vector for expressing the OxaL protein can be specifically as follows: the recombinant plasmid pXW06-oxaL is obtained by replacing a small fragment between NdeI and PmeI enzyme cutting sites of the yeast expression plasmid pXW06 with a DNA molecule shown in a sequence 2 in a sequence table.

The invention also protects the application of the OxaL protein in the synthesis of the compound oxalicine B.

The invention also protects the application of the recombinant microorganism, which is (b1) or (b2) or (b 3):

(b1) use in converting compound 3 to compound 8;

(b2) use in converting compound 2 to compound 9;

(b3) use in the conversion of compound 4 to the compound oxalicine B.

The invention also protects the total protein of the recombinant microorganism.

The total protein is microsomal.

The preparation method of the total protein sequentially comprises the following steps:

(1) culturing the recombinant microorganism, then centrifugally collecting thalli, and resuspending the thalli by using microsome extracting solution;

(2) cell wall breaking is carried out;

(3) centrifuging and collecting the supernatant containing total protein;

(4) and centrifuging and collecting the precipitate to obtain the total protein.

In the step (1), a liquid YPD medium is used for culturing the recombinant microorganism.

In the step (1), the conditions for culturing the recombinant microorganism are as follows: the culture was carried out at 28 ℃ and 200rpm for 2 days with shaking.

In step (2), cell wall disruption was performed by adding glass beads and vortexing.

In the step (3), the centrifugation conditions are as follows: centrifuging at 4000rpm for 5min at 4 deg.C.

In the step (4), the centrifugation conditions are as follows: centrifuging at 17000rpm for 50min at 4 ℃.

Microsome extract: TES buffer solution containing 10g/L bovine serum albumin, 2mM beta-mercaptoethanol and the balance of pH7.5.

The invention also protects the application of the total protein, which is (b1) or (b2) or (b 3):

(b1) use in converting compound 3 to compound 8;

(b2) use in converting compound 2 to compound 9;

(b3) use in the conversion of compound 4 to the compound oxalicine B.

The compound 3 is shown as a formula I. The compound 8 is shown as a formula II.

The compound 2 is shown as a formula III. The compound 9 is shown as a formula IV.

Compound 4 is represented by formula V. The compound oxalicine B is shown as a formula VI.

The inventor of the invention takes an oxalicine B compound from penicillium oxalicum as a target molecule, and positions an oxalicine B biosynthesis gene cluster oxa by combining genome excavation. In contrast, oxaL (encoding P450 oxidase) and oxaM (encoding NADPH dependent P450 oxidoreductase) in the oxa gene cluster were found to be absent from the biosynthetic gene cluster olc of 15-deoxyoxalicine B. In combination with bioinformatics alignment analysis, it is speculated that OxaL may be responsible for C-15 hydroxylation in the molecule of the oxalicine B compound. Meanwhile, the biosynthesis of the polypeptide is researched by adopting a method combining molecular genetics, bioinformatics, biochemistry and natural product chemistry. Through the biosynthetic studies of natural products of this family, studies from both gene and enzyme catalysis levels can help one understand how nature synthesizes such numerous structurally complex and similar compounds. On the basis of clarifying the biosynthesis pathway in the nature and understanding the natural combined biosynthesis mechanism of a-pyrone type heteroterpene compounds in the nature, people can produce a plurality of structural analogs which do not exist in the nature by using a combined biosynthesis method, and molecular and activity diversity is provided for discovery and drug development of new active 'non-natural' products.

The contribution of the invention is as follows: provides a biosynthetic gene cluster for producing an antibiotic-oxalicine B with anti-HIV-1 activity in penicillium oxalicum P.oxalicium 114-2, and functional research and application of an OxaL protein coded by the biosynthetic gene cluster. The invention reports the biosynthesis gene cluster oxa of the oxalicine B for the first time, and makes the clarification and analysis on the function of C-15 hydroxylation reaction enzyme-P450 oxidase OxaL in the molecule of the oxalicines compound and an enzyme catalytic machine for the first time. The invention provides all gene and protein information related to oxalicine B biosynthesis, which can help people to understand the biosynthesis mechanism of a-pyrone heteroterpene family natural products and provide materials and knowledge for further genetic modification. The gene and the protein thereof provided by the invention can also be used for searching and discovering compounds or genes and proteins which can be used for medicine, industry or agriculture.

Drawings

FIG. 1 is a schematic structural diagram of a family of a-pyrone-containing heteroterpenoids.

FIG. 2 is a schematic diagram showing the biosynthetic pathway of the biosynthetic gene cluster of 15-deoxyoxalicine B.

FIG. 3 is a schematic diagram of the elements of the 15-deoxyoxalicine B biosynthetic gene cluster and the oxalicine B biosynthetic gene cluster.

FIG. 4 is an electrophoretogram of PCR amplification products in example 2 and example 3.

FIG. 5 is an HPLC chromatogram of example 4.

FIG. 6 is a structural formula of each compound prepared in example 5.

FIG. 7 is a graph showing the results of example 6.

FIG. 8 shows the 4 possible biosynthetic pathways from decaturin C to the target compound oxalicine B at the later stage of oxalicine B biosynthesis, as predicted in example 7.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. Yeast Transformation Kit (Frozen-EZ Yeast Transformation II Kit): ZYMO Corp; no. t 2001. Solution I, Solution II and Solution III are all components of the yeast transformation kit. Unless otherwise stated, the quantitative tests in the following examples were performed in triplicate, and the results were averaged.

Penicillium oxalicum (Penicillium oxalicum)114-2, also known as p.oxalicum114-2, is described in the following references: a Production of a high-efficiency cellulose complex via β -glucosidase engineering in Penicillium oxyalicum; guangshan Yao, Ruimei Wu, Qinbiao Kan, Liwei Gao, Meng Liu, Piao Yang, Jian Du, Zhonghai Li, Yinbo Qu; yao et al Biotechnol Biofuels (2016)9: 78.

The Yeast expression plasmid pXW06(Yeast expression plasmid pXW06) is described in the following documents: biosynthesis of Heataclic Duclauxins requirers Extensive modulators of the Phenalone Aromatic Polyketide; Shu-Shan, Gao, Tao, Zhang, Marc, Garcia-Borr as, Yiu-Sun, Hung, John, M; 10.1021/jacs.8b03705; 2018.

saccharomyces cerevisiae RC01, also known as s.cerevisiae RC01, is described in: genome Mining and Assembly-Line biosyntheses of the UCS1025A pyrrolidone Family of Fungal Alkaloids; li, Man-Cheng Tang, Shoubin Tang, Shushan Gao, Sameh Soliman, Leibnizz Hang, Wei Xu, Tao Ye, Kenji Watanabe, Yi Tang.J.Am.Chem.Soc.2018,140,6, 2067-.

MEPA medium (100 ml): 1.5g of malt extract, 0.2g of soybean cake powder, 2g of agar and the balance of water. Dichloromethane-methanol: from 1 part by volume of methylene chloride and 1 part by volume of methanol.

Liquid Trp-auxotrophic medium (100 mL): containing Difco^TM0.67g of basic nitrogen source (BD, 239210), 0.14g of Yeast synthetic Drop-out Medium supplements (Sigma, Y2001), 0.02g of L-leucine, 0.02g of uracil, 0.8g of glucose, and the balance of water. Solid Trp-auxotrophic media differ from liquid Trp-auxotrophic media only by the addition of agar.

Example 1 discovery of the oxalicine B biosynthetic Gene Cluster from P.oxalicium114-2

A contig region was obtained by screening genomic DNA of P.oxalicum114-2 using 15-deoxyoxalicine B biosynthesis key polyketide synthase (Olca) encoding gene. Gene cluster prediction is synthesized using genomic and microbial secondary metabolites. Analysis was performed by the anti SMASH and Softberry (http:// www.softberry.com /) database online tools. Functional Annotation of proteins A homology search for amino acid sequences was performed in the GenBank protein database by means of the BLAST program (http:// www.ncbi.nlm.nih.gov/Blastp /). The Clustalx program was used for amino acid sequence alignment. The oxalicine B biosynthetic gene cluster was found from P.oxalicum 114-2. The oxalicine B biosynthetic gene cluster has 13 genes, and is shown as a sequence 1 in a sequence table (in the sequence 1, part of the genes are coding chains, and part of the genes are template chains).

A schematic diagram of the elements of the 15-deoxyoxalicine B biosynthetic gene cluster and the oxalicine B biosynthetic gene cluster obtained according to the present invention is shown in FIG. 3.

The 13 genes in the oxalicine B biosynthetic gene cluster are: an oxaM gene, an oxaE gene, an oxaD gene, an oxaC gene, an oxaF gene, an oxaG gene, an oxaL gene, an oxaH gene, an oxaA gene, an oxaI gene, an oxaJ gene, an oxaK gene, an oxaB gene.

The proteins encoded by the respective genes are shown in Table 1.

TABLE 1 Gene and functional Annotation for the oxalicine B biosynthetic Gene Cluster

The oxaM gene is shown as the nucleotide at position 409-1287 in the sequence 1 of the sequence table (coding strand; without intron); the oxaM gene encodes an NADPH-P450 oxidoreductase. The oxaE gene is shown as nucleotide at position 1819-3392 in sequence 1 of the sequence table (template strand; intron; exon: 1819-1889, 1966-2227, 2280-2650, 2717-3392); the oxaE gene encodes a FAD-dependent monooxygenase. The oxaD gene is shown as nucleotides 3699-4476 in the sequence 1 of the sequence table (template strand; intron; exon: 3699-3900, 3965-4476); the oxaD gene encodes a terpene cyclase. The oxaC gene is shown as a nucleotide at the position of 4847-year 6001 in a sequence 1 of a sequence table (a coding strand; an intron; an exon: 4847-year 4897, 4956-year 5110, 5165-year 5491, 5551-year 6001); the oxaC gene encodes a diterpene synthase. The oxaF gene is shown as the 6024-6971 site nucleotide in the sequence 1 of the sequence table (template strand; containing intron; exon: 6024-6250, 6311-6397, 6453-6891, 6945-6971); the oxaF gene encodes a short-chain dehydrogenase/reductase. The oxaG gene is shown as the 7344-9145 site nucleotide in the sequence 1 of the sequence table (coding strand; containing intron; exon: 7344-7568, 7620-7736, 7800-7971, 8033-8647, 8706-9145); the oxaG gene encodes a P450 oxidase. The oxaL gene is shown as the nucleotide at position 9903-11535 in the sequence 1 of the sequence table (template strand; containing intron; exon: 9903-10063, 10112-10563, 10625-11535); the oxaL gene codes P450 oxidase shown in sequence 3 of the sequence table. The oxaH gene is shown as the 11801-12911 nucleotide in the sequence 1 of the sequence table (coding strand; containing intron; exon: 11801-11912, 11971-12911); the oxaH gene encodes isopentenyl transferase. The oxaA gene is shown as nucleotide 13529-20836 in sequence 1 of the sequence table (coding strand; without intron); the oxaA gene encodes polyketide synthase. The oxaI gene is shown as the 21517-23435 nucleotide in the sequence 1 of the sequence table (coding strand; intron; exon: 21517-21729, 21798-23435); the oxaI gene encodes CoA ligase. The oxaJ gene is shown as the 23483-25174 site nucleotide in the sequence 1 of the sequence table (template strand; intron; exon: 23483-24757, 24824-25174); the oxaJ gene encodes a P450 oxidase. The oxaK gene is shown as the 25296-26171 th nucleotide in the sequence 1 of the sequence table (template strand; intron-free); the oxaK gene encodes a Fe (II)/a-KG dependent dioxygenase. The oxaB gene is shown as 26443-27975 nucleotide in sequence 1 of the sequence table (coding strand; containing intron; exon: 26443-27567, 27628-27975); the oxaB gene encodes a P450 oxidase.

The biosynthetic pathway of oxalicine B in oxalicium114-2 is as follows: under the action of polyketide synthase coded by oxaA gene, a-pyrone is formed; ② CoA ligase coded by oxaI gene connects nicotinamide to alpha-pyrone to form HPPO intermediate compound; ③ the diterpene synthase coded by the oxaC gene is responsible for the synthesis from a precursor mevalonic acid to a long-chain diterpene; the isopentenyl transferase coded by the oxaH gene is responsible for transferring the long-chain diterpene to an HPPO biosynthesis intermediate; the monooxygenase coded by the oxaE gene and the terpene cyclase coded by the oxaD gene are responsible for oxidizing the tail end double bond of the intermediate long-chain diterpene to form ternary oxygen ring and cyclizing the diterpene to form intermediate predecatoxin E; sixthly, three oxidoreductases coded by the oxaG gene, the oxaJ gene and the oxaF gene participate in a cascade reaction system from predecaurin E to decacaturin C, wherein P450 oxidase (OxaG) participates in the spiro formation on the right side of an oxaicine B molecule; after this, in P450 oxidase (OxaL), Fe-dependent²⁺Under the combined action of the a-KG dioxygenase (OxaK) and the P450 oxidase (OxaB), the target compound molecule oxaticine B is generated, wherein OxaL is responsible for C-15 hydroxylation reaction, OxaK is responsible for introducing C-23 hydroxyl groups, and OxaB participates in left-side spiro formation of the oxaticine B molecule. The OxaM-encoded NADPH-P450 oxidoreductase does not participate in the oxalicineB molecular biosynthetic pathwayThe specific scaffold synthesis, ligation or modification reaction of (1) is a chaperone protein for P450 oxidase.

Example 2 preparation of an oxaA Gene knock-out Strain

Construction of first, knockout vectors

oxaA gene knockout vectors: is a recombinant plasmid pXW 06-delta oxaA obtained by replacing a small fragment between NdeI and PmeI enzyme cutting sites of a yeast expression plasmid pXW06 with a DNA molecule shown in a sequence 4 of a sequence table. In the DNA molecule shown in the sequence 4 of the sequence table, the 1-2200 th nucleotide is the oxaA-UP of the upstream homologous arm of the oxaA gene, the 2201-3802 th nucleotide is the hygromycin resistance gene, and the 3803-5926 th nucleotide is the oxaA-DN of the downstream homologous arm of the oxaA gene.

Second, protoplast transformation

1. Spores of P.oxalicum114-2 were washed with Osmotic buffer, suspended in 10mL of a Trichoderma lyase solution, and cultured at 30 ℃ for 4 hours with shaking at 120 rpm.

Osmatic buffer (pH5.8): containing 1.2M MgSO₄And 20mM sodium phosphate, balance water. 10mL of Trichoderma lyase solution: consists of 10mg of Trichoderma lyase and 10mL of Osmotic buffer. Trichoderma lyase (1U/mg): sigma, L1412-5G.

2. After the step 1 is completed, collecting the upper layer liquid containing the protoplast, adding an equal volume of STC buffer solution, centrifuging at 3000rpm for 5min, and collecting the precipitate (the precipitate is the protoplast).

STC buffer (ph 7.0): contains 1.0M sorbitol and 0.1M Tris-HCl, the balance being water.

3. Suspending the precipitate obtained in step 2 in 200-500. mu.L STC buffer solution, adding 50. mu.L oxaA gene knockout carrier, standing on ice for 20min, and adding 1.0mL 60% PEG₆₀₀₀The buffer solution was spread on a screening medium plate and cultured upright at 28 ℃.

60％PEG₆₀₀₀Buffer (ph 7.5): containing 5mM CaCl₂50mM Tris-HCl and 60g/100mL PEG₆₀₀₀And the balance being water.

Screening a culture medium: PDA medium containing 200. mu.g/ml hygromycin B.

4. The clone that can normally grow in step 3 was transferred to a new screening medium plate and cultured upright at 28 ℃.

After completion of step 4, 130 hygromycin-resistant transformants were selected for normal growth.

Thirdly, screening recombinant bacteria

Randomly picking 10 hygromycin resistant transformants obtained in step two (4), and performing molecular identification by using P.oxalicum114-2 as a wild strain control (WT).

1. Extracting the genome DNA.

2. Taking genome DNA as a template, adopting a primer pair consisting of hph-for and hph-rev (the target sequence is positioned in the hygromycin resistance gene) to carry out PCR amplification, and then sequencing the amplified product. All 10 transformants showed amplification products of the expected size (515bp), and the sequencing showed that the amplification products were indeed the target amplification products.

hph-for：TCGTTATGTTTATCGGCACT；hph-rev：TGTTGGCGACCTCGTATT。

3. PCR amplification was performed using genomic DNA as a template and a primer set consisting of Check ALs for and Check hph rev. The Check ALs for gene is from the upstream region of the left homology arm, and the Check hph rev is from the hygromycin resistance gene region. The oxaA gene knockout strain can amplify a PCR fragment (3065bp), and a wild strain cannot realize amplification.

Check ALs for：GCAGATTTGATGCGAAGG；Check hph rev：GAACCCGCTCGTCTGGCTAAG。

4. PCR amplification was performed using genomic DNA as a template and a primer set consisting of Check hph for and Check ARs rev. The Check hph for gene region from hygromycin resistance, the Check ARs rev from the right homology arm downstream region. The oxaA gene knockout strain can amplify a PCR fragment (2524bp), and the wild strain cannot realize amplification.

Check hph for：TGGCTGTGTAGAAGTACTCGC；Check ARs rev：TTCCTATCACGGGTCAGC。

5. PCR amplification was performed using genomic DNA as a template and a primer set consisting of Check ALs for and Check ALs rev. The wild strain can amplify a PCR fragment (2467bp), and the oxaA gene knockout strain cannot realize amplification.

