CN114316066A

CN114316066A - MNR2 protein purification method

Info

Publication number: CN114316066A
Application number: CN202111330351.5A
Authority: CN
Inventors: 刘毅; 蔡炯; 丁国中; 刘明霞; 肖凯; 宋旭; 付玉洁; 祁丽丽; 张晋; 肖阳
Original assignee: Yuanben Zhuhai Hengqin Biotechnology Co ltd
Current assignee: Yuanben Zhuhai Hengqin Biotechnology Co ltd
Priority date: 2021-11-11
Filing date: 2021-11-11
Publication date: 2022-04-12
Anticipated expiration: 2041-11-11
Also published as: CN114316066B

Abstract

The invention provides a high-efficiency MNR2 protein purification process, wherein the MNR2 protein has an MBP label, the purification process adopts two-step purification, the first step is MBP affinity purification, the second step is the purification of a capto Q ImpRes column and a capto adhere column in series, a strong anion column, namely the capto Q ImpRes column, is arranged above, a strong anion composite column, namely the capto adhere column, is arranged below, or the strong anion column, namely the capto Q ImpRes column, is arranged in front, the strong anion composite column, namely the capto adhere column, is arranged behind, and the middle is connected in series by using a column connector. The invention can greatly improve the working efficiency, changes two-step purification into one-step purification, saves the purification time of each step and the configuration time of various purification buffers, and saves related reagents. The operation is simple, and the related detection indexes are superior to other purification modes, so that the requirements of related indexes of the medicine are met; in addition, the loss is increased by adding one-step purification, the loss can be reduced by one-step purification, the product yield is obviously improved, and all detection indexes can meet the relevant requirements of Chinese pharmacopoeia; moreover, the purification and the amplification are very convenient.

Description

MNR2 protein purification method

Technical Field

The invention belongs to the technical field of protein purification, and particularly relates to a method for purifying MNR2 protein.

Background

The latest statistical data show that 1929 ten thousand new cancer cases and 996 ten thousand cancer death cases are found in the world in 2020; 457 ten thousand cases of new cancer and 300 ten thousand cases of cancer death in China in 2020. Worldwide, due to the increasing aging of the population, the burden of cancer is expected to increase by 50% in 2040 years compared with 2020, and the number of new cancer cases reaches nearly 3000 ten thousand at that time. This is most significant in countries experiencing social and economic transformation.

The research of cancer treatment drugs is a hot spot in international research today. The traditional means of cancer treatment is surgery, chemotherapy and radiotherapy, and biological immunotherapy develops rapidly in recent years, and particularly, the vaccine for treating cancer is convenient to apply, has obvious effect and is well received by patients. The principle of the tumor vaccine inoculation is that tumor cells or tumor antigen substances are utilized to induce an organism to generate specific cellular immunity and humoral immunity reaction, namely, the immune system of a patient is activated to enhance the anti-cancer capability of the organism, so that the growth, the diffusion and the relapse of tumors are prevented, and the purpose of controlling and even eliminating the tumors is finally achieved. The inoculation of the tumor vaccine can effectively and specifically remove the tumor in the early stage of tumorigenesis, and has small adverse reaction. In addition, the tumor vaccine treatment can also be combined with operation treatment, radiotherapy and furuncle treatment, and plays an important role in the comprehensive treatment of tumors.

Research and development of MNR2 cancer vaccine brings good news to cancer patients, families and countries. The MNR2 protein gene integrates MBP label protein gene, and is expressed by gene recombination escherichia coli, and protein stock solution which meets various indexes of medicine production is obtained through the procedures of thallus centrifugation, crushing, filtration and the like and the subsequent steps of protein purification and the like. The yield, purity, final quality level of the finished medicine and the like of the product are mainly determined by the purification steps.

For MNR2 proteins, the current general purification scheme requires at least three purification steps: first step, MBP affinity chromatography purification is carried out to remove most of mixed protein; the second purification step is generally carried out by anion or cation chromatography, such as capto adhere and capto Q ImpRes or capto SP ImpRes, to remove residual contaminating proteins, as well as host proteins and host DNA; the third step generally selects Sepharose Q Fast Flow filler chromatography to remove endotoxin; thus, according to the general purification protocols of the prior art, at least three purification steps are required to obtain MNR2 protein that is relatively compliant with the relevant standards.