Check ALs rev：CTGTGGACTGGCATTGATA。

The electrophoretogram of each amplification product is shown in A of FIG. 4. In A of FIG. 4,

lanes

1 and 5 are both amplification products obtained by PCR amplification using a primer pair consisting of Check ALs for and Check hph rev,

lanes

2 and 6 are both amplification products obtained by PCR amplification using a primer pair consisting of Check hph for and Check ARs rev, and

lanes

3 and 7 are both amplification products obtained by PCR amplification using a primer pair consisting of Check ALs for and Check ALs rev.

Example 3 preparation of oxaL Gene knock-out Strain

Construction of first, knockout vectors

oxaL gene knockout vectors: is a recombinant plasmid pXW 06-delta oxaL obtained by replacing a small fragment between NdeI and PmeI enzyme cutting sites of a yeast expression plasmid pXW06 with a DNA molecule shown in a sequence 5 in a sequence table. In the DNA molecule shown in the sequence 5 of the sequence table, the 1 st-2090 th nucleotide is the oxaL-UP of the upper homologous arm of the oxaL gene, the 2091 st-3692 th nucleotide is the hygromycin resistance gene, and the 3693 th-5716 th nucleotides are the oxaL-DN of the lower homologous arm of the oxaL gene.

Second, protoplast transformation

The same procedure as in example 2 was repeated except that the oxa L knock-out vector was used instead of the oxaA knock-out vector.

After completion of step 4, 120 hygromycin-resistant transformants were selected for normal growth.

Thirdly, screening recombinant bacteria

1. Extracting the genome DNA.

hph-for：TCGTTATGTTTATCGGCACT；hph-rev：TGTTGGCGACCTCGTATT。

3. PCR amplification was performed using genomic DNA as a template and a primer pair consisting of Check LLs for and Check hph rev. The Check LLs for was derived from the upstream region of the left homology arm, and the Check hph rev was derived from the hygromycin resistance gene region. The oxaL gene knockout strain can amplify a PCR fragment (2994bp), and the wild strain cannot realize amplification.

Check LLs for：TCACGCTATACGAAACGA；Check hph rev：GAACCCGCTCGTCTGGCTAAG。

4. PCR amplification was performed using genomic DNA as a template and a primer pair consisting of Check hph for and Check LRs rev. The Check hph for gene region is derived from the hygromycin resistance gene region, and the Check LRs rev is derived from the right homology arm downstream gene region. The oxaL gene knockout strain can amplify a PCR fragment (2607bp), and a wild strain cannot realize amplification.

Check hph for：TGGCTGTGTAGAAGTACTCGC；Check LRs rev：TGGGCTGATGCTGAAGAAA。

5. PCR amplification was performed using genomic DNA as a template and a primer pair consisting of Check LRs for and Check LRs rev. The wild strain can amplify a PCR fragment (2532bp), and the oxaL gene knockout strain cannot realize amplification.

Check LRs for：TGCGGTAGGATGACGACG。

The results are shown in B of FIG. 4. In FIG. 4B,

lanes

1 and 5 are both PCR-amplified products using a primer pair consisting of Check LLs for and Check hph rev,

lanes

2 and 6 are both PCR-amplified products using a primer pair consisting of Check hph for and Check LRs rev, and

lanes

3 and 7 are both PCR-amplified products using a primer pair consisting of Check LRs for and Check LRs rev.

Example 4 Metabolic Spectroscopy HPLC analysis

Test strains: p. oxalicum114-2 (WT), the oxaA gene knock-out strain (Δ oxaA) prepared in example 2, or the oxaL gene knock-out strain (Δ oxaL) prepared in example 3, respectively.

The test strains were inoculated onto MEPA medium plates (plate diameter: 3cm), and subjected to static culture at 28 ℃ for 6 days. Then, all the cultures (the whole culture system including the culture medium) were collected into a 15ml centrifuge tube, and 5ml of ethyl acetate was added for ultrasonic extraction at room temperature for 30min (ultrasonic frequency 25KHz, ultrasonic power 800W). Then centrifuged at 5000rpm for 10min, the supernatant was collected, the solvent was evaporated with a solvent evaporation station (GeneVac EZ-2), then 500. mu.L of acetonitrile (chromatographically pure) was added to dissolve the residue, and then centrifuged at 13000rpm for 10min, and the supernatant was collected.

The supernatant was applied to Agilent1290 for HPLC analysis.

Chromatograph: high performance liquid chromatograph (Agilent1290 tandem liquid phase evaporative light scattering detector ELSD);

a chromatographic column: agilent ZORBAX SB-C18,5 μm,4.6 × 250 mm; the flow rate was 1 mL/min.

And (3) an elution process: the elution time is 30 min; the eluent consists of acetonitrile and water; from the initial time to the end time, the volume fraction of acetonitrile in the eluent linearly increased from 5% to 99%.

The results are shown in FIG. 5. Oxalicum114-2 can produce the target compound molecule oxalicine B (the corresponding peak is labeled 1). The oxacicine B gene knockout strain cannot generate the oxacicine B, and further proves that the gene cluster discovered in the embodiment 1 is the oxacicine B biosynthesis gene cluster. The oxaL knock-out strain was also unable to produce oxalicine B while accumulating intermediate compound molecules (corresponding peaks are labeled 2, 3, and 4; 2 is

compound

2, 3 in example 5, compound 3 in example 5, and 4 is compound 4 in example 5).

Example 5 isolation and purification of intermediate Compounds produced by OxaL Gene knock-out strains and structural characterization

Preparation, separation and purification of compound

1. The oxaL knock-out strain (. DELTA.oxaL) prepared in example 3 was collected and suspended in sterile water to give a spore concentration of (1-2). times.10⁶Spore suspension of individual/ml; 300-400. mu.l of spore suspension was inoculated into a MEPA medium plate (15 cm in diameter) and incubated at 28 ℃ for 6 days. At least 150 repetitive treatments are set.

2. Mixing all the cultures (the whole culture system containing the culture medium) of the 150 plates completing the step 1, adding 5L ethyl acetate, performing ultrasonic extraction at room temperature for 3 hours, and collecting an organic phase; adding 5L ethyl acetate into the remainder, performing ultrasonic extraction at room temperature for 3h, and collecting an organic phase; adding 5L ethyl acetate into the remainder, performing ultrasonic extraction at room temperature for 3h, and collecting an organic phase; combining the organic phases obtained by three extractions, and concentrating under reduced pressure at 40 ℃ to constant weight to obtain 12g of extract. Ultrasound parameters of ultrasound extraction: the ultrasonic frequency is 25KHz, and the ultrasonic power is 800W.

3. Dissolving the extract obtained in the step 2 in dichloromethane-methanol, uniformly stirring with 20g of normal phase silica gel (60-100 meshes), concentrating to constant weight by adopting a rotary evaporator to obtain a solid sample, filling the solid sample into a sample column, connecting the sample column with a chromatographic column, and separating by using a chromatograph.

The chromatographic column is a normal phase silica gel chromatographic column, and the filling medium is column chromatography silica gel (200-300 meshes, 330 g).

The chromatograph is a Combiflash Rf200 preparative chromatograph manufactured by TELEDYNE ISCO.

Mobile phase A: dichloromethane; mobile phase B: acetone. Flow rate of mobile phase: 30 mL/min. Detection wavelength: 230 nm.

And (3) an elution process: 0-5min, wherein the mobile phase is all mobile phase A; 5-80min, the volume fraction of the mobile phase B in the mobile phase is linearly increased from 0% to 100%, and the volume fraction of the corresponding mobile phase A in the mobile phase is linearly decreased from 100% to 0%; 80-105min, and the mobile phase is the mobile phase B.

The eluent after passing through the column is collected continuously in the whole elution process, 1 bottle is collected every 150mL, and 21 bottles are collected. The 1 st to 4 th bottles were combined as the part stream Fr.1, the 5 th to 9 th bottles were combined as the part stream Fr.2, the 10 th to 12 th bottles were combined as the part stream Fr.3, the 13 th to 14 th bottles were combined as the part stream Fr.4, the 15 th to 19 th bottles were combined as the part stream Fr.5, and the 20 th to 21 th bottles were combined as the part stream Fr.6.

And (4) concentrating each flow part to constant weight by adopting a rotary evaporator to obtain dry matters.

4. The dry matter (79mg) of fraction fr.2 obtained in step 3 was dissolved in dichloromethane-methanol, then loaded and separated by gel column chromatography. The column specification for gel column chromatography was 30X 1700mm (diameter. times. length) and the packing medium was Sephadex LH-20(80 g). The mobile phase is as follows: dichloromethane-methanol. The eluate after passing through the column is collected continuously in 1-100mL (i.e. flow Fr.2-1), and then 10 bottles (flow Fr.2-2 to Fr.2-11) are collected in total every 20mL collection 1.

5. The fraction Fr.2-5 (16mg) obtained in step 4 was dissolved in 0.5mL of methanol and then subjected to separation and purification by chromatography.

Chromatograph: hanbang NP 7000.

A chromatographic column: SunAire C18, 10mm 250mm, pore size 5 μm, Waters corporation.

Mobile phase: consisting of 45 parts by volume of acetonitrile and 55 parts by volume of water. Flow rate of mobile phase: 6 mL/min. Detection wavelength: 230 nm.

And collecting the eluate after passing through the column, which corresponds to the peak value and has a retention time of 12.1min, and concentrating the eluate to constant weight by using a rotary evaporator to obtain 2.3mg of a yellow solid product, namely the compound 3.

6. The dry matter of fraction fr.3 obtained in step 3 (117.8mg) was dissolved in dichloromethane-methanol, then loaded and separated by gel column chromatography. The column specification for gel column chromatography was 30X 1700mm (diameter. times. length) and the packing medium was Sephadex LH-20(80 g). The mobile phase is as follows: dichloromethane-methanol. The eluate after passing through the column is collected continuously in 1-100mL (i.e. flow Fr.3-1), and then 11 bottles (flow Fr.3-2 to Fr.3-12) are collected in total every 20mL collection 1.

7. The fraction Fr.3-5 (20mg) as a dry substance obtained in step 6 was dissolved in 0.5mL of methanol, followed by separation and purification by chromatography.

Chromatograph: hanbang NP 7000.

And collecting the eluate after passing through the column, which corresponds to the peak value and has a retention time of 8.7min, and concentrating the eluate to constant weight by using a rotary evaporator to obtain 8.7mg of a yellow solid product, namely the compound 4.

8. The dry matter (115mg) of fraction fr.5 obtained in step 3 was dissolved in dichloromethane-methanol, then loaded and separated by gel column chromatography. The column specification for gel column chromatography was 30X 1700mm (diameter. times. length) and the packing medium was Sephadex LH-20(80 g). The mobile phase is as follows: dichloromethane-methanol. The eluate after passing through the column is collected continuously in 1-100mL (i.e. flow Fr.5-1), and then 14 bottles (flow Fr.5-2 to Fr.5-15 in sequence) are collected in every 20mL collection 1 bottle.

9. The fraction Fr.5-5 (26.5mg) as a dry substance obtained in step 8 was dissolved in 0.7mL of methanol, followed by separation and purification by chromatography.

Chromatograph: hanbang NP 7000.

Mobile phase: consisting of 40 parts by volume of acetonitrile and 60 parts by volume of water. Flow rate of mobile phase: 6 mL/min. Detection wavelength: 230 nm.

And collecting the eluate after passing through the column, which corresponds to the peak value and has a retention time of 7.0min, and concentrating the eluate to constant weight by using a rotary evaporator to obtain 13.9mg of a yellow solid product, namely the compound 2.

10. The dry matter (185.8mg) of fraction fr.6 obtained in step 3 was dissolved in dichloromethane-methanol, then loaded and separated by gel column chromatography. The column specification for gel column chromatography was 30X 1700mm (diameter. times. length) and the packing medium was Sephadex LH-20(80 g). The mobile phase is as follows: dichloromethane-methanol. The eluate after passing through the column is collected continuously in 1-100mL (i.e. flow Fr.6-1), and then 10 bottles (flow Fr.6-2 to Fr.6-11) are collected in total every 20mL collection 1.

11. The fraction Fr.6-6 (15mg) as a dry substance obtained in step 10 was dissolved in 0.5mL of methanol, followed by separation and purification by chromatography.

Chromatograph: agilent 1100.

A chromatographic column: YMC-C18, 10mm by 250mm, pore diameter 5 μm, Japan YMC Co.

Mobile phase: consisting of 35 parts by volume of acetonitrile and 65 parts by volume of water. Flow rate of mobile phase: 4 mL/min. Detection wavelength: 230 nm.

And collecting the eluate after passing through the column, which corresponds to the peak value and has a retention time of 17.4min, and concentrating the eluate to constant weight by using a rotary evaporator to obtain 1mg of a light yellow solid product, namely the compound 7.

12. The dry matter of fraction fr.1 obtained in step 3 (138.1mg) was dissolved in dichloromethane-methanol, then loaded and separated by gel column chromatography. The column specification for gel column chromatography was 30X 1700mm (diameter. times. length) and the packing medium was Sephadex LH-20(80 g). The mobile phase is as follows: dichloromethane-methanol. The eluate after passing through the column is collected continuously in 1-100mL (i.e. flow Fr.1-1), and then 11 bottles (flow Fr.1-2 to Fr.1-12) are collected in total every 20mL collection 1.

13. The fraction Fr.1-3 (0.8mg) obtained in step 12 was dissolved in 0.3mL of methanol and separated and purified by chromatography.

Chromatograph: hanbang NP 7000.

Mobile phase: consisting of 50 parts by volume of acetonitrile and 50 parts by volume of water. Flow rate of mobile phase: 6 mL/min. Detection wavelength: 230 nm.

And collecting the eluate after passing through the column with the retention time of 22.5min corresponding to the peak value, and concentrating to constant weight by using a rotary evaporator to obtain 0.4mg of a yellow solid product, namely the compound 6.

14. The fraction Fr.1-5 (22.8mg) obtained in step 12 was dissolved in 0.5mL of methanol and separated and purified by chromatography.

Chromatograph: hanbang NP 7000.

Collecting eluate after passing through the column with retention time of 17.4min corresponding to the peak value, and concentrating to constant weight by using a rotary evaporator to obtain 4.5mg product, namely product Fr.1-5-1.

15. The whole product Fr.1-5-1 obtained in step 14 was dissolved in 0.3mL of methanol and separated and purified by chromatography.

Chromatograph: agilent 1100.

Mobile phase A: water; mobile phase B: and (3) acetonitrile. Flow rate of mobile phase: 4 mL/min. Detection wavelength: 230 nm.

Elution procedure: and (3) linearly increasing the volume fraction of the mobile phase B in the mobile phase from 70% to 100% in 0-10min, and linearly decreasing the volume fraction of the mobile phase A in the corresponding mobile phase from 30% to 0%.

And collecting the solution after passing through the column of the elution peak with the retention time of 4.1min corresponding to the peak value, and concentrating the solution to constant weight by adopting a rotary evaporator to obtain 0.9mg of a yellow solid product, namely the compound 5.

II, identification of the Compound

In the first step, 1oxalicine compound (compound 4) and 5 decaturin analogues (compound 2, compound 3, compound 7, compound 5 and compound 6) are separated. Through nuclear magnetic resonance and mass spectrometry analysis, 3 main compounds, namely 15-deoxyaxalicine B (compound 4), decaturin C (compound 3) and decaturin A (compound 2), are identified and are all intermediates for biosynthesis of the compound oxalicine B. By nuclear magnetic resonance and mass spectrometry analysis, 3 additional compounds were identified, decaturin H (compound 5), decaturin I (compound 6) and decaturin F (compound 7), respectively. decaturin I (Compound 6) and decaturin F (Compound 7) are novel decaturin derivatives.

The identification data for each compound is as follows:

process for preparation of Compound 5HRESIMS ion peak is M/Z504.2369 [ M + H ]]+, corresponding to formula C with 15 degree of unsaturation₃₀H₃₃NO₆. Process for preparation of Compound 5¹H、¹³C and HSQC NMR data show the presence of 4 methyl groups [ Delta ]_H 0.84(3H,s),δ_C17.1；δ_H1.04(3H,s),δ_C 26.1；δ_H 1.05(3H,s),δ_C 15.5；δ_H 1.64(3H,s),δ_C 18.0]One alkenylmethine [ delta ]_H5.72(1H,d,J＝5.4Hz),δ_C 128.4]And typically a pyridine-alpha-pyrrolidine group [ delta ]_H 7.27(1H,s),δ_C94.1；δ_H 7.56(1H,br s),δ_C 124.1；δ_H 8.23(1H,d,J＝7.8Hz),δ_C 133.1；δ_H 8.71(1H,br s),δ_C 151.4；δ_H 9.10(1H,br s),δ_C 146.7；δ_C 169.8,159.6,159.5,127.3,and 101.3]. Process for preparation of Compound 5¹H and¹³the C NMR spectrum was similar to decaturin C (Compound 3), with the obvious difference being the carbonyl signal (. delta.) in Compound 3_C173.5) rather than having an oxymethylene signal [ (delta) as in compound 3_H 4.07(1H,dd,J＝9.0,3.0Hz),3.73(1H,d,J＝9.0Hz)；δ_C 66.3]. The location of the carbonyl group is further confirmed by correlation of C-29/H-19, H-23 and H-25 in HMBC. By means of the counter-current to the DEPT,¹H-¹detailed analysis of H COSY, HSQC, HMBC spectra established a complete assignment for compound 5. By analysis of¹H and¹³c NMR data, NOESY correlation and ECD spectra and the basis of biogenetic, the relative and absolute configuration of compound 5 was the same as compound 3. In summary, compound 5 may not be a precursor to oxalicine B, but is apparently a product of other pathways.