The prior general purification scheme has the following technical problems: after the first-step MBP affinity chromatography purification, a plurality of buffers for at least two subsequent purification steps need to be configured, so that time and related purification reagents are consumed; at the same time, at least two purification steps are needed, namely repeated multi-step purification operation procedures such as balancing, sample loading, impurity washing, elution, column washing and the like are carried out, and the column washing procedure generally comprises the steps of washing 3-5 column volumes by 2M sodium chloride, washing 3-5 column volumes by purified water and washing 3-5 column volumes by 20% ethanol, and then carrying out liquid seal; cause repeated operation, resulting in low purification operation efficiency; meanwhile, the yield is reduced because of the loss caused by two-step purification.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a high-efficiency method for purifying MNR2 protein.

Through a large amount of experimental researches, the inventor unexpectedly discovers that 2 chromatographic columns are used in series, a strong anion column, namely a capto Q Impres column, is arranged above the chromatographic column, a strong anion composite column, namely a capto adhere column, is arranged below the chromatographic column, or the strong anion column, namely the capto Q Impres column, is arranged in front of the chromatographic column, and the strong anion composite column, namely the capto adhere column, is arranged behind the chromatographic column, and is directly inserted and connected in the middle according to different specifications of the chromatographic columns, or connected by 1/16 through two-way connecting pieces with external threads at two ends, or connected in series by 1/16 through two-way connecting pieces with internal threads at two ends; only one-step purification is carried out, at least two-step purification process is carried out after the original affinity chromatography is replaced, namely only one-step column washing, balancing, sample loading, impurity washing, eluting, column regeneration, cleaning, 20% ethanol liquid sealing and other processes are needed, repeated purification operation steps are avoided, the detection result of the purified sample reaches or even exceeds the two-step purification effect, and the detection result accords with the related indexes of the medicine.

The technical scheme of the invention is as follows:

a process for purifying MNR2 protein, wherein the MNR2 protein is MNR2 protein with MBP label, the gene nucleotide sequence of the MNR2 protein with MBP label is shown in SEQ ID NO. 37;

the MNR2 protein is expressed by genetic engineering bacteria, and the genetic engineering bacteria are transformed into a recombinant plasmid expression vector containing a gene for coding an MBP label and a gene for coding MNR2 protein;

in the invention, the plasmid expression vector is pET26b (+) escherichia coli expression vector, and the host bacterium is E.coli BL21(DE)3 host bacterium.

The purification process adopts two-step purification, wherein the first step is MBP affinity purification, and the second step is the purification by connecting a capto Q ImpRes column and a capto adhere column in series, a strong anion column, namely the capto Q ImpRes column, is arranged above, a strong anion composite column, namely the capto adhere column, is arranged below, or the strong anion column, namely the capto Q ImpRes column, is arranged in front, and the strong anion composite column, namely the capto adhere column, is arranged behind.

Preferably, the first and second electrodes are formed of a metal,

the MNR2 protein purification process specifically comprises the following steps:

1) carrying out fermentation and induction expression on escherichia coli genetic engineering bacteria for expressing the target protein MNR2, and centrifuging fermented escherichia coli liquid to obtain bacterial sludge;

2) dissolving the bacterial sludge obtained in the step 1) in a buffer solution, crushing to obtain a crushed feed liquid, centrifuging to collect a supernatant, and filtering the supernatant to obtain a filtrate containing the target protein MNR 2;

3) obtaining a sample after one-step purification after MBP affinity chromatography;

4) sample dilution: diluting the sample eluted by the MBP affinity chromatography in the step 3) by 2.5 times by using a low-salt buffer, namely, the volume ratio of the sample to the low-salt buffer is 1: 1.5; and simultaneously preparing 5% high-low salt buffer, namely mixing the high-salt buffer and the low-salt buffer according to a volume ratio of 5: 95 mixing for later use;