The HRESIMS ion peak of the compound 6 is M/Z518.2528 [ M + H ]]⁺And C is₃₁H₃₅NO₆The molecular formula (a) is consistent, indicating that a methyl group may be introduced compared to compound 5. Process for preparation of Compound 6¹H and¹³c NMR data was similar to that of Compound 5 except for the presence of a methoxy moiety (. delta.) (_H 3.30；δ_C50.5). Correlation of H-34 to C-27 from the HMBC spectra confirms the position of the methoxy group. According to nuclear magnetic resonance numberOn the basis of NOESY experiments and ECD spectroscopy and biogenetic, the stereochemistry of compound 6 was similar to that of compound 5.

Of Compounds 5 and 6¹H-NMR and¹³the C-NMR data are shown in Table 3.

TABLE 3 of Compound 5 and Compound 6¹H-NMR and¹³C-NMR data

Spectroscopic data for compound 2: (+) ESI-MS M/z 506.5[ M + H]⁺；¹H-NMR(600MHz,DMSO-d₆)δ:9.09(1H,d,J＝2.4Hz),8.38(1H,dd,J＝4.8,1.8Hz),8.24(1H,ddd,J＝8.4,1.8,1.8Hz),7.55(1H,dd,J＝8.4,4.8Hz),7.35(1H,s),5.67(1H,d,J＝5.4Hz),3.98(1H,dd,J＝9.0,3.0Hz),3.73(1H,d,J＝9.0Hz),3.05(1H,d,J＝16.2Hz),2.84(1H,d,J＝16.2Hz),2.17(1H,dd,J＝12.6,5.4Hz),1.99(1H,m),1.95(1H,m),1.93(1H,m),1.84(1H,m),1.80(1H,m),1.69(1H,m),1.61(3H,s),1.54(1H,m),1.48(1H,m),1.46(1H,m),1.19(1H,m),0.93(3H,s),0.83(3H,s),0.81(3H,s)；¹³C-NMR(150MHz,DMSO-d₆)δ:170.1,159.6,159.5,151.4,146.7,133.0,131.0,128.2,127.2,124.0,101.2,99.7,97.5,94.1,72.9,66.4,46.3,40.0,38.9,37.7,29.1,28.5,27.7,24.7,24.5,22.6,21.1,20.0,18.4,15.3。

Spectroscopic data for compound 3: (+) ESI-MS M/z 490.6[ M + H]⁺；¹H-NMR(600MHz,DMSO-d₆)δ:9.09(1H,br s),8.70(1H,br s),8.25(1H,br d,J＝7.8Hz),7.56(1H,dd,J＝7.8,4.8Hz),7.30(1H,s),5.68(1H,br d,J＝5.4Hz),4.07(1H,dd,J＝9.0,2.4Hz),3.73(1H,d,J＝9.0Hz),3.04(1H,d,J＝16.2Hz),2.85(1H,d,J＝16.2Hz),2.10(1H,m),2.08(1H,m),1.99(1H,m),1.78(1H,m),1.67(1H,dd,J＝12.0,4.2Hz),1.64(1H,m),1.61(3H,s),1.55(1H,m),1.50(2H,m),1.25(1H,m),1.23(1H,m),1.12(1H,m),0.91(3H,s),0.88(3H,s),0.83(3H,s)；¹³C-NMR(150MHz,DMSO-d₆)δ:169.9,159.5,159.5,151.2,146.5,133.3,131.1,128.1,127.3,124.1,101.3,99.5,96.9,94.2,66.2,49.5,41.8,40.1,40.1,34.4,34.1,29.8,29.5(C-26),27.6,27.2,22.7,18.6,18.5,17.9,15.8。

Spectroscopic data for compound 4: (+) ESI-MS M/z 504.5[ M + H ]]⁺；¹H-NMR(600MHz,DMSO-d₆)δ:9.10(1H,br s),8.69(1H,d,J＝4.8Hz),8.27(1H,ddd,J＝8.4,2.4,1.8Hz),7.57(1H,dd,J＝8.4,4.8Hz),7.36(1H,s),5.71(1H,br d,J＝5.4Hz),5.09(1H,s),4.88(1H,s),4.48(1H,d,J＝12.6Hz),4.43(1H,d,J＝12.6Hz),3.07(1H,d,J＝16.2Hz),2.87(1H,d,J＝16.2Hz),2.61(1H,dd,J＝12.0,4.8Hz),2.42(1H,dd,J＝16.0,6.0,6.0Hz),2.33(1H,m),2.27(2H,m),2.17(1H,m),2.10(1H,m),1.94(1H,m),1.79(3H,s),1.65(3H,s),1.45(1H,m),1.41(1H,m),1.22(1H,m),0.85(1H,m)；¹³C-NMR(150MHz,DMSO-d₆)δ:173.5,170.1,159.5,159.4,151.1,150.5,146.4,133.3,130.7,127.8,127.3,124.1,114.3,101.2,99.9,94.2,75.0,66.9,43.6,41.6,40.1,29.6,27.9,27.6,25.7,24.8,23.5,21.6),18.1,15.2。

Spectroscopic data for compound 7: (+) ESI-MS M/z 492.4[ M + H ]]⁺；¹H-NMR(600MHz,DMSO-d₆)δ:9.08(1H,br s),8.68(1H,br s),8.24(1H,ddd,J＝8.4,1.8,1.8Hz),7.54(1H,dd,J＝8.4,4.8Hz),7.36(1H,s),5.65(1H,br s),3.79(1H,d,J＝12.0Hz),3.76(1H,d,J＝12.0Hz),3.04(1H,d,J＝16.2Hz),3.01(1H,dd,J＝11.4,4.8Hz),2.88(1H,d,J＝16.2Hz),2.65(1H,m),2.24(1H,ddd,J＝13.2,3.6,3.6Hz),2.05(1H,m),1.61(3H,s),1.60(1H,overlap),1.58(1H,m),1.55(1H,m),1.44(2H,m),1.42(1H,m),1.34(1H,m),1.02(3H,s),0.89(3H,s),0.78(1H,dd,J＝11.4,2.4Hz),0.71(3H,s),0.68(1H,dd,J＝13.2,3.6Hz)；¹³C-NMR(150MHz,DMSO-d₆)δ:170.0,159.6,159.5,151.4,146.7,133.1,130.3,129.4,127.2,123.9,101.1,100.6,94.3,77.1,59.3,54.7,48.1,40.5,40.5),38.4,32.7,32.1,29.0,27.9,27.5,24.6,18.1,17.2,16.5,16.4。

According to the identification results, the structural formula of each compound is shown in FIG. 6.

Example 6 heterologous expression and functional characterization of P450 oxidase OxaL

Construction of recombinant plasmid

oxaL gene overexpression vector: is a recombinant plasmid pXW06-oxaL obtained by replacing a small fragment between NdeI and PmeI enzyme cutting sites of a yeast expression plasmid pXW06 with a DNA molecule shown in a sequence 2 in a sequence table. The DNA molecule shown in the sequence 2 of the sequence table encodes the OxaL protein shown in the sequence 3 of the sequence table.

II, heterogenous expression and functional identification of P450 oxidase OxaL (Agilent1290 tandem liquid phase evaporation light scattering detector ELSD detection analysis)

1. Washing S.cerevisiae RC01 with Solution I, then re-suspending with Solution II, then adding an oxaL gene over-expression vector, then adding Solution III, vortex-suspending and mixing uniformly, then incubating for 1h at 30 ℃ (vortex-suspending for 1-3 times), then coating on a Trp-auxotrophic culture medium plate, and culturing overnight at 30 ℃.

2. Collecting the clone (yeast gene engineering strain RC01-oxaL) which normally grows on the plate, inoculating the clone into 100ml of liquid Trp-auxotrophic culture medium, and carrying out shaking culture at 30 ℃ and 150rpm for 1 day to obtain the seed solution.

3. 2mL of the seed solution obtained in step 2 was inoculated into 20mL of a liquid YPD medium and cultured at 28 ℃ for 36 hours with shaking at 200 rpm.

4. After completion of step 3, 0.1mg of the test compound was added to the system, and the mixture was cultured at 28 ℃ for 1 day with shaking at 200 rpm.

The test compounds were: compound 2, compound 3, compound 4 or compound 7 prepared in example 5.

A control was set up without the test compound added.

5. After the step 4 is finished, collecting all cultures (the whole culture system containing the culture medium), adding equal volume of ethyl acetate, performing ultrasonic extraction at room temperature for 1 hour, and collecting an organic phase; adding the remainder into ethyl acetate with the same volume, performing ultrasonic extraction at room temperature for 1 hour, and collecting an organic phase; and combining the organic phases obtained by the two extractions, and concentrating to constant weight by adopting a rotary evaporator to obtain an extract. Ultrasound parameters of ultrasound extraction: the ultrasonic frequency is 25KHz, and the ultrasonic power is 800W.

6. Taking the extract in the step 5, adding 500 mu L of acetonitrile (chromatographic purity) to dissolve, then centrifuging at 13000rpm for 10min, and collecting the supernatant; the supernatant was applied to Agilent1290 for HPLC analysis.

The results are shown in A of FIG. 7. In a of fig. 7: i OxaL +3 represents the result of adding Compound 3 in the above method, iv OxaL +4 represents the result of adding Compound 4 in the above method, v OxaL +2 represents the result of adding Compound 2 in the above method, vi OxaL +7 represents the result of adding Compound 7 in the above method, ii 8 represents Compound 8 (Standard), iii represents Compound 3 (Standard), and vii OxaL represents the result of the control in which Compound 3 was not added in the above method. The result shows that the compound 3 can be completely converted into the compound 8 through the yeast genetic engineering bacteria RC 01-oxaL; comparing compound 3 with compound 8, hydroxylation occurred at the C-15 position, indicating that OxaL protein is a hydroxylase. From a in fig. 7, no significant conversion was seen for compound 2, compound 4 and compound 7.

Thirdly, heterologous expression and functional identification (UPLC-MS identification analysis) of P450 oxidase OxaL

Steps 1 to 5 are the same as steps 1 to 5 of step two.

6. The product of step 5 was dissolved in 200. mu.l acetonitrile and then subjected to UPLC-MS identification analysis.

The instrument comprises the following steps: ultra high performance liquid mass spectrometry detector (Waters acquisition UPLC-Class-MS tandem Xevo-G2-S Q-TOF).

A chromatographic column: waters ACQUITY UPLC-BEH-C18,1.7 μm, 2.1X 100 mm;

mobile phase A: acetonitrile containing 0.02% (by volume) formic acid; mobile phase B: 0.02% (by volume) aqueous formic acid solution.

Flow rate of mobile phase: 0.5 mL/min.

Mobile phase: the volume fraction of the mobile phase A in the mobile phase is linearly increased to 20% from 10% and the volume fraction of the corresponding mobile phase B in the mobile phase is linearly decreased to 80% from 90% from 0-5 min; 5-7min, wherein the mobile phase A accounts for 20% of the volume fraction of the mobile phase, and the corresponding mobile phase B accounts for 80% of the volume fraction of the mobile phase; and 7-25min, the volume fraction of the mobile phase A in the mobile phase is linearly increased from 20% to 100%, and the volume fraction of the corresponding mobile phase B in the mobile phase is linearly decreased from 80% to 0%.

ESI positive and negative ion detection mode.

The results are shown in B of FIG. 7. In B of fig. 7: i represents the result of adding compound 3 in the above method, v represents the result of adding compound 2 in the above method, and iv represents the result of adding compound 4 in the above method. The results show that: compound 3 can be completely converted into compound 8(M/z 504.2380[ M-H ] through yeast genetic engineering bacteria RC01-oxaL biotransformation]^-) Comparing the retention time and the ultraviolet absorption spectrum (lambda max 205,235,335nm), the product generated by the OxaL catalytic compound 3 is the same as the standard compound 8, and the OxaL is further proved to be hydroxylating enzyme; the compound 2 can partially generate a compound 9(M/z 564.2224[ M + HCOOH-H) through the biotransformation of yeast genetic engineering bacteria RC01-oxaL]^-) (ii) a Compound 4 can be partially converted into compound 1 (compound 1 namely oxalicine B) (M/z 566.2399[ M + HCOOH-H) through yeast genetic engineering bacteria RC01-oxaL bioconversion]^-) (ii) a The yeast genetically engineered bacterium RC01-oxaL cannot carry out biotransformation on the compound 7.

Spectroscopic data for compound 8: (+) ESI-MS M/z 506.6[ M + H]⁺；¹H-NMR(600MHz,DMSO-d₆)δ:9.13(1H,br s),8.74(1H,br s),8.27(1H,d,J＝7.8Hz),7.59(1H,dd,J＝8.4,4.8Hz),7.32(1H,s),5.74(1H,d,J＝5.4Hz),5.17(1H,s),4.08(1H,d,J＝8.4Hz),3.73(1H,overlap),2.60(1H,m),2.08(1H,m),2.04(1H,m),1.99(1H,m),1.86(1H,m),1.66(1H,m),1.63(1H,m),1.50(1H,m),1.42(1H,m),1.46(3H,s),1.15(1H,m),1.11(3H,s),0.92(3H,s),0.85(3H,s)；¹³C-NMR(150MHz,DMSO-d₆)δ:170.1,160.6,158.9,151.4,146.7,133.5,130.6,130.3,127.2,124.2,105.6,99.6,96.9,94.4,73.0,66.4,49.5,43.6,40.1,39.8,39.3,34.7,34.5,29.9,29.4,27.2,23.0,18.9,18.6,15.7。

Spectroscopic data for compound 9: (+) ESI-MS m/z 522.4[M+H]⁺；¹H-NMR(600MHz,DMSO-d₆)δ:9.11(1H,d,J＝4.8Hz),8.70(1H,dd,J＝4.8,1.8Hz),8.27(1H,ddd,J＝8.4,2.4,1.8Hz),7.57(1H,dd,J＝8.4,4.8Hz),7.34(1H,s),5.72(1H,dd,J＝4.2,1.8Hz),5.16(1H,s),4.00(1H,dd,J＝9.0,2.4Hz),3.73(1H,d,J＝9.0Hz),2.25(1H,dt,J＝13.2,3.6Hz),2.14(1H,t,J＝9.0Hz),2.03(1H,m),1.98(1H,m),1.92(1H,m),1.91(1H,m),1.68(1H,m),1.53(1H,m),1.48(1H,m),1.47(3H,s),1.37(1H,dt,J＝14.4,3.6Hz),1.07(3H,s),0.93(3H,s),0.84(3H,s)；¹³C-NMR(150MHz,DMSO-d₆)δ:170.3,160.6,158.9,151.5,146.8,133.3,130.4,130.4,127.2,124.1,105.5,99.9,97.5,94.3,73.0,72.5,66.5,46.0,40.0,39.8,39.3,29.2,28.6,24.8,24.1,22.9,21.1,20.1,19.0,15.6。

Spectral data of compound 1 (compound 1, oxalicine B): (+) ESI-MS M/z 520.4[ M + H [)]⁺；¹H-NMR(600MHz,CDCl₃)δ:9.03(1H,br s),8.71(1H,d,J＝4.8Hz),8.13(1H,ddd,J＝7.8,1.8,1.8Hz),7.42(1H,dd,J＝8.4,4.8Hz),6.70(1H,s),5.82(1H,br d,J＝5.4Hz),5.52(1H,s),5.20(1H,s),5.08(1H,s),4.51(1H,d,J＝12.6Hz),4.41(1H,d,J＝12.6Hz),2.65(1H,dd,J＝12.6,4.8Hz),2.53(1H,ddd,J＝14.4,14.4,4.8Hz),2.45(1H,m),2.43(1H,m),2.33(1H,m),2.33(1H,m),2.26(1H,ddd,J＝13.2,13.2,3.6Hz),2.16(1H,ddd,J＝18.0,5.4,5.4Hz),1.90(3H,s),1.61(1H,m),1.61(3H,s),1.45(1H,ddd,J＝14.4,3.6,3.6Hz),1.30(1H,m),1.20(1H,s)；¹³C-NMR(150MHz,CDCl₃)δ:173.4,170.4,161.9,160.1,152.0,150.7,147.2,133.4,130.7,129.9,127.3,123.7,115.1,105.6,101.1,93.9,76.3,74.4,67.8,44.6,43.6,41.1,29.9,29.3,26.0,24.5,24.5,21.7,19.4,15.9。

Four, UPLC-MS identification of OxaL microsome in vitro biochemistry

3. 2mL of the seed solution obtained in step 2 was inoculated into 20mL of a liquid YPD medium and cultured at 28 ℃ for 2 days with shaking at 200 rpm.

4. After completion of step 3, the cells were collected by centrifugation at 4 ℃ and resuspended in 2mL of microsomal extract.

5. A2 mL Eppendorf centrifuge tube was added 1mL of the resuspension from step 4, followed by 2/3-height glass beads (Sigma, G9268, 425 μm-600 μm) and vortexed (1 min/time, 6 times total, each time after vortexing and ice-cooling) to disrupt the cell walls.

6. After completion of step 5, 750. mu.l of the suspension was centrifuged at 4000rpm for 5min at 4 ℃ and the supernatant was collected.

7. And (4) centrifuging the supernatant obtained in the step (6) at the temperature of 4 ℃ and at the rpm of 17000 for 50min, discarding the supernatant, and collecting the precipitate.

8. And (3) adding an appropriate amount of TEG buffer solution into the precipitate obtained in the step (7), gently stirring, and subpackaging in 1.5ml Eppendorf centrifuge tubes, 100 mul/tube.

TEG buffer (ph 7.5): containing 50mM Tris-HCl, 1mM EDTA, 30% glycerol, and the balance water.

9. Preparing a reaction system and carrying out reaction.

Reaction system: 50. mu.l of the solution obtained in

step

8,1. mu.l of a test compound stock solution, and 49. mu.l of 50mM Tris-HCl buffer (pH 7.5).

Reaction conditions are as follows: the reaction was allowed to stand at 30 ℃ for 12 hours.

Test compounds were dissolved in DMSO to give a test compound stock solution having a compound concentration of 50 mg/ml.

10. After step 9, adding 50 μ l of methanol into the system, vortexing and shaking for 1min, then centrifuging at 13000rpm for 10min, and taking 30 μ l of supernatant to perform UPLC-MS identification analysis.

And identifying and analyzing parameters of the UPLC-MS in the same way as the step three 6.

The results are shown in C of FIG. 7. The results are consistent with those of step three.

The results show that: compound 3 can generate compound 8(M/z 504.2392[ M-H ] through oxaL catalysis]^-) (ii) a The compound 2 can partially generate a compound 9(M/z 564.2217[ M + HCOOH-H) through oxaL catalysis]^-) (ii) a Compound 4 can partially generate compound 1(M/z 520.2348[ M-H ] through oxaL catalysis]^-). OxaL does not catalyze the formation of other compounds from compound 7.

Example 7 Oxalicine B biosynthesis late pathway analysis

The separation and identification of intermediate compounds such as a gene knockout strain delta oxaL and the like are combined, and the intermediate compounds are obtained by carrying out separation and identification on P450 oxidase OxaL and Fe dependence²⁺The analysis of the functions of the a-KG dioxygenase OxaK and the P450 oxidase OxaB predicts 4 possible biosynthetic pathways from decaturin C to the target compound Oxalicin B in the later stage of the Oxalicin B biosynthesis, but mainly takes the 1 st pathway, as shown in FIG. 8. OxaL is responsible for the hydroxylation reaction of C-15, OxaK is responsible for the introduction of a C-23 hydroxyl group, and OxaB participates in the spiro formation on the left side of an oxalicine B molecule.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> institute of medical and Biotechnology of Chinese academy of medical sciences

<120> compound oxalicine B biosynthesis gene cluster and C-15 hydroxylase OxaL and application