5) the chromatographic columns are connected in series: connecting a capto Q Impres chromatographic column and a capto adhere chromatographic column in series, wherein a strong anion column, namely the capto Q Impres column, is arranged above the capto Q Impres column, a strong anion composite column, namely the capto adhere column, is arranged below the capto Q Impres column, or the strong anion column, namely the capto Q Impres column, is arranged in front of the capto Q Impres column, and the strong anion composite column, namely the capto adhere column, is arranged behind the capto adhere column and is connected to a column position valve of a purifier;

6) column washing and balancing: regulating the flow rate to 2.0-10mL/min according to chromatographic columns with different specifications; washing the column with 5-10 times of ultrapure water, washing the column with 3-5 times of 0.5M sodium hydroxide or 2M sodium chloride, washing the column with 5-10 times of ultrapure water, balancing the column with 3-5 times of 5% high-low salt buffer, measuring the conductivity value by a purifier to be about 6-8ms/cm, wherein the UV value and the conductivity value have no fluctuation basically, and the UV value is calibrated to be 0;

7) sampling and removing impurities: loading the diluted sample obtained in the step 4), and adjusting the flow rate to 2.0-10mL/min according to chromatographic columns with different specifications; the conductivity value measured by a purifier is about 6-8ms/cm, and after the sample loading is finished, impurities are washed by using a 5% concentration high-low salt buffer with 3-5 times of column volume, wherein the 5% concentration high-low salt buffer is the prepared high-low salt buffer in the step 4);

8) protein elution and collection: firstly dismantling a capto Q impromes column, then carrying out protein elution on the capto adhere column, setting the elution gradient to be 20-25% high-low salt gradient elution, measuring the elution conductivity value range by a purifier to be 15-25ms/cm, and collecting the eluate as UV₂₈₀The UV absorbance rose to 100. + -. 50mAU and collection commenced, followed by UV₂₈₀The value reached the highest and then dropped to 100. + -. 50mAU to stop collection, which is the purified final feed.

In the step, the collecting tube is put in a collector in advance, and the purifier is set to elute the target protein in a gradient of 20-25 percent when the protein is UV₂₈₀The absorption value rises to 100 +/-50 mAU, clicking and collecting, and the collector starts to collect the target protein, UV₂₈₀Reaches a maximum value followed by UV₂₈₀The value is reduced to 100 +/-50 mAu, the collection is stopped when the click is carried out, and a certain deviation exists in the actual process, so that the final feed liquid is purified.

Further, in step 2) of the present invention, the specific steps are as follows: re-suspending the bacterial sludge with lysine buffer of 5-10 times volume, crushing for 2-3 times with homogenizer of 700-800bar, centrifuging the crushed liquid at 25000rpm for 30 min, removing crushed bacterial dregs, collecting supernatant, and sterilizing with 0.22um or 0.45um filter membrane.

Further, in step 2) of the present invention, the lysine buffer composition is as follows: 20mM Tris-HCl, 0.2M NaCl, 1mM EDTA, buffer pH 7.40. + -. 0.05/25 ℃.

Lysis buffer is used for dissolving target protein released after the cells are homogenized and broken, and the target protein is stable and not inactivated.

Furthermore, the ratio of the bacterial sludge in the step 2) to the bacterial sludge in the step 3) to the amount of the filler is important, 5mL of filler is used for every 5g of bacterial sludge, and excessive bacterial sludge can overload the column, so that the protein liquid is wasted.

Further, in step 3) of the present invention, the specific steps of MBP affinity chromatography are as follows: washing the column with ultrapure water in 3-5 times of column volume, balancing wash buffer in 3-5 times of column volume, and performing UV₂₈₀After calibrating to 0, loading the filtrate obtained in the step 2) on an MBP affinity chromatography column, and removing impurities by washing with wash buffer with the volume 3-5 times of the column volume after the loading is finishedHybrid proteins that bind poorly to MBP mediators; then the MNR2 of the target protein is eluted by using an Elute buffer, and the elution conductivity value measured by a purifier is about 16.2mS/cm, and UV₂₈₀The collection range was 100. + -.50 mAu-maximum-100. + -.50 mAu.