<130> GNCYX213577

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28137

<212> DNA

<213> Penicillium oxalicum

<400> 1

cagggagatc acgaggaaga cacaggaaaa caaaagttgc gtgaatagac ccacaagcat 60

gatattttgt ccgacgtccg ccatcgatgc ttgggttatc atgccgccac cgccggcttg 120

gagaaggatg gcaataacgt caccgcatac aaagacttta gtcactcgag ccgaaggaat 180

catgcttgtc ttaggcgtgc tgacgaagag cgcaatacat ccgtacatca tatcatagag 240

agttgcagcg taaaggtggg tggggggggg gggggggtgg gcaggacgac gagcagagat 300

tcaatgcatg atgtatgggc ctaggtcgaa aggtgacttg gcggaaaaga tctcgcaatg 360

taaccggtgg tcatccctac ctaagaacag ggattatgag ctgcatcgat gggggagatt 420

caagacggac tcctcctgca tatggagttc gacacgagat ccggaggtca gactatccaa 480

tatgaaagcg aggatcacct tgcgacatgg caaatcaacc caaacggtga agtcattctc 540

atcgcaagcc tgttcaagtg ggacaagaag accttgaagg caaacattga aatcagaccg 600

catggttctg cccttgacgg ctccgtcgca gtcttcggcg ttgcaccaac cacaagggaa 660

acactgctac attatcagct cgacatctgc ggaccagtca ctcctgaaat gctggagctg 720

cttgccgcct atagcccggg gccagcagcc aagaagtatc taaatcgcta ccgattcgaa 780

tgcctgagta cctcggacat ctccagaaat ctcctcaccc gtgggcagct gatgaagcag 840

gctgccagca aagcagtgtg gcccgaggaa gaattctcta ccttgatctc cattatgccg 900

agactccgcc tgtggtattt ctccatcgtc tcctcgcctc gtgtgaaccc atcttccatc 960

gccatcaccg ctggtgtcct cgaaacaaca attgcacaca ctgatcgagg attcattggc 1020

ttgacggcgg gctacctgca ttctttgcac ctgaaagaaa accaactcaa ctcaagcgat 1080

gaacctgagt cttccaacaa ccttgaagga ccacgatcta tcgtgaaaga ccacaagcta 1140

ttcgcccaca tccgcaaatc aaggttcagg cttccagaca gtgatgagac tccaattatc 1200

ttcatcgctg ccggaagtgg catcacacca ttcagagcct ttgttcagaa gcggaagctt 1260

ctttcaagta agggtatcag tgggtaagat ggttcttttc tatgagtctc gctccgagga 1320

ggattgtctg taaaaggacg tctagatgga agtggaggcg atagggatct tagacaccca 1380

cttcgtgtac tcgtctcgat tggtggatgg aaagaatttc tacgtgcagg acaaaatgta 1440

cacattttgc agagaccatg aatcaattga ttcagacgga ggatgcgtca atttatgtct 1500

gcggaggctc tagcatggcc aatgatgtga aagccatcac ggtcactcga gtccttggcg 1560

gcatcggggc tgtccagcaa ttgaagagat ctagacggct ataggaaggt gtttgggggt 1620

agcaagtgtt tcattcatgc tatttgtttc tccgcaatga caagatctac atattgaaca 1680

aaaacgtatg gaaagtgtga ccttcatgac tcacatgagt ctgcatgtca ggctagcaag 1740

tcaaggcccg aattttgaac gctagagatc ttctagatgc tcatcctctc cgtgtccaaa 1800

ttagccctag tacaaacatc aatcccagaa taacgcccca tatttctttt ccactccctg 1860

tagtattttc agtccatcca ttggcggccc tagttggaat tggaatgaag ttcaaccttg 1920

cagcgccttt aattgcttgt gatgctcccc tggcttgtat tttaccggca tatggtaata 1980

catatcgggc gaaaaagcgg aggaagaaag tgtcccgcgc ttgtaaacgg acaaccagcc 2040

gcgcaacttt gtgaatttta tgcattcgtg cttttcgctc agccgtatac cgccttagcc 2100

tattgtccaa ttgttccgtg cttggtttgc tgcttgggct ggcaatgagg aattcatgaa 2160

gcagattggc taggccggcg gcatcttcaa tagcacaatt ggcgccttgt ccggtgttgg 2220

gggcgatcta cctggagtta gcttctgctt tgatgtagga aaattaaggt ggtatgtacc 2280

ttatgtatac tgtccccaat gcaaactatg cgcttatgat gccagttctc aaatacattc 2340

tcttcgagaa ctgtcatgtt atgccttgtt ctccgagtcc agaggtcgcg aaacgccacc 2400

tcgccccaga taatatcgtt tgcgtatttt tcaaccacgg atgccacatc ggttgttgcg 2460

aaacgaggca tatcgccatc ggaatagagc cgatcaagtt tccagatcaa aaaccaaaat 2520

gtgcgatcat ggtttccagg aaaggttaag aatgaccgtt tgtcgttgag gctggcaacg 2580

tgctcgccgg gtgggaatcc cggcactgcg gaggatatgc cgaaaacgca gccatactcc 2640

gctgtgagac ctgttcactg ttagctgcct tctttgatgt atgaagtata ttcaacaagg 2700

gacaattggc acaaaccgtc tctcccaaca ggttccataa tttctccgtc ttcggcagag 2760

attctccaca tttcccggcg gacaatgcta tgcaccccat cacaacccac cactagatct 2820

cccttatagt cttctccatc cttcgttctt accaagactc cttctcgctt tcctcccgaa 2880

tcagcaatga gctcaacccg tgcaacttcc ttatcacaga gaacctggct gccttcaccc 2940

ccgtctttag tcactttccc acgttgccca agaccaagcc tatcagcaag aatacacaat 3000

agcgtcctcc gctctaaaaa tgcaaagggg aacccaaagc tctcgccgat tacccgagga 3060

gagtcattcg tcagcacaaa cctatttgtg tccgggaagc gaagatgagc ggtatgtagg 3120

ggagcaatct ccttctcaac gcactcgaag agccctagct ggtcgagaat ccgaccgcca 3180

tgggggagaa tcccgatgga ggcaccttct tgtggtgtaa gtgacgtgcg cttttcgagc 3240

accgtgaatc gaatttttgc tctgtgtgtt tgggtgttgt cttggagaag agaggtattg 3300

agggcagtca gagcgtgtgc gagcgttaga ccagcgatgg agcctccaat aatgataata 3360

tgcagctcgt ctgatgcaga cttctcggtc atcgcgaatc atggattccc ccgcggagaa 3420

tggcacttat gatggtagtg cggcgtagag agttcgtaga ggcagtgtgc tattgcaagt 3480

aggtaaaaaa gtaacgctcc ttgattgact acagggatag ccattgtacg ttaggtctag 3540

ccgagaggcg taatagtagg atgatgtaag tcgtgtatta ttgtaagcat aaatttgatt 3600

taatacatcg gctcatcagg cgagactgta gatcttatcg ttacctaact cataccttgc 3660

ttaatgatga atcaatagca aacatgctct gtgaaatctc actcagtctt tttgccagcc 3720

tttgcttcag cctgtttcac aaaggcaaaa aacaagccgt acgccccatc aaagattaca 3780

aatgctgcgg tggaccagta gaacaacggg ttcatcgtcc acgcccacag ctcaggccag 3840

tagtgtgcac gaaaaaacac acctgcaagg gcacttcctg tcccagtcac acgagacgac 3900

ctatctctca gtcagcaagg caaggaagtt cgttgtcgaa gtcaggggga cggaagaaac 3960

gtaccagatg agccaactag caccacgcga ttggctcgat cgcacgagct cacacagcgc 4020

ggtcacactg gtcatgatct ggcagcccag tccaccatag tagaacgctg taaggggtcc 4080

cacgaggttt gcgagggaga catgtcccgc agcccagata gcggtgacga tgacgaaggt 4140

aagatagaag taatagccgc ggagcatcga atcatccccc aatgctaggg gatggtattt 4200

gagagccgca tatattgaag caaggttcag cataaaccat gcggtgacta ttggaaggcg 4260

gggcggggga tagagagtcg cgtagacgag ctcccaggcg aggttacagg atactgggac 4320

gatggggacc cagcaggctt tgtcgcggca agcggtgcga atcgtggcgg cgtagcaagt 4380

cagccagccc gctgccatgg cgaagagcag tgtgtcggat atccatttaa ccgattgaaa 4440

ggattcgggc gctttggtga aatccagtga gtccatagtc actttgaagg gtgagcgtgt 4500

tggtggctgc aagagggaat ggggttgatc cttgaaatat tatcctgcac aacacagtcg 4560

aagtggaacc aaaggcgccc tccaggagga actcatattt atgagaatgc gtacactttc 4620

aagtcgcaca ccgtcctcgc aaggaaatat gcaggggtac cgttgtggag ccctccttgc 4680

atcgcgtgct ccaacttgat aagccatagg tccaagctgt cacacctgac gagatgaagg 4740

gttgctcaca acgaaaaacc tttcacatcg atttcgaaga cccgtggcga atcttgcctc 4800

taggttcacc gtcacgacga ccccgagcat cgcagcgcct ctagctatga ctggtcaagg 4860

tgtcacccag cagaaggcga ctctaagtcc cgagaaggta tcgaagcata tcacttcacc 4920

ttatgtcttc gaattttaat actcacaaac aatagatcat agcagccccg atagactacc 4980

tcttatccca accaggaaag gacctccgca gccgcctaat cactgctttc aacgagtggc 5040

tgaatgtccc agaggagaag ctcgatctca tcagaagagt gattgagctt ctgcacacgg 5100

cctcactcct gtaggcttct ttaatcgttc gcacaagttg aaaatgccta attcagcgtc 5160

ctagaattga tgacattcag gactcctcta agctgcgccg gggtcaacca gtcgcccaca 5220

gtctatttgg gattccacag actatcaact ctgcgaacaa tgcatatttc gaagcgcaaa 5280

atgaactgca caagctgaat gacccgcgag cagtccagat cttcacagag gagcttctcc 5340

ggctgcatcg cgggcaggga atggatttgt actggcgaga ctccatgatc tgcccgtccg 5400

aagaagaata cctcgatatg gtagctgata agacgggagg tctgtttcga ctcgcgatca 5460

agttgatgca gtgttcaagc tttagtacat agtaagctgg cacgtctgac tctgggcaaa 5520

cggtttgaat gagctgacta gagataatag cgactacgtt cccctggttg acttgatggg 5580

cgtcatcttc cagattcggg acgactacca gaatctccag agcggaacat atattcagaa 5640

caaaggtttt ggagaggatt tgactgaggg aaagttttca ttcccaatca tccatggact 5700

caatcatggg acgcagagcc tgcagctttt caatatcctg aagcagaaga cggaggatgt 5760

gtctgtcaaa cgatacgcgc taagcatcat ggaagcagct ggaagctttg catattgccg 5820

cgcaaggctc gcggaactgg ggacggaggc gaggttgatg cttcaggaaa ttgagcgtac 5880

cacagaggga gcatgcgccg gtgacacaaa aggcaaagct gtcgccgaat ttttggattt 5940

gctcgagatc aaacaggaca gctcatgttc caactgtgct aattgcacac aaggcttatg 6000

aatgttctag tgtgcgagtg ttattaaata gtagaccagc catcgtcaat aggaagaaca 6060

gctccattta tccgcgaagc ctgatctgag cacatgaaca caataataga cgctacttcg 6120

tccggcatca tcatcgcgta tccatctctc cggttggcat acacagcgga aagaacaggc 6180

ttgattgtcg aagtggcttc cggatcaaac cttgatggat caacactgtt taatataccg 6240

gtcgccactc ctactgatag tgagtgcctg taacaaaata tgggcttaat ggaagaacaa 6300

gacatcttac ctcctgggca cagcacgttg catcgtatgt tctccccttt gaatctccag 6360

gccacgttct tcgtcgctcc gataaggcca tgcttaccta cgactggtta gaggtatctt 6420

ttaatgagac tgaccaagaa agagaaacgt actcgccgta tacgccacgc ctgctgcagc 6480

accgctcatt ccagctcgac tcgccatgtt caagatcaca ccagacttct gcatcctcat 6540

ctccccgata acctctctca tcagtctcac cggtgccgta aggttcacag ccatacaacg 6600

attccagtct gcgtctgtga ctgtgtccac actggcattg tgatcgagga ctccagcgat 6660

attcatgaga atgtcaatcc ggttaccgaa ggctgaaaga caagctttga caattgtctt 6720

agggatatct aggtctgtga ggtcacattg catcgtctga cagttctcgt tggcttccag 6780

gacggctgga aatggcgata tgtcaacggc gaatacattg gccccagcct ctaaagcagc 6840

ctcagcagca gccagcccaa tgcctgagga ggcgccggtg atgattgcga cctgccctga 6900

gtgttactat gccatcgatt ggcgattatt cgggcaatac taacacgatt ttgaagacag 6960

cctgattcca tcgtgatagt cattctgcct ctctgtgcag aggacgtgag ttacacgtag 7020

ctcaattctc acccaggtac tgagcgcaga tcatttcaca aaatgactta aagcttttct 7080

agaagtgaca ttgaccgccc agatggggcc agttcccatt tagttggcag acaccctaag 7140

aggaagttct ccatcaggta tgtggtgtat ctgatgcgga ctggacccct tgcattagtg 7200

ttacacaggg gaactacacc gcttcactag tgcagcgact acatattgat atcacaaata 7260

ttttcaagga cagtacaatg ctctttccag gccgtatatt ctacgctttg caaaggttgt 7320

ctacgtcgga tagacaagca atcatgattg caagtatact tgaaaagtcc cgagatgctg 7380

accacttcac tattatcatc gccgcatctt ttctcttgag cgtcgcgatt tctcttgtct 7440

ttttacgttc aactacgcct cagctgcctt tgttaaatgg acccaagcgt tgggaattca 7500

cgttcacgaa tgcgaagaag cgctattact tgaatgcgaa tcaaattata caagatggat 7560

tcaagaaggt ctttcctcca tctgcgacag aatactagca agatctcact aagccacagt 7620

ctaaagatgg gttttatgct gtcaccgaga atggaatcga gctgattctc gcaccgaaat 7680

atgctcacgc tatacgaaac gacaagagac tcgactttca cacttacagg acgcatgtaa 7740

gtatagtagc tatacttatc tggtcttttt gccctttctc atttaaaaat cactcacaga 7800

ctatgctccc caatgtcgca ggcctgaaag tctttgagat ggatcaggtc ggaagggaga 7860

taatgagtta catcatccgc caaaaactaa cacatcattt ggtcgatctc atcagaccgc 7920

tgtctgagga ggccgatgat tgtttacacc ggagttggac agataattca ggtactccaa 7980

atctccatgt cgtagctcgt ccatgaggat ccattcactt attaatcctt agattggcac 8040

gaaatttctc tcaaatccac cctcctcgac atgatatccc agcaatcggc ccacgtcttc 8100

ctcggccgca gcttttccca taacgtgagt tggctagcgc tgtcgcgcag cataaccttg 8160

caggccttcg gcgccgtccg cgagcttcgc gtatacccat ccttcatacg cccgcttgtt 8220

ggctggtttc tccccgcatg taaatcactt cgcggagaga ttgccaaagc ccggaagctt 8280

gttgagcccc ttatactagc tcgaagactc gaaagagagc gatgcatcgc cagtggccgg 8340

gaaccacccg tctatcatga cactattgca tgggcagagg aatgtgcacg tggacgaaaa 8400

tacgatccag ctcttattca gctcacgctc gcgctttcgg ctatgcacaa cacctctgac 8460

tttctcacgc aagtaatata tgacatagcg gcgaggccga aactcgtgga ggagttgagg 8520

aaagagatca tcgatgttcg gacgtgtgga gatgcaacag agtcatggaa taagggggcg 8580

gttcacaagt tgaagttgat ggatagtgtc atgaaagaaa gtcagcgatt gaagcctacg 8640

ggattgggta agttttgctg ggatcaacgc ttattctcta caaggctaat atgctaatca 8700

tatagtaaac atgcggcgct atgcaactga ggacatccag ctctcttccg tcattcccga 8760

gcacaaggaa ggcagcatca caatccgaaa gggggatctg gtcatgatat cgcaacacag 8820

ccactgggac gaggatattt accaagacgc ggcgtctttc aacccatacc gattctgcag 8880

gatgcgcgaa caacccacgc aggagcacac agcacacttt gtcgccacaa gtgtcaacca 8940

tatcggcttc gggcatgggg tgcatggctg tcctggtcga ttctttgccg ccgctgagac 9000

gaagcttgca atgtgtcaca ttttgatgaa atacgacatt aagcttatcg atcagcctaa 9060

ggtcctcaat gtaggttcgc ttatggttgc aaatcccgtt gcgaaggttg cagtgagaag 9120

gaggaaggag gaggtttcat tgtgattgtg aacagtgagc tcgcccacat ctcactcagc 9180

ccaaggagta ccaaaggtag gtggagatgg accgtaacca cattactgct ttcggacaaa 9240

ctcaatttac tacatacctc gtggaatact caccttcgcg taaatgaaag tctcccaacc 9300

tttgtaatca cagtatatat tgggcttcca agcttccgtc tatgtctgtg aattctaaag 9360

cgttactatc gtcccttgaa cctctgtccc aaacttgaat gatatccttt ctcgtccatc 9420

atgttgtcaa tgatcgtaag gggaagaatg ataaaataaa ttgaagtatg gttattcagt 9480

tgaatctctg gcagactcaa attcacctat tcaatctgaa ttctaacttg tccaggttcc 9540

atgtccgggt ggtttgtgac cgttgatata cctatcgagc atacgtaatc ttccaaagtt 9600

taaggttgcg acccaccaat acctgaacca gggcgtagat cacacctaga tacgtgtaca 9660

acggctcata ttcgatcggt gtatcatata tgcctaggat aatggctaaa tgcagcctgc 9720

ctaagaagcg gtcgggagac ggtgctccac ctacctagta gtagtagtag gactaggtac 9780

tccctatgct acgtgtgtaa tgactcaaca ctttctcttg gctatgaccg cctctctgga 9840

tgcaggtgaa ttcacaatta ctaagtaagg tcaagaaagc ggacataatg caagagtgga 9900

cattatgctc ttcttcgcac tctcactacc acatccggag gcacagcatg ctctcccatg 9960

aaaaagttcg gaggccgtcc atcaatctct tcgatgtcgt aatgcaggac gatgtaagaa 10020

agcatcattt tcaatatgcg ggttgcaaac tgtcttccgg cgctacaaaa ccattagaat 10080

tacatagaaa atgagaggta tcagacctac caggccgagc gaccgtgtcc aaaggacaga 10140

aatgtgtcgc ttgtcgagac acaagactct gatttcccat cctgcacaaa acgaaaaggc 10200

ttgaattgtt ctgcattctc gtagaatctc ttatcgttat gaatgggaat tgaaggaaca 10260

gccagccagc tgcctttgtt aaggagttgt ccatttggca gcgccagccc atctcgggga 10320

acgacctcgc gcaacagagc catcgaggtg ggtggcgccc gccgcagact ctctcgaagg 10380

gtgctatcga tgtatcctaa acgatgaaca gtagctgggt cagcccattt agcaggacca 10440

tcaaacaccg actcagcctc gcttcgaaga atttggtaaa tctctgcctt ttcgctcgag 10500

ccgagtatgt cgagcaaggc atggtgcgcc gtcaatacgg tacttgtaaa tgcagctcca 10560

agctggcgga agttgtcaga tcatgataga atcttccaga tgaggtagag ttgataaccg 10620

taccagtaag ttaaaagcgt cagcgaacac cccctcagct ccttctgggc cgcgtgtctt 10680