In the step, the MBP affinity chromatography is selected because the strain is designed to have an MBP label during construction, the target protein can be combined with an MBP column medium, but the hybrid protein is not combined with the MBP filler basically, most of the hybrid protein can be removed through a hybrid washing process, the target protein combined with the MBP column filler is eluted and collected through a buffer solution added with 10mM maltose, and the target protein is effectively distinguished from other hybrid proteins.

The sample purified by MBP affinity chromatography in one step contains a certain amount of hybrid protein, the purity is about 80-90%, and the purity is insufficient and other indexes do not meet the related requirements of medicines.

Further, in step 3), the wash buffer and the lysine buffer have the same components, and the components are as follows: 20mM Tris-HCl, 0.2M NaCl, 1mM EDTA, buffer pH 7.40. + -. 0.05/25 ℃; the Elute buffer composition is as follows: 20mM Tris-HCl, 0.2M NaCl, 1mM EDTA, 10mM maltose, buffer pH 7.40. + -. 0.05/25 ℃.

The Wash buffer is the washing buffer, has the same composition as the lysis buffer, and is used for removing various residual miscellaneous proteins which are not combined with the MBP filler, thereby playing the role of removing impurities.

The Elute buffer is the target protein elution buffer, and 10-20mM maltose is added on the basis of the impurity washing buffer to Elute the target protein combined with MBP chromatography, so as to collect the target protein (containing a small amount of impurity).

In the buffer buffers of the MBP affinity chromatography and the tandem chromatography, EDTA with the concentration of 0.1-1mM is used, and the EDTA is a metal chelating agent and can be combined with metal ions to prevent target protein from being degraded by contained metalloprotease and effectively protect the target protein.

Further, in the step 4) of the present invention, the low-salt buffer comprises 20-40mM Tris-HCl or phosphate, 1-2mM EDTA, pH 6.50-8.50/25 ℃; the high-salt buffer comprises 20-40mM Tris-HCl or phosphate, 1-2mM EDTA, 1M NaCl and has a pH of 6.50-8.50/25 ℃. More preferably, the composition of the low salt buffer is 20mM Tris-HCl, 1mM EDTA, pH7.0/25 ℃; high salt buffer, 20mM Tris-HCl, 1mM EDTA, 1M NaCl, pH7.0/25 ℃.

The low-salt buffer and the high-salt buffer are both used as ion exchange chromatography purification buffer, wherein Tris-HCl or phosphate is used for stabilizing system pH, EDTA is used for preventing target protein degradation, and sodium chloride is used for eluting the target protein and maintaining the salt ion concentration of the target protein.

Further, in step 5) of the present invention, since the isoelectric pH of the target protein is about 5.8, capto Q Impres and capto adhere chromatography using ion exchange chromatography require ion exchange buffer pH at 6.5-9.0/25 ℃, preferably pH 6.8-8.0. At too low a pH, the MNR2 protein binds less or not to the column; the pH value is too high, and the storage stability of the purified protein is reduced; the pH of the buffer for the step 2 purification is preferably 7.0/25 ℃.

According to the principle of ion exchange chromatography, the isoelectric point of the target protein is pH5.8, an anion column capto Q ImpRes or an anion composite column capto adhere is adopted, the pH of a corresponding purification buffer solution is more than 6.8, and the target protein is easily combined with an ion exchange chromatography filler to realize the purposes of separation and purification. By comparing the purification effect, the binding rate of the target protein and the anion composite column capto adhere is high, and the elution effect is good. And experiments prove that the Sepharose Q Fast Flow anion column or capto Q Impres anion column is basically not combined with MNR-MBP target protein at the pH of 7.0-7.5, and the capto adhere anion composite column has the functions of anion exchange, hydrogen bond, hydrophobicity and the like, is well combined with the target protein and can play a role in removing foreign protein, endotoxin, host DNA, host protein and the like, so the capto adhere anion composite column is selected.

In addition, purification experiments also prove that the Sepharose Q Fast Flow anion column or capto Q ImpRes anion column can strengthen the effect of removing foreign proteins, endotoxin, host DNA and host proteins, and has better endotoxin removing effect; particularly, the capto Q ImpRes anion column is used for combining the hybrid protein in the MNR2 project to remove the hybrid protein, so that the purification effect is strengthened, and the capto Q ImpRes anion column is selected on the basis of the capto adhere column.