gaggatggct tgacagagcc aagtgaccat gtcttccggg acctgtgaat cctcctgcaa 10740

tttgttcaat ctctctttta caattggcat caggtaagcc aggtaccggc gctggacata 10800

tccgatgggc ttctgcagca cccacccgat gacgcctcga aaaggggccg gcaaacattg 10860

ccctgttatc gtagaggccg ccccaaacca ctgtgagctc gatatgatcg cctctacaaa 10920

gcgctcattt ttggccaatt cgcgacccgc cagaacggga accaaggtat ggtaaacggc 10980

gtagcgcaac gcgtcgccaa gtgacacctt actgacacag tttgcggtgc caaaactgcg 11040

atcaatcgcc caactcagtt ggtcatacat agccggttgc aacctgtcaa acttcttgtt 11100

caggtggact ttgatcgcgg tgtgcagtat ctcacttgtg gctggtgtga agccaggcgc 11160

cacgtaccgc acgcccatcc gggagtatgc ggcgcggcgt gggcacagga ccgtgggcgg 11220

ttgatcgata atccattgta tgtgctcttg cggtaggatg acgacgggct caaaactaat 11280

caacggcata agaaaggctt tgccagtttt gttgaaggct ttgtagccgg cctcgaggat 11340

ggccggattg tactgccatt gagcaagaca ggcacggaac gcgctgagca agccctgctc 11400

gcgacctatc catgagatgt cctttggccg gcgttggaga ggaaaacagg ctcgggcgag 11460

atggtatagg ctgagtccca ggactaaggg agctatgagg atgagaatgg ttggggctga 11520

aagttggtac tgcatcttgg tcacggcggt catgggcacg ccacggagca aggaattacc 11580

actgtttagt atgagagact gaaaatatag atggtcgatc ccgattgccc tgattaaaga 11640

gcggtatgga tggtgtgacg tccttgcatc aagttttctt cgactttgca tgtaaggggt 11700

ccctagccac ggactcgcct gttctgagaa tgctgatata agaggcacag ctctctatca 11760

tggaattatt tacaggccac agttctatcc cttcgtcaca atgatccgca gtcccactgc 11820

cccaagcagg cccctaggcc agatctcgtg ggacctgatc cgcatctcgc gatttgacaa 11880

gtacaactca tttctagccc tctttgccgg aggttagtcc acccatccca aattcataca 11940

ctctaggcag tgggtgctaa caacacacag tatggtcaac ccttcttgcg gggagcgcac 12000

gacttcgcga agaccctgag cacgtctccg ttcaatatat ccttagtcgt gcttttctgt 12060

gctccatagc cgcatatata ttctctgggg caggcatggt gtggaatgac tgggttgacc 12120

gggacatcga tgctcgcgtg gcacgcacca aggatcgtcc tttagctgca ggcagactga 12180

gcacagaaga agcaatgctt tggatgctgc ttcaagctgg tgtagcaacg acatttttgt 12240

attggatgat ggacggacaa catgtgttcg tgagcccctg gaaaagtcat ctctctctct 12300

ctgctgtacc aaggtcgact aacgaagcgg ggctacctag cttgcattcc atgattcctc 12360

caacattagg aacattgata tatccatatt gcaagcgtcc tctcgctcgc cgacttggta 12420

tctaccctca atatgttctc ggtctgacag cttcctgccc tgtcctcttt ggccgtgctt 12480

cgatataccc tgatatagaa tccttctctc gactcgtatc gtctagcctc ccgctttgcc 12540

tagtggtgtt tacatggact ctctatttca ataccgcata cagctaccag gacatcgttg 12600

atgacaagaa attgggggtg aactcactat acaaccttgc gggaaagcac atacatggcg 12660

tgcttgtggc cctcgtgaca atcatggtga gcgcactgtg gtgggcactg taccccttgg 12720

gatcagcttg gttgtggatc tcttggatgg gagtctggat cgtgggatgt gtggaccaaa 12780

tgcgcagatt tgatgcgaag gatccttcaa gtggacagta cgtcttccgt agcaatgtcc 12840

ttatggggct ctggacgatg cttgcttgtc ttttggaggt tttttctaca gggaagagag 12900

tggctttgtg aacgaaatgg ggaagacata gcgacacaaa taaatattag ctgccagccc 12960

agcaagcgca gagcaagatc atgtgagact ggatgaagca cctgctagaa atatcatggc 13020

atttgatcag gttgaagtga gatcagtatc ccagtagagt agcggggtgt tcttttccaa 13080

aggaatgttc caccctggcc gaacgttctt ctcttccttg cccgtgaatc tttaatgttc 13140

tagcaaccac agacggagaa agactcagct gagaccagcg gctatacagg aacaccagct 13200

actatttaca cgtgttatgc tagattgatg gatatttgag tcatttgtct ttgacatctg 13260

cgctcaagac ttgacgaaga aagggcaaat tcaaaaaccc acagagaccg aacaacaggc 13320

tgaaagccct gatgggagtt cataggttgg taatgagcag taaaactggt actgggcagt 13380

catatgcaat tattcctgta ggagtaaggg gctcgcctag cccaattgcc ttgcaagata 13440

agctagtcac caaataaata tagatcaatt cggttggttt ggactctcat ctccatttct 13500

tgtcttcatc atcctgtaga tatcgccaat gtccctcgag cccatagcta ttgttggaac 13560

aggatgccgc tttccgggtt cctcttcctc accgaatcgt ctctggcact tgcttcaaaa 13620

tccgcaaaat gtcgcctcca aagtccccag tgagcgcttc aacgtggact cattctacca 13680

ccctaatagc cagcagcatg gctcgacaag cgtggccgag tcttattttc ttgaggaaga 13740

tataagagcc tttgacgcgc ctttcttcag catcagccca gcggaagcgg ctgccatgga 13800

tccacagcaa cgcttgcttc tggagacggt ttatcactcc ctcgaggccg gtggccatag 13860

acttgacgct ttgcagggct cggccacagg agtctactgt ggctttctcc ggactgatta 13920

cagccagata cagtttacag acccggactc gttgccaccg tacacggtta caggaaattc 13980

tcccgcaatc atggcaaacc gcatctcata ctttttcaac tggactgggc catcgttcgc 14040

ggtggatacc gggtgctctt cgagcttgct ggcagttcac ctggctgttg aatcgttgag 14100

gaaaagagac tgtgatttgg ctgtcgcggt ggggagtaat ctgcttctat cgcccaaccc 14160

ttatatcgcg gatgcaaaga cgggaatgtt gtcagctaca ggccgatcgc ggatgtggga 14220

tgcatccgcg gatggctacg cgcgcggaga aggggttgcg tcggtagtac tcaagcgatt 14280

gagcgacgcc gtcgctgcag gggacgagat tgagtgtgta attcgagcta cagggatgaa 14340

cagcgacggc cggacaatgg gtatcaccat gcccagtgga gaggcacagc ggaaactgat 14400

tgagtcgacc tatgccagta ttggacttga tcccaaaaat gctcaggaca gatgtcaata 14460

tttcgaggcg cacgggacgg gaacgcaggc gggagatcca caagaggcca gtgcgattca 14520

tgcggcattc tttgggaacg aagctgaaaa cgacagctct aacgtcctgc atgtcggttc 14580

aatcaagaca gtaatcggtc atacggaagc aactgctggc ctggctggct tgatcaaggc 14640

atctctgtgt ctacagcatg gggagatcac accgaacctt ctgttctcca cgcctaaccc 14700

tcgcataaca ccgcatctta ctcgactcca ggtgccgagt gagtctgtag catggcctac 14760

cctgccgccc ggggcaccac gtagggcttc ggtgaactcg tttggctttg gcggtgctaa 14820

tgttcatgcc atcctggaaa gctatgaacc cccttcttca tctcgccgag gctcagaaga 14880

tgcagaggcg gattgtttgc ttcttccctt tgtggtttca gcggcatcag aaccctcatt 14940

gaggacagca ctggagaggc ttttccaatt ccttgaggat cagccggtga caaacatgat 15000

cgactttgct cagaccctct tgacgcggcg ttcgtgccat aaacatcgta tagtatttat 15060

cgctagctca tcggacgagc tcagagacaa gattctgcat gaaatatcct acccatccag 15120

tggccagata tccgcgaaaa ttcatcgccc tgtccaggca aatcggagct ttggcatatt 15180

gggaatattc actggccagg gggcacagtg gccgcagatg agtctcgata ttatcaatgc 15240

cagtccacag gctcaaaggt ggatggctga tatgcagaaa gcccttgaca cgctccctca 15300

acaataccgg cctgattttg atctattggc agaacttgca gtcccaaagt ccgactctcg 15360

aattcatgaa gctagaatct cacaggttct acgcactgct gttcagatcg tgcaaaccaa 15420

cctccttcgt acccttgggg tcaactttga tactgtgatt ggccactcat cgggcgaaat 15480

cgccgccgct tttgctgctg ggattctcga cctctcagat accatccgga ttgcttacct 15540

acgagggtgg gcgatcaaac agtctcaaaa tcagcaacaa tgcccaggga gcatgattgc 15600

agtgatgctt gattggaacc aagcagaggc catttgctgc aaccttgccc agtacacagg 15660

gaagattcaa atagcagcct acaattccct cagaagtgtc acactatctg gcgaccgcaa 15720

catgatcgat gaactggcct ggctactttc aagtttgggt catgctgtgc accggctcca 15780

cgttgatact gcgtaccatt cccaccacat ggagcctgcc gccaagctgt atcggcaagc 15840

cttgaaagct tgcaacatcc aggcaaaaaa gcccagatcg acaatgcgct ggttttcatc 15900

cgttcatcct ggggtagacc tcaatgctac cgggatttct caaccgaggg agtactgggt 15960

agccaatatg ctggagtcag tttcattctc acaagctgtt tcgaccgcgc tcctgtcatc 16020

ttcagatacc cagtatagct gtgccattga gattggtccg caccctgtgc tcggtggacc 16080

agtcaagcag atccttgagg ggatggcgag accgatagac ctgccgtatt ttggcctagc 16140

gaggcgcgcc acatcaggaa tacaatcatt cgccttggcg attggacaac tctggactat 16200

ctttggtcct ggcgaactag atttccaggg ctatctccgc gcattcaata tcaatgcttc 16260

accttctctg ttgaaagacc tgccgagtta cccatttgac catagccaat catattgggc 16320

cgagtcacga ttatcacgag ctcgcttacg tgcacaaaat cctccaaatg cattgttagg 16380

ccgattgctt cccacctctg gccaaggaga acgacgctgg agaaattatt tgcgccccga 16440

ggagcttttg tggttggatg ggtacaaatt agaggggagg ccagttcttc cgccagcaac 16500

atacgtctcc atgatggttg aagcggccct tgagatttcc ggggtatctc cagtacaact 16560

actcgagctt cgtgatctag aattctatca agatgtcccg ctcccatcag atcaggctgg 16620

acttgaggta ttgttcgctg cggaggtaag ctcaaatgaa tctcatgcgt tgggcaggtt 16680

cagctgtcaa gcagctgttg atggtgagct ttgccgtgct gcttcaggcc aattcgaaat 16740

tacctatgat gtacctggct ttcaagctct ggctgcacga gccacacctc tgacgctcca 16800

gccaatggat gtgaacggat tttaccgcga tttatctgct ctaggtcatg acagatgtgg 16860

agatttcaaa ggcctttcta cacttgcttg caatcggaaa gtcgcttctg caaccatagt 16920

ccatccaggc agcaacagcc atcaaccctt gaattttcac cctgccacaa tcgaccacgc 16980

ttttcagact gtattagcaa cttcgatctc caaaacgagg gatcaggcca ccggctcgcg 17040

ctacacaatc tccagaatat cttatttggg catcaatccg accttgcgcc cggcagatag 17100

cgaagcactg aacattgacg gctcaatcgt tactaaagtc ccgggtttga tcaccggcgc 17160

tgcagaaatt ttccggtcaa atgacgagtg cctgctatct tgcgagggaa tacaaatctc 17220

tagaaccgcc aatgcctcca gcccacctca attgtttagc accattgact ggatacctct 17280

tcaacccagc gcaaccgcag gtggaaatgt actatgccga ccaggggccg tgaggacgct 17340

gatggctcgt gaacagctcg cactactgct cctgcgtgat atatgcagga aagatgcgcg 17400

gaagtcaagg gaaaccctcc cagaaggcaa ggctgcattc ctaaactggg ctgatcatgt 17460

cctggcccat gtcagagagg gcatgcatcc agtctgtcgc ccggagtggc tcgcgggtaa 17520

atctgacgag atctgcacac ctccacttga acctctgatg cgcattggtg aagattgggg 17580

aaaccttctc gcttctgagt gtgaggatgt tattcctgct gtggagcttc tggatcgata 17640

ctacgctaca aatatgcaag acttcaaccc gtggtattac cgcttcgtgt cgctagtcaa 17700

acagctgaca gcactctatc cagtgatgga tatcattgag gtgacagtca gtccgagtta 17760

tcgactgaca aaccgtgttt tgagcgagat cgggactgcc tataagacct atacacgcgc 17820

ggtggtcaac atgtccacgg cagcatcaag cacgaagcca gctgcacaac cacaaatcca 17880

cgagaagaac ttcgaggccg acgcgttcaa gcagaattcc gtcgatctaa ttatcgtcca 17940

tcaggcgctt tacagcacaa agtcgttaga cgatgccttc aaaagactgc gccgaatgat 18000

caagcctggc ggctacctcc tcattcttga agatacaaac cccaacctca ttcatcggaa 18060

actgctgctt ccattcagcg gctggaaaaa gacaagtaca gaacatctgt ccaatggccc 18120

tattcagaca cgtgacgcat ggaaatccct ccttttcaag catggtttca gcgggattga 18180

ttcaataacc tcaattcatg acgaggtgat agctggtctt tccatcatgg taagccgcgc 18240

ggtggaacct gcggcccaag agattcaaag tccatctcac gagtcaaaca agcccagcga 18300

tttggtgatc gtggcggcgc agaataagtg gatgaatcgt acatggattg ccgtctctga 18360

gcgctttcgc cgtatggaac tagtcgagaa tattcgcgag attaaatttg ggacaggaag 18420

aaatccgcct gtcgtccttg ttgtgacaga ctctttgcag ccaacagtct tttcagggcc 18480

ccatgaggag gagaaacagc taagacggtt gtttgctggg gccagcaaag ttctctgggt 18540

tgtttctcgc tctgatttca gaagccctgt ggctttgtcc aacgctgtta cagcgggaat 18600

tctttctagc ctctcagttg agtacccaga cacaatgttc cagcgcctcg agcttccctg 18660

cgatctgcct tctaaggaaa atgtcgatgc tgtggtcacc cttctgatgc gcctggtgtt 18720

cacatcttca aaagaaagtc tctcgctaga atcgcacatg cgactgtctg agaagggtgt 18780

ccttcatgtt ccgcgtcata catattccga ctctatgaat cagcgctgtc tagcagcgca 18840

cgtcgaagtt caaggtgaca ttttgttcaa tcggaatcaa aaatatactg tactgcaggt 18900

tgagcatgtg ggaacgaccg agaaacaagt cgctcgcctg catgcatatc catccatcgg 18960

actcatgtct ggtgtctcga gaacaaatat cgaggtcgaa gttgattatt ccacagcaca 19020

tagtatcaaa attgaagggg cgggatcttt ctacctttct ttaggtacag cctcccgtca 19080

tagcagcggt ctccaccctc gcacgggaaa aggccactcc agtcgcgtct tcgcactctc 19140

tgagcgcaat gcgtcacgcg tgcatacccc aatcttgtgg tgctgggatg tccctgccgc 19200

tgtttccgcg gcgcaggaag ctgggttcct agcgaatata gtggctgtct tgatcgcgaa 19260

agatatccta tccaagactg aacccgactc ttcaatattg cttttagaac ctgatgtgac 19320

catcctgaag atcctcgatt cactcgcgcc tttgcacaag acaaagatta tatcggtcac 19380

acacaaggca actgccaaag ccaacagaaa gagtctgatt tatatccccg agcgtacgcc 19440

ctctcatcgc atacggcaaa tgattccaca caaaaaagtt gtcagagccg ttgtttttga 19500

ttctaaccgc gtctgtaacg gacgaaatga tcgcatctgc aacctctttc cgaatgctcg 19560

acagcttgat atcgcgtcct tctatcaaac tgtgccgatg ccaaactcac cagaacatgg 19620

ttccatactg tgtattcctg cagcggttca gagtgtagcg gggtggcttc accccgaaga 19680

ttccactttt gcagtaacct cgatcacaaa acttatttca gaagaaatcg atctacgacc 19740

aacctctgtg atcaaatggt catctgagac tcagaacccg atcaaagcgc agatacgttc 19800

agcgacagat gcggtcaatt tgtcgcaaca aggcgcatat gttttgtggg agctgcccaa 19860

ggccttgaga aggaccgttg ccgattggct tgtctcccat ggagcgcagc atcttgtttt 19920

tgttcagaaa attcccgatg atacccagtg ggtgtccagc attacatgtg gtggtgcaga 19980

agttgttatt gtgcctcctc aggaagatct cgttcacacg gttcttgcgc tccgagacca 20040

ctcgtctgtg ccgcttgttc ggggtattgt atttactggg gcactcgata atgctgtggc 20100

tgctgagacg atccaacggg ctaaatgctt gtcccaacat tacgactctc ccaatctaga 20160

gatgttcttg agcattgact gctgcccagc gataccgaat ccgcagcagt gcgctgtgac 20220

cgaatttctc gcagcactag cacatcaacg agcaatgatc aatcttgcgg caagtgtcct 20280

ctgtcttgga cccgggtttg atctcgacaa tccacacgga gatgatattg cggagatact 20340

tgcagaggct gccttagccg gccatccctt tgccggtggc gatcgcgtgg ttacagctgg 20400

cctctgtccc ggtactggca gtccagagta caaggcgtgg gacactatcc actcgcggaa 20460

cccagcaatg tcgaacatcc ttgctttgtc aaggaaaggt gggcaagaag agactgctgg 20520

cgttgaggca gccacggagc atatcccttt gaaagtccaa ctcgagcgtg ctaaagaaac 20580

cacatcggca gccttggctg tgcgggctat tttgaatcag tactttacca gatacctccg 20640

gatgcggctc cagtccacgg ccgagatcaa tgagaatacc ttattcaacg aacttggtgt 20700

ggactcgatg gtcgcggcac agttggttgg gtggtttatg aaagaagttg gcgtggaggt 20760

ttcggttgtt ttcattctcg ctggcgcatc tgttggcgag gtcctccagg atgtcacgga 20820

gaagcttatc ccttgaggtc gagatttttc tgtgtgaata aatatagctc tcctgacgcg 20880

accttagaaa accacatgcg taccagatgc aaatttttag gtcattcaat attaacatct 20940

acatgcagaa gcaattactt ccttcattat cagtctcatt tataatctgt gcactagact 21000

gtaatagagg ctgtgcagca tgactcaaaa actaggaaaa ggtcacttca acaggctagg 21060

tacgtttatc accaacaaaa gatggaatct gatccactca gctcatttga tgtagacatg 21120

gataaatatt ggcaccgaag gcatatttac actactgccg gcgagattga gccaaacata 21180

acaagctgcc cgaggtgcgg atttgcaatt gatccgtgac atttccttga aggacccaac 21240

cgcctcccat cacaacgccc cagctgaggc aaaacggcgc tcggagaaga cttgaacgta 21300

aattgaacga gagttcctaa ggaatttcac gcaatggaaa gcgccgcccg ctcagcccag 21360

acgtaggtgt ggtatacccg ctgacccgtg ataggaagct cagcgaccac ctatttctat 21420

aagcttttgc ccctcgcatg ggtaagtcct ataaaaaaga gccctcttcg gttcgatgca 21480

atcccttctg tgtttacttt caagtatcaa gtgatcatgt ctgactctaa ctgttacgac 21540

ctggtcagct ttgccttcaa cgggccgttc ctccacagcg aacagccacc gattttcatc 21600

gatgccaaaa gtccctctcg agcgttgagt gccgggccgt tcaagcgact tctttgctcg 21660

ctgattgccg gtctcactgc tcaccagatc cagccagggg actgcgtgct tgttcaaatg 21720

gataactatg taactgaacc tggacctagg cctcagtctg tggatgagac ctttactgac 21780

ggatgcgcga gcaccagatc cttcattccg ccgtctatct cgcaatcatc ggtgcaggag 21840

gtgtctacat gggctgtagc ccgacgactc ctcgccacga gctcgagcat tttgtgaagc 21900

tctctgatcc acgtatcatt ttgacagcag agagtgctct ccctctggtt cgagaagtct 21960

gcgcttcttc tccttcgccg cgccaaatct gcctcgtcac cgaaactgga attgatgagc 22020

ttattgcctt cgcgaacgaa cacgacccta gcaacggttc tctgtcctcg acggggaaca 22080

aaaatgacgg aagaaacaat gacccggagt tgcagcctga ataccccatc actgaactta 22140

caggccatgg ctcagccccc tggcgtcgta tacccacatt ggaacttgcc aaaacgacac 22200

cagcggccat gtttactact agtggcacta gcggactccc caaagcagcg atccgcacgc 22260

accacaccat catctcgcag cacctgagcg tctactacca gaccccctac agcatctcca 22320

ccgagatcac agaggaaggt gtcgaaattg acgcaagttc aaaaacccaa catggtcgaa 22380

tccgtcgcct tctcgccctt cccgcctacc attccttcgg tgacttctgg aataacctgt 22440

tcccgctccg ctatggcgag ccgctataca tcgtcccacg cttcgatctc gctgacttca 22500

tcgccgcggt cgagcgcttc cgcatcacgg agacctatct cgtccccgtc gcggtgcaga 22560

tgctcgcgca ggcgggccgg gcagccaatg gtgcgcgggt ccgcgagggt ctcgcctcgt 22620

tgcgatatat cggtgtgtcg ggggcgccgg tcgatgcggc ctctttgcaa agatgtgagg 22680

aggtcttgca tccagatgcg tgtgtgagtc agctgtgggg gatgaccgag gttggggtcg 22740

ttttccaaaa tcgctatggg gatcgcctgc atcctggaag tttgggaatg ctgcttgacc 22800

ggtacgaggt gcgattggtg gatcccgttg ggggtgaggg agttgatgga tcgcttggtg 22860

aacttgggtc agggcaacca gccacaggag agctgtatgt tcgtggaccg gggctcatgg 22920

ctgggtacaa aggacgaagt gaccccgttg tggatgcgga ggggtggttc ccgaccggag 22980

acatggtcta cgagaaagac ggacactggt ttattgtggg tcggaccaag gagctgatta 23040

aggtaagggg gtactcggtc gctccggcag agatcgaggc gcttctgctc gacaaggagg 23100

agggcatagc agacgtggct gttttaggag tcaaatcggg gaatggggac ggagaggaag 23160

tcccacgggc ctacgtggtc cgttcaaagg agcaaagtca aggcagtggt aagatagcaa 23220

cgtccggggt agtcaccgag gagcggattc gggcgatcat gcagcaacat ctggccagct 23280

acaaggcgtt ggaaggcggc gtggtctttg tcgacagcat tccacgcaca gacatcggga 23340

agccggctcg gtccaagctg gcgagattga atcagcagcg tgacgagctg gcagccttgc 23400

tccaggcgac ttgtacaagt gtcagagaga agtagaagat agaatggcac actctagcgg 23460

tggtttattc acttatatat gactacgttg atgagtttcg ccgcttcatc aagacttggg 23520

cctgcggatc cgccagaaga atctcatcga tcatcatatt cctcggtcgc tccttcccat 23580

caggcaagcg gaactcatac ccgaccaaca aatgggccag gatgatcttg atctcgttgg 23640

cagcaaagaa tctcccgggg caagcgtact tgccatggcc aaagtgaaga ctatttttgt 23700

cggttgtggc gaactgatgc cggtgtgctt ctgcgggatc gaccctacgc cgccgtgagt 23760

agcgatatcc gtcgaactcg gggtcataat ctgtgctatt ggtgatatct gcagcgggta 23820

ccgcgagatg tgtccccttg gggagaacgg tgccgtcaga tagggtaaga tcgcgcatga 23880

cgatgcgttg gaagctcact aaagcagggt tagatcggag ttggcccaaa gaactcggtg 23940

ggatgattaa agacttgggg ggtaacgaac gtagagcagg cgggttcaaa cgctgcactt 24000

ccttgatgaa gctgtcgaga tcccacatct tcgtcagagt cgtcttctta tattcgccgc 24060

catcttcgac gagggcctga agcacctctc gacgtaaggg ctcaatatag tcttggtgcg 24120

cgcagagatc gtatacagcc tgggttgccg aggcggtagt ggtgtggatt gctgccagac 24180

tgaggatgag ctgacgatgc gcgagttttt cgggctgact gtcatacgga ttcgccttgt 24240

ccatcatcca ctgcaggaga tcggctggct ttttcttctc cgcatcgcct gggctcgtgg 24300

attgctggga tcgtcgctca cgaaccaagg tgccgatgat tcgatttccc gtcgagagcc 24360

cgcggcggat cgccctgtat cgaggaataa gaggagcgat gagcgggcgc atccagcgtg 24420

gaaagcgacg caggatggcc agggtaagga aaacatcctc ggtaaaatgg atcgagagat 24480

tgagccattc ctcattacgg caggtaggga gcccgacaaa gacgcgtgcc gaaatgcgcg 24540

cgacgatgcg cagaatgacc tcgtagatac aaactggagt ccattcgtcg atagtgagat 24600

tgcttggccg gaactcctgc gcgaaagcaa agtctagctc ggatttgaca tcgtggatca 24660

gattgccgag tcgcggggtc aactcggttt gcaagacgtg tgtatgcagg gtcccctcat 24720

caaggatgtc gatggtcgaa tacctgccga gaagattctg cagagttcaa aattcaaggg 24780

gtcattgaca tgctcgatcg agagcaatat gtgtaagaag taccttcata tgtgccttga 24840

tcgcactcag ctgctcatcc ggcttggagt gtagctcgtc cacaaatcgc cttggaacga 24900

ccagaatgtt cgtgtccacg cgtgcgatcc tgaacatccc atccttgtat tgtcgacacc 24960

cctgcgtgat ctggtggagc gcatcttgcg aaaaacggac agcaaccagc cagcggggct 25020

cccagcgaga gcggaaacca acaaaaggcg cttgcaggcg atgtgagtgg aagaccaact 25080

tctgcaggaa tacaatgcct agggcgacca ggctgatttg gacgagggaa ctcgactcta 25140

cgagccagga agtggtgagg tccagtttcg tcatattcag tgaacgtgta ggtagctagc 25200

ggaagggaaa atggtaaaga gggcttgcca actatgccta catcgcatca aacgacttta 25260

taagaggcac acgctgaagc ctgcaagggg ctctatcagg cagacttcaa cgccagctca 25320

tcctccatcc tgcgatctct caccgtccac accggcactc catgataccc gcaccaactc 25380

cgccacgcga tcatcttctg cgcgaggggc gtcatttctt ccagaatatc tcgcgacagg 25440

tcaacatggg cctccatcgg ggtaaaatgc gcgggatgca tcgtcacact caacccacgg 25500

cggctctgca tggactgatt ctcgccagcc ccatgccaga cgcttcccaa gtacaagaca 25560

gcgtcacccg gccgcatcac cgcgcccact gtgttttctg gaactgcccc ggaaatctcg 25620

tctccactcc agcgatggct cccgggaatc agcctggtgg caccattatc ctcgcgaaat 25680

tcggtcagcg cgatgaaaaa gttcatcatg agttctggcg cgcccggtcc cagatacttc 25740

gtgaccccgt atagactgtc atcgcggtgc agaccctggg gtttctcacc gggttcaacc 25800

tggagaacgg cggctcggtt gacccaatag tcgccaaagg gtgcggtgaa gaaagagtcg 25860

gagacggcat gcatcatagg gtggttcagg atagtcgtgc ggtatgtcgg ggagatggcg 25920

gctaggtttc ccatatgctt cgtgcgcgag ccgacggtct ttttgtacaa ctcgccggat 25980

cttgcctggg ggccggtgat ggtggcattc aggtatgggt cgacttcttc attgagggca 26040

gcgacaaccg agattggaac aaactgtcgc acgatgacgg cgccgtcact cacgatgagc 26100

ttgctgattt cctctgtgga cgttgagggg tcgacagtac ggatggcctt tggagaaacc 26160

gagacagtca tggcgacgga gatcccagcg tgcacttctt tgaaatgagc tgatgcttgg 26220

attctttgaa cgagcttata acttagcttg atcgcaccaa atgcaatggt gaacggcggt 26280

gtgatgttga tctattagag gccatgttta tcccactgga aatgcaaggg gtagttagta 26340

gcgaaggggg cggatcaggg gagacagact tataatcatt gatgcaatca gggtcgtgac 26400

ggagagaagg aggcttgtcg taacagcgcc caccaaacca agatgatcgc ttttgtgctc 26460

tgtgcggtga tcacggtact gtatgtgatc ggaaccgccc ttcgagacct ttacctccac 26520

cctctgcgtc gagtcccttg ccactggcca tgggtggctt ttcctctgct ccgtcatata 26580

tccgccgtgc gcggcaacgt tgacctcgac atcaaacaat ggcacgaccg atacggcccg 26640

gtggtccggt tctctccaaa tgaggtctcc ttcaccacct ctgaagcctg gagtgaaatc 26700

tacggccgcc atggccgata ccaatgcctc ccaaagacca agttctcaaa cacgagcaca 26760

atagatctca tccacgcaaa cgatgcggat catgcccgat accgcaaggc tctcgcccat 26820

ggcttctcta ccaagggtgt tcgcgagcaa gagtccctaa ttcagggtta tatcgacaag 26880

ctcgtctccc aacttcaagc gtttgcagat gcacaccagc aggtagatct ggtgatttgg 26940

taccgactca ccactttcga tatcattggc gatttggcat ttggcgagca ctttggtggc 27000

ctcgacaagg ggcgctatca tccctgggtt accttcatga ccgggtacac gcgcatgatt 27060

cctttcttca aagcaatgga tgcgtatcca gctatctttc gcaccgcatt cgctttcatg 27120

tcatcctcat ctcaggcaat tgcgcagcag atgcagtaca gtcgggaact agtccagaaa 27180

cggatcaaat cggcctcatc gagccgtccg gactttgtgg actcgatcat gcgccagcag 27240

ggaaccaagg atgagctctc cgatgcggaa atcgaggcaa acgctagtgt cattataatt 27300

gctggaagtg agaccccggc tgatctgcta tgttcggtga catattggct cttacggact 27360

cccaacgttt ttgctcgtgt acggaatgag ttgcaagatg cgatcacctg cccagcggat 27420

ataacttttc agaccgtcac tcaaggacta cctctcctca cagcatgcct gaatgaggct 27480

ctgcggctct atccctctgt acctgggggc ctacagcgcg atacagtggg ctcggccacc 27540

ctctcgggat ataccatcgc tcccaatgtg aggaatccaa agatattggc catcagtgtc 27600

ctctgctgat cataaaaaaa acaacagacg caggtcggcc ttcatcaata cgcagcctac 27660

acttcgtcat ccaacttcca tctgcctgag tccttttgcc cagaacgctg ggacccagat 27720

gtgccgaata atccggcgtc cctgttttac aacgacaatc gtgacgtatt tcagcccttc 27780

tcggctggac cccggaattg tatcggcaag aacctggcgt acgcgatcat gcgaacggct 27840

ttagcaagag ttctatggga attcgaccta aagttgtgcc ctgaaagtga gaattggcat 27900

gtccagaaaa cttatgggct atgggacaag gggccgctgc tttgtcaact gagccgaagg 27960

gaatgcagaa agtgattctt gttggaagct ttacgtctca atgccagtag atcattgtcc 28020

aggagaatgt cccttcattc tggaattttc taatacaatc cgaacaagtt gttctattcg 28080

ttaacgctgg tatggtggct ttgacttgtt gtgtgaacac gcagtacaat ggtctag 28137

<210> 2

<211> 1524

<212> DNA

<213> Penicillium oxalicum

<400> 2

atgcagtacc aactttcagc cccaaccatt ctcatcctca tagctccctt agtcctggga 60

ctcagcctat accatctcgc ccgagcctgt tttcctctcc aacgccggcc aaaggacatc 120

tcatggatag gtcgcgagca gggcttgctc agcgcgttcc gtgcctgtct tgctcaatgg 180

cagtacaatc cggccatcct cgaggccggc tacaaagcct tcaacaaaac tggcaaagcc 240

tttcttatgc cgttgattag ttttgagccc gtcgtcatcc taccgcaaga gcacatacaa 300

tggattatcg atcaaccgcc cacggtcctg tgcccacgcc gcgccgcata ctcccggatg 360

ggcgtgcggt acgtggcgcc tggcttcaca ccagccacaa gtgagatact gcacaccgcg 420

atcaaagtcc acctgaacaa gaagtttgac aggttgcaac cggctatgta tgaccaactg 480

agttgggcga ttgatcgcag ttttggcacc gcaaactgtg tcagtaaggt gtcacttggc 540

gacgcgttgc gctacgccgt ttaccatacc ttggttcccg ttctggcggg tcgcgaattg 600

gccaaaaatg agcgctttgt agaggcgatc atatcgagct cacagtggtt tggggcggcc 660

tctacgataa cagggcaatg tttgccggcc ccttttcgag gcgtcatcgg gtgggtgctg 720

cagaagccca tcggatatgt ccagcgccgg tacctggctt acctgatgcc aattgtaaaa 780

gagagattga acaaattgca ggaggattca caggtcccgg aagacatggt cacttggctc 840

tgtcaagcca tcctcaagac acgcggccca gaaggagctg agggggtgtt cgctgacgct 900

tttaacttac tgcttggagc tgcatttaca agtaccgtat tgacggcgca ccatgccttg 960

ctcgacatac tcggctcgag cgaaaaggca gagatttacc aaattcttcg aagcgaggct 1020

gagtcggtgt ttgatggtcc tgctaaatgg gctgacccag ctactgttca tcgtttagga 1080

tacatcgata gcacccttcg agagagtctg cggcgggcgc cacccacctc gatggctctg 1140

ttgcgcgagg tcgttccccg agatgggctg gcgctgccaa atggacaact ccttaacaaa 1200

ggcagctggc tggctgttcc ttcaattccc attcataacg ataagagatt ctacgagaat 1260

gcagaacaat tcaagccttt tcgttttgtg caggatggga aatcagagtc ttgtgtctcg 1320

acaagcgaca catttctgtc ctttggacac ggtcgctcgg cctgcgccgg aagacagttt 1380

gcaacccgca tattgaaaat gatgctttct tacatcgtcc tgcattacga catcgaagag 1440

attgatggac ggcctccgaa ctttttcatg ggagagcatg ctgtgcctcc ggatgtggta 1500

gtgagagtgc gaagaagagc ataa 1524

<210> 3

<211> 507

<212> PRT

<213> Penicillium oxalicum

<400> 3

Met Gln Tyr Gln Leu Ser Ala Pro Thr Ile Leu Ile Leu Ile Ala Pro

1 5 10 15

Leu Val Leu Gly Leu Ser Leu Tyr His Leu Ala Arg Ala Cys Phe Pro

20 25 30

Leu Gln Arg Arg Pro Lys Asp Ile Ser Trp Ile Gly Arg Glu Gln Gly

35 40 45

Leu Leu Ser Ala Phe Arg Ala Cys Leu Ala Gln Trp Gln Tyr Asn Pro

50 55 60

Ala Ile Leu Glu Ala Gly Tyr Lys Ala Phe Asn Lys Thr Gly Lys Ala

65 70 75 80

Phe Leu Met Pro Leu Ile Ser Phe Glu Pro Val Val Ile Leu Pro Gln

85 90 95

Glu His Ile Gln Trp Ile Ile Asp Gln Pro Pro Thr Val Leu Cys Pro

100 105 110

Arg Arg Ala Ala Tyr Ser Arg Met Gly Val Arg Tyr Val Ala Pro Gly

115 120 125

Phe Thr Pro Ala Thr Ser Glu Ile Leu His Thr Ala Ile Lys Val His

130 135 140

Leu Asn Lys Lys Phe Asp Arg Leu Gln Pro Ala Met Tyr Asp Gln Leu

145 150 155 160

Ser Trp Ala Ile Asp Arg Ser Phe Gly Thr Ala Asn Cys Val Ser Lys

165 170 175

Val Ser Leu Gly Asp Ala Leu Arg Tyr Ala Val Tyr His Thr Leu Val

180 185 190

Pro Val Leu Ala Gly Arg Glu Leu Ala Lys Asn Glu Arg Phe Val Glu

195 200 205

Ala Ile Ile Ser Ser Ser Gln Trp Phe Gly Ala Ala Ser Thr Ile Thr

210 215 220

Gly Gln Cys Leu Pro Ala Pro Phe Arg Gly Val Ile Gly Trp Val Leu

225 230 235 240

Gln Lys Pro Ile Gly Tyr Val Gln Arg Arg Tyr Leu Ala Tyr Leu Met

245 250 255

Pro Ile Val Lys Glu Arg Leu Asn Lys Leu Gln Glu Asp Ser Gln Val

260 265 270

Pro Glu Asp Met Val Thr Trp Leu Cys Gln Ala Ile Leu Lys Thr Arg

275 280 285

Gly Pro Glu Gly Ala Glu Gly Val Phe Ala Asp Ala Phe Asn Leu Leu

290 295 300

Leu Gly Ala Ala Phe Thr Ser Thr Val Leu Thr Ala His His Ala Leu

305 310 315 320

Leu Asp Ile Leu Gly Ser Ser Glu Lys Ala Glu Ile Tyr Gln Ile Leu

325 330 335

Arg Ser Glu Ala Glu Ser Val Phe Asp Gly Pro Ala Lys Trp Ala Asp

340 345 350

Pro Ala Thr Val His Arg Leu Gly Tyr Ile Asp Ser Thr Leu Arg Glu

355 360 365

Ser Leu Arg Arg Ala Pro Pro Thr Ser Met Ala Leu Leu Arg Glu Val

370 375 380

Val Pro Arg Asp Gly Leu Ala Leu Pro Asn Gly Gln Leu Leu Asn Lys

385 390 395 400

Gly Ser Trp Leu Ala Val Pro Ser Ile Pro Ile His Asn Asp Lys Arg

405 410 415

Phe Tyr Glu Asn Ala Glu Gln Phe Lys Pro Phe Arg Phe Val Gln Asp

420 425 430

Gly Lys Ser Glu Ser Cys Val Ser Thr Ser Asp Thr Phe Leu Ser Phe

435 440 445

Gly His Gly Arg Ser Ala Cys Ala Gly Arg Gln Phe Ala Thr Arg Ile

450 455 460

Leu Lys Met Met Leu Ser Tyr Ile Val Leu His Tyr Asp Ile Glu Glu

465 470 475 480

Ile Asp Gly Arg Pro Pro Asn Phe Phe Met Gly Glu His Ala Val Pro

485 490 495

Pro Asp Val Val Val Arg Val Arg Arg Arg Ala

500 505

<210> 4

<211> 5926

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgacacaaat aaatattagc tgccagccca gcaagcgcag agcaagatca tgtgagactg 60