Purifying by using a capto Q Impres anion column and a capto adhere column in series, wherein the capto Q Impres is in front of the capto adhere column and behind the capto adhere column, or the capto Q Impres is above the capto adhere column and below the capto adhere column, because the capto Q Impres is not combined with the target protein but can bind most of hetero-proteins, endotoxin, host DNA and the like, MNR2 protein and a very small amount of hetero-proteins flow into the capto adhere column, and MNR2 protein can be combined with the capto adhere column; before MNR2 target protein is eluted, a capto Q ImpRes column is firstly disassembled, namely most of foreign protein, endotoxin, host DNA and the like in feed liquid are removed; the system is provided with 20-25% concentration high and low salt elution, the target protein in capto adhere is eluted and purified, the elution gradient is low, the residual foreign protein, endotoxin, host DNA and host protein are still hung on the column, and finally, the purification and the separation are realized.

Furthermore, a capto adhere anion chromatography composite column is used, a capto adhere medium (ligand n-benzyl-n-methyl-thiolamine) is a multi-binding strong anion exchange medium, and has multiple complex action modes such as anion exchange, hydrogen bond and hydrophobicity, and experiments prove that the binding effect of the capto adhere medium and MNR2-MBP target protein is far better than that of a chromatography medium with a single action mode such as common anion exchange or hydrophobicity, and the capto adhere medium has the functions of removing foreign proteins, certain endotoxin, host DNA and host protein, so that the purification effect can be further improved.

Further, in step 5) of the present invention, the series connection may be a direct plug connection, or a male adaptor connection at both ends of AKTA 1/16, or a female adaptor connection at both ends of AKTA 1/16, depending on the specification of the chromatography column.

Further, in step 6) of the present invention, the column is washed with 5 to 10 times the column volume of ultrapure water for the first time for the purpose of removing ethanol from the column, and the column is generally sealed with 20% ethanol and washed with 5 to 10 times the column volume of ultrapure water for the purpose of removing ethanol from the column. The column is washed with 3 to 5 column volumes of 0.5M sodium hydroxide or 2M sodium chloride in order to remove foreign proteins, endotoxins, etc. that may remain in the column. The second time, the column is washed with 5 to 10 column volumes of ultrapure water for the purpose of removing sodium hydroxide or sodium chloride from the column. The 5% concentration high-low salt buffer with 3-5 times of column volume is adopted, the aim is to balance the column, the 5% concentration high-low salt buffer and the sample feed liquid have basically the same components and similar conductivity values, and the condition fluctuation is avoided. The 5% high and low salt buffer prepared in step 4) can be used.

Further, in step 6), step 7) and step 8) of the present invention, 4.7mL of the column and 5mL of the column may be connected in series, or 20mL of the column and 25mL of the column may be connected in series, and the column washing flow rates are 2.0mL/min and 10mL/min, respectively.

Further, the low-salt buffer and the high-salt buffer in step 6), step 7) and step 8) of the present invention are the same as those in step 4). The method comprises the following specific steps:

the low-salt buffer comprises 20-40mM Tris-HCl or phosphate, 1-2mM EDTA, and has pH of 6.50-8.50/25 deg.C; the high-salt buffer comprises 20-40mM Tris-HCl or phosphate, 1-2mM EDTA, 1M NaCl and has a pH of 6.50-8.50/25 ℃.

More preferably, a low salt buffer, with a composition of 20mM Tris-HCl, 1mM EDTA, pH7.0, temperature 25 ℃; high salt buffer, 20mM Tris-HCl, 1mM EDTA, 1M NaCl, pH7.0/25 ℃.

Further, the step 7) of the present invention is not intended to collect the target protein, but is intended to wash out impurities, remove a part of the impurity proteins, endotoxins, host proteins, and the like.

Further, in the step 8), before the MNR2 target protein is eluted, the capto Q ImpRes column is firstly disassembled, namely, most of foreign proteins, endotoxin, host DNA and the like in the feed liquid are removed; the system is provided with 20-25% concentration high and low salt buffer to elute the target protein combined in the capto adhere, the elution gradient is low, the residual foreign protein in the capto