gatgaagcac ctgctagaaa tatcatggca tttgatcagg ttgaagtgag atcagtatcc 120

cagtagagta gcggggtgtt cttttccaaa ggaatgttcc accctggccg aacgttcttc 180

tcttccttgc ccgtgaatct ttaatgttct agcaaccaca gacggagaaa gactcagctg 240

agaccagcgg ctatacagga acaccagcta ctatttacac gtgttatgct agattgatgg 300

atatttgagt catttgtctt tgacatctgc gctcaagact tgacgaagaa agggcaaatt 360

caaaaaccca cagagaccga acaacaggct gaaagccctg atgggagttc ataggttggt 420

aatgagcagt aaaactggta ctgggcagtc atatgcaatt attcctgtag gagtaagggg 480

ctcgcctagc ccaattgcct tgcaagataa gctagtcacc aaataaatat agatcaattc 540

ggttggtttg gactctcatc tccatttctt gtcttcatca tcctgtagat atcgccaatg 600

tccctcgagc ccatagctat tgttggaaca ggatgccgct ttccgggttc ctcttcctca 660

ccgaatcgtc tctggcactt gcttcaaaat ccgcaaaatg tcgcctccaa agtccccagt 720

gagcgcttca acgtggactc attctaccac cctaatagcc agcagcatgg ctcgacaagc 780

gtggccgagt cttattttct tgaggaagat ataagagcct ttgacgcgcc tttcttcagc 840

atcagcccag cggaagcggc tgccatggat ccacagcaac gcttgcttct ggagacggtt 900

tatcactccc tcgaggccgg tggccataga cttgacgctt tgcagggctc ggccacagga 960

gtctactgtg gctttctccg gactgattac agccagatac agtttacaga cccggactcg 1020

ttgccaccgt acacggttac aggaaattct cccgcaatca tggcaaaccg catctcatac 1080

tttttcaact ggactgggcc atcgttcgcg gtggataccg ggtgctcttc gagcttgctg 1140

gcagttcacc tggctgttga atcgttgagg aaaagagact gtgatttggc tgtcgcggtg 1200

gggagtaatc tgcttctatc gcccaaccct tatatcgcgg atgcaaagac gggaatgttg 1260

tcagctacag gccgatcgcg gatgtgggat gcatccgcgg atggctacgc gcgcggagaa 1320

ggggttgcgt cggtagtact caagcgattg agcgacgccg tcgctgcagg ggacgagatt 1380

gagtgtgtaa ttcgagctac agggatgaac agcgacggcc ggacaatggg tatcaccatg 1440

cccagtggag aggcacagcg gaaactgatt gagtcgacct atgccagtat tggacttgat 1500

cccaaaaatg ctcaggacag atgtcaatat ttcgaggcgc acgggacggg aacgcaggcg 1560

ggagatccac aagaggccag tgcgattcat gcggcattct ttgggaacga agctgaaaac 1620

gacagctcta acgtcctgca tgtcggttca atcaagacag taatcggtca tacggaagca 1680

actgctggcc tggctggctt gatcaaggca tctctgtgtc tacagcatgg ggagatcaca 1740

ccgaaccttc tgttctccac gcctaaccct cgcataacac cgcatcttac tcgactccag 1800

gtgccgagtg agtctgtagc atggcctacc ctgccgcccg gggcaccacg tagggcttcg 1860

gtgaactcgt ttggctttgg cggtgctaat gttcatgcca tcctggaaag ctatgaaccc 1920

ccttcttcat ctcgccgagg ctcagaagat gcagaggcgg attgtttgct tcttcccttt 1980

gtggtttcag cggcatcaga accctcattg aggacagcac tggagaggct tttccaattc 2040

cttgaggatc agccggtgac aaacatgatc gactttgctc agaccctctt gacgcggcgt 2100

tcgtgccata aacatcgtat agtatttatc gctagctcat cggacgagct cagagacaag 2160

attctgcatg aaatatccta cccatccagt ggccagatat ggaggtcaac acatcaatgc 2220

ctattttggt ttagtcgtcc aggcggtgag cacaaaattt gtgtcgtttg acaagatggt 2280

tcatttaggc aactggtcag atcagcccca cttgtagcag tagcggcggc gctcgaagtg 2340

tgactcttat tagcagacag gaacgaggac attattatca tctgctgctt ggtgcacgat 2400

aacttggtgc gtttgtcaag caaggtaagt ggacgacccg gtcatacctt cttaagttcg 2460

cccttcctcc ctttatttca gattcaatct gacttaccta ttctacccaa gcatccaaat 2520

gaaaaagcct gaactcaccg cgacgtctgt cgagaagttt ctgatcgaaa agttcgacag 2580

cgtctccgac ctgatgcagc tctcggaggg cgaagaatct cgtgctttca gcttcgatgt 2640

aggagggcgt ggatatgtcc tgcgggtaaa tagctgcgcc gatggtttct acaaagatcg 2700

ttatgtttat cggcactttg catcggccgc gctcccgatt ccggaagtgc ttgacattgg 2760

ggagttcagc gagagcctga cctattgcat ctcccgccgt gcacagggtg tcacgttgca 2820

agacctgcct gaaaccgaac tgcccgctgt tctccagccg gtcgcggagg ccatggatgc 2880

gatcgctgcg gccgatctta gccagacgag cgggttcggc ccattcggac cgcaaggaat 2940

cggtcaatac actacatggc gtgatttcat atgcgcgatt gctgatcccc atgtgtatca 3000

ctggcaaact gtgatggacg acaccgtcag tgcgtccgtc gcgcaggctc tcgatgagct 3060

gatgctttgg gccgaggact gccccgaagt ccggcacctc gtgcatgcgg atttcggctc 3120

caacaatgtc ctgacggaca atggccgcat aacagcggtc attgactgga gcgaggcgat 3180

gttcggggat tcccaatacg aggtcgccaa catcctcttc tggaggccgt ggttggcttg 3240

tatggagcag cagacgcgct acttcgagcg gaggcatccg gagcttgcag gatcgccgcg 3300

cctccgggcg tatatgctcc gcattggtct tgaccaactc tatcagagct tggttgacgg 3360

caatttcgat gatgcagctt gggcgcaggg tcgatgcgac gcaatcgtcc gatccggagc 3420

cgggactgtc gggcgtacac aaatcgcccg cagaagcgcg gccgtctgga ccgatggctg 3480

tgtagaagta ctcgccgata gtggaaaccg acgccccagc actcgtccga gggcaaagga 3540

atagctcgag tttctccata ataatgtgtg agtagttccc agataaggga attagggttc 3600

ctatagggtt tcgctcatgt gttgagcata taagaaaccc ttagtatgta tttgtatttg 3660

taaaatactt ctatcaataa aatttctaat tcctaaaacc aaaatccagt actaaaatcc 3720

agatcccccg aattaattcg gcgttaattc agtacattaa aaacgtccgc aatgtgttat 3780

taagttgtct aagcgtcaat ttgtttccgc ggcgcaggaa gctgggttcc tagcgaatat 3840

agtggctgtc ttgatcgcga aagatatcct atccaagact gaacccgact cttcaatatt 3900

gcttttagaa cctgatgtga ccatcctgaa gatcctcgat tcactcgcgc ctttgcacaa 3960

gacaaagatt atatcggtca cacacaaggc aactgccaaa gccaacagaa agagtctgat 4020

ttatatcccc gagcgtacgc cctctcatcg catacggcaa atgattccac acaaaaaagt 4080

tgtcagagcc gttgtttttg attctaaccg cgtctgtaac ggacgaaatg atcgcatctg 4140

caacctcttt ccgaatgctc gacagcttga tatcgcgtcc ttctatcaaa ctgtgccgat 4200

gccaaactca ccagaacatg gttccatact gtgtattcct gcagcggttc agagtgtagc 4260

ggggtggctt caccccgaag attccacttt tgcagtaacc tcgatcacaa aacttatttc 4320

agaagaaatc gatctacgac caacctctgt gatcaaatgg tcatctgaga ctcagaaccc 4380

gatcaaagcg cagatacgtt cagcgacaga tgcggtcaat ttgtcgcaac aaggcgcata 4440

tgttttgtgg gagctgccca aggccttgag aaggaccgtt gccgattggc ttgtctccca 4500

tggagcgcag catcttgttt ttgttcagaa aattcccgat gatacccagt gggtgtccag 4560

cattacatgt ggtggtgcag aagttgttat tgtgcctcct caggaagatc tcgttcacac 4620

ggttcttgcg ctccgagacc actcgtctgt gccgcttgtt cggggtattg tatttactgg 4680

ggcactcgat aatgctgtgg ctgctgagac gatccaacgg gctaaatgct tgtcccaaca 4740

ttacgactct cccaatctag agatgttctt gagcattgac tgctgcccag cgataccgaa 4800

tccgcagcag tgcgctgtga ccgaatttct cgcagcacta gcacatcaac gagcaatgat 4860

caatcttgcg gcaagtgtcc tctgtcttgg acccgggttt gatctcgaca atccacacgg 4920

agatgatatt gcggagatac ttgcagaggc tgccttagcc ggccatccct ttgccggtgg 4980

cgatcgcgtg gttacagctg gcctctgtcc cggtactggc agtccagagt acaaggcgtg 5040

ggacactatc cactcgcgga acccagcaat gtcgaacatc cttgctttgt caaggaaagg 5100

tgggcaagaa gagactgctg gcgttgaggc agccacggag catatccctt tgaaagtcca 5160

actcgagcgt gctaaagaaa ccacatcggc agccttggct gtgcgggcta ttttgaatca 5220

gtactttacc agatacctcc ggatgcggct ccagtccacg gccgagatca atgagaatac 5280

cttattcaac gaacttggtg tggactcgat ggtcgcggca cagttggttg ggtggtttat 5340

gaaagaagtt ggcgtggagg tttcggttgt tttcattctc gctggcgcat ctgttggcga 5400

ggtcctccag gatgtcacgg agaagcttat cccttgaggt cgagattttt ctgtgtgaat 5460

aaatatagct ctcctgacgc gaccttagaa aaccacatgc gtaccagatg caaattttta 5520

ggtcattcaa tattaacatc tacatgcaga agcaattact tccttcatta tcagtctcat 5580

ttataatctg tgcactagac tgtaatagag gctgtgcagc atgactcaaa aactaggaaa 5640

aggtcacttc aacaggctag gtacgtttat caccaacaaa agatggaatc tgatccactc 5700

agctcatttg atgtagacat ggataaatat tggcaccgaa ggcatattta cactactgcc 5760

ggcgagattg agccaaacat aacaagctgc ccgaggtgcg gatttgcaat tgatccgtga 5820

catttccttg aaggacccaa ccgcctccca tcacaacgcc ccagctgagg caaaacggcg 5880

ctcggagaag acttgaacgt aaattgaacg agagttccta aggaat 5926

<210> 5

<211> 5716

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atcatccgcc aaaaactaac acatcatttg gtcgatctca tcagaccgct gtctgaggag 60

gccgatgatt gtttacaccg gagttggaca gataattcag gtactccaaa tctccatgtc 120

gtagctcgtc catgaggatc cattcactta ttaatcctta gattggcacg aaatttctct 180

caaatccacc ctcctcgaca tgatatccca gcaatcggcc cacgtcttcc tcggccgcag 240

cttttcccat aacgtgagtt ggctagcgct gtcgcgcagc ataaccttgc aggccttcgg 300

cgccgtccgc gagcttcgcg tatacccatc cttcatacgc ccgcttgttg gctggtttct 360

ccccgcatgt aaatcacttc gcggagagat tgccaaagcc cggaagcttg ttgagcccct 420

tatactagct cgaagactcg aaagagagcg atgcatcgcc agtggccggg aaccacccgt 480

ctatcatgac actattgcat gggcagagga atgtgcacgt ggacgaaaat acgatccagc 540

tcttattcag ctcacgctcg cgctttcggc tatgcacaac acctctgact ttctcacgca 600

agtaatatat gacatagcgg cgaggccgaa actcgtggag gagttgagga aagagatcat 660

cgatgttcgg acgtgtggag atgcaacaga gtcatggaat aagggggcgg ttcacaagtt 720

gaagttgatg gatagtgtca tgaaagaaag tcagcgattg aagcctacgg gattgggtaa 780

gttttgctgg gatcaacgct tattctctac aaggctaata tgctaatcat atagtaaaca 840

tgcggcgcta tgcaactgag gacatccagc tctcttccgt cattcccgag cacaaggaag 900

gcagcatcac aatccgaaag ggggatctgg tcatgatatc gcaacacagc cactgggacg 960

aggatattta ccaagacgcg gcgtctttca acccataccg attctgcagg atgcgcgaac 1020

aacccacgca ggagcacaca gcacactttg tcgccacaag tgtcaaccat atcggcttcg 1080

ggcatggggt gcatggctgt cctggtcgat tctttgccgc cgctgagacg aagcttgcaa 1140

tgtgtcacat tttgatgaaa tacgacatta agcttatcga tcagcctaag gtcctcaatg 1200

taggttcgct tatggttgca aatcccgttg cgaaggttgc agtgagaagg aggaaggagg 1260

aggtttcatt gtgattgtga acagtgagct cgcccacatc tcactcagcc caaggagtac 1320

caaaggtagg tggagatgga ccgtaaccac attactgctt tcggacaaac tcaatttact 1380

acatacctcg tggaatactc accttcgcgt aaatgaaagt ctcccaacct ttgtaatcac 1440

agtatatatt gggcttccaa gcttccgtct atgtctgtga attctaaagc gttactatcg 1500

tcccttgaac ctctgtccca aacttgaatg atatcctttc tcgtccatca tgttgtcaat 1560

gatcgtaagg ggaagaatga taaaataaat tgaagtatgg ttattcagtt gaatctctgg 1620

cagactcaaa ttcacctatt caatctgaat tctaacttgt ccaggttcca tgtccgggtg 1680

gtttgtgacc gttgatatac ctatcgagca tacgtaatct tccaaagttt aaggttgcga 1740

cccaccaata cctgaaccag ggcgtagatc acacctagat acgtgtacaa cggctcatat 1800

tcgatcggtg tatcatatat gcctaggata atggctaaat gcagcctgcc taagaagcgg 1860

tcgggagacg gtgctccacc tacctagtag tagtagtagg actaggtact ccctatgcta 1920

cgtgtgtaat gactcaacac tttctcttgg ctatgaccgc ctctctggat gcaggtgaat 1980

tcacaattac taagtaaggt caagaaagcg gacataatgc aagagtggac attatgctct 2040

tcttcgcact ctcactacca catccggagg cacagcatgc tctcccatga ggaggtcaac 2100

acatcaatgc ctattttggt ttagtcgtcc aggcggtgag cacaaaattt gtgtcgtttg 2160

acaagatggt tcatttaggc aactggtcag atcagcccca cttgtagcag tagcggcggc 2220

gctcgaagtg tgactcttat tagcagacag gaacgaggac attattatca tctgctgctt 2280

ggtgcacgat aacttggtgc gtttgtcaag caaggtaagt ggacgacccg gtcatacctt 2340

cttaagttcg cccttcctcc ctttatttca gattcaatct gacttaccta ttctacccaa 2400

gcatccaaat gaaaaagcct gaactcaccg cgacgtctgt cgagaagttt ctgatcgaaa 2460

agttcgacag cgtctccgac ctgatgcagc tctcggaggg cgaagaatct cgtgctttca 2520

gcttcgatgt aggagggcgt ggatatgtcc tgcgggtaaa tagctgcgcc gatggtttct 2580

acaaagatcg ttatgtttat cggcactttg catcggccgc gctcccgatt ccggaagtgc 2640

ttgacattgg ggagttcagc gagagcctga cctattgcat ctcccgccgt gcacagggtg 2700

tcacgttgca agacctgcct gaaaccgaac tgcccgctgt tctccagccg gtcgcggagg 2760

ccatggatgc gatcgctgcg gccgatctta gccagacgag cgggttcggc ccattcggac 2820

cgcaaggaat cggtcaatac actacatggc gtgatttcat atgcgcgatt gctgatcccc 2880

atgtgtatca ctggcaaact gtgatggacg acaccgtcag tgcgtccgtc gcgcaggctc 2940

tcgatgagct gatgctttgg gccgaggact gccccgaagt ccggcacctc gtgcatgcgg 3000

atttcggctc caacaatgtc ctgacggaca atggccgcat aacagcggtc attgactgga 3060

gcgaggcgat gttcggggat tcccaatacg aggtcgccaa catcctcttc tggaggccgt 3120

ggttggcttg tatggagcag cagacgcgct acttcgagcg gaggcatccg gagcttgcag 3180

gatcgccgcg cctccgggcg tatatgctcc gcattggtct tgaccaactc tatcagagct 3240

tggttgacgg caatttcgat gatgcagctt gggcgcaggg tcgatgcgac gcaatcgtcc 3300

gatccggagc cgggactgtc gggcgtacac aaatcgcccg cagaagcgcg gccgtctgga 3360

ccgatggctg tgtagaagta ctcgccgata gtggaaaccg acgccccagc actcgtccga 3420

gggcaaagga atagctcgag tttctccata ataatgtgtg agtagttccc agataaggga 3480

attagggttc ctatagggtt tcgctcatgt gttgagcata taagaaaccc ttagtatgta 3540

tttgtatttg taaaatactt ctatcaataa aatttctaat tcctaaaacc aaaatccagt 3600

actaaaatcc agatcccccg aattaattcg gcgttaattc agtacattaa aaacgtccgc 3660

aatgtgttat taagttgtct aagcgtcaat tttgagaatg gttggggctg aaagttggta 3720

ctgcatcttg gtcacggcgg tcatgggcac gccacggagc aaggaattac cactgtttag 3780

tatgagagac tgaaaatata gatggtcgat cccgattgcc ctgattaaag agcggtatgg 3840

atggtgtgac gtccttgcat caagttttct tcgactttgc atgtaagggg tccctagcca 3900

cggactcgcc tgttctgaga atgctgatat aagaggcaca gctctctatc atggaattat 3960

ttacaggcca cagttctatc ccttcgtcac aatgatccgc agtcccactg ccccaagcag 4020

gcccctaggc cagatctcgt gggacctgat ccgcatctcg cgatttgaca agtacaactc 4080

atttctagcc ctctttgccg gaggttagtc cacccatccc aaattcatac actctaggca 4140

gtgggtgcta acaacacaca gtatggtcaa cccttcttgc ggggagcgca cgacttcgcg 4200

aagaccctga gcacgtctcc gttcaatata tccttagtcg tgcttttctg tgctccatag 4260

ccgcatatat attctctggg gcaggcatgg tgtggaatga ctgggttgac cgggacatcg 4320

atgctcgcgt ggcacgcacc aaggatcgtc ctttagctgc aggcagactg agcacagaag 4380

aagcaatgct ttggatgctg cttcaagctg gtgtagcaac gacatttttg tattggatga 4440

tggacggaca acatgtgttc gtgagcccct ggaaaagtca tctctctctc tctgctgtac 4500

caaggtcgac taacgaagcg gggctaccta gcttgcattc catgattcct ccaacattag 4560

gaacattgat atatccatat tgcaagcgtc ctctcgctcg ccgacttggt atctaccctc 4620

aatatgttct cggtctgaca gcttcctgcc ctgtcctctt tggccgtgct tcgatatacc 4680

ctgatataga atccttctct cgactcgtat cgtctagcct cccgctttgc ctagtggtgt 4740

ttacatggac tctctatttc aataccgcat acagctacca ggacatcgtt gatgacaaga 4800

aattgggggt gaactcacta tacaaccttg cgggaaagca catacatggc gtgcttgtgg 4860

ccctcgtgac aatcatggtg agcgcactgt ggtgggcact gtaccccttg ggatcagctt 4920

ggttgtggat ctcttggatg ggagtctgga tcgtgggatg tgtggaccaa atgcgcagat 4980

ttgatgcgaa ggatccttca agtggacagt acgtcttccg tagcaatgtc cttatggggc 5040

tctggacgat gcttgcttgt cttttggagg ttttttctac agggaagaga gtggctttgt 5100

gaacgaaatg gggaagacat agcgacacaa ataaatatta gctgccagcc cagcaagcgc 5160

agagcaagat catgtgagac tggatgaagc acctgctaga aatatcatgg catttgatca 5220

ggttgaagtg agatcagtat cccagtagag tagcggggtg ttcttttcca aaggaatgtt 5280

ccaccctggc cgaacgttct tctcttcctt gcccgtgaat ctttaatgtt ctagcaacca 5340

cagacggaga aagactcagc tgagaccagc ggctatacag gaacaccagc tactatttac 5400

acgtgttatg ctagattgat ggatatttga gtcatttgtc tttgacatct gcgctcaaga 5460

cttgacgaag aaagggcaaa ttcaaaaacc cacagagacc gaacaacagg ctgaaagccc 5520

tgatgggagt tcataggttg gtaatgagca gtaaaactgg tactgggcag tcatatgcaa 5580

ttattcctgt aggagtaagg ggctcgccta gcccaattgc cttgcaagat aagctagtca 5640

ccaaataaat atagatcaat tcggttggtt tggactctca tctccatttc ttgtcttcat 5700

catcctgtag atatcg 5716

Claims

Use of an OxaL protein or an OxaL protein-related biomaterial as follows (a1) or (a 2):

(a1) use of an OxaL protein or an OxaL protein-related biomaterial as a hydroxylase;

(a2) use of OxaL protein or an OxaL protein-related biomaterial in the preparation of a hydroxylase;

the OxaL protein is a protein shown in a sequence 3 in a sequence table;

the OxaL protein-related biomaterial is a gene encoding the OxaL protein, an expression cassette expressing the OxaL protein, an expression vector expressing the OxaL protein or a recombinant microorganism expressing the OxaL protein.
The 15-deoxyoxalicine B biosynthetic gene cluster, which has 13 genes: an oxaM gene, an oxaE gene, an oxaD gene, an oxaC gene, an oxaF gene, an oxaG gene, an oxaL gene, an oxaH gene, an oxaA gene, an oxaI gene, an oxaJ gene, an oxaK gene, and an oxaB gene;

the oxaM gene is shown as 409-1287 th site in the sequence 1 of the sequence table; the oxaE gene has four exons, which sequentially correspond to the 1819-1889 th site, 1966-2227 th site, 2280-2650 th site and 2717-3392 th site of the sequence 1 of the sequence table; the oxaD gene has two exons and sequentially corresponds to the 3699-3900 th site and the 3965-4476 th site of the sequence 1 of the sequence table; the oxaC gene has four exons and sequentially corresponds to the 4847-4897 th site, 4956-5110 th site, 5165-5491 th site and 5551-6001 th site of the sequence 1 in the sequence table; the oxaF gene has four exons and sequentially corresponds to the 6024-6250 th site, the 6311-6397 th site, the 6453-6891 th site and the 6945-6971 th site of the sequence 1 in the sequence table; the oxaG gene has five exons and sequentially corresponds to the 7344-7568 site, the 7620-7736 site, the 7800-7971 site, the 8033-8647 site and the 8706-9145 site of the sequence 1 of the sequence table; the oxaL gene has three exons and sequentially corresponds to the 9903-th 10063 site, the 10112-th 10563 site and the 10625-th 11535 site of the sequence 1 in the sequence table; the oxaH gene has two exons and sequentially corresponds to the 11801-11912 site and the 11971-12911 site of the sequence 1 in the sequence table; the oxaA gene is shown as position 13529-20836 in a sequence 1 of a sequence table; the oxaI gene has two exons and sequentially corresponds to the 21517-21729 th site and the 21798-23435 th site of the sequence 1 of the sequence table; the oxaJ gene has two exons, which sequentially correspond to the 23483 th and 24757 th sites and 24824 th and 25174 th sites of the sequence 1 in the sequence table; the oxaK gene is shown as the 25296-26171 site of the sequence 1 in the sequence table; the oxaB gene has two exons, which correspond to the 26443-27567 th site and the 27628-27975 th site of the sequence 1 in the sequence table in sequence.
3. Use of the gene cluster according to claim 2 for the synthesis of the compound oxalicine B.
OxaL protein, shown as sequence 3 in the sequence table.
5. A gene encoding the OxaL protein according to claim 4.
6. A recombinant microorganism expressing the OxaL protein of claim 4.
7. Use of the OxaL protein according to claim 4 in the synthesis of the compound oxalicine B.
8. The use of the recombinant microorganism of claim 6, which is (b1) or (b2) or (b3) as follows:

(b1) use in converting compound 3 to compound 8;

(b2) use in converting compound 2 to compound 9;

(b3) application in converting compound 4 into compound oxalicine B;

the compound 3 is shown as a formula I; the compound 8 is shown as a formula II; the compound 2 is shown as a formula III; the compound 9 is shown as a formula IV; compound 4 is represented by formula V; the compound oxalicine B is shown as a formula VI;
9. the recombinant microorganism of claim 6, wherein said recombinant microorganism comprises total protein.
10. The use of total protein according to claim 9 as (b1) or (b2) or (b 3):

(b1) use in converting compound 3 to compound 8;

(b2) use in converting compound 2 to compound 9;

(b3) application in converting compound 4 into compound oxalicine B;

the compound 3 is shown as a formula I; the compound 8 is shown as a formula II; the compound 2 is shown as a formula III; the compound 9 is shown as a formula IV; compound 4 is represented by formula V; the compound oxalicine B is shown as a formula VI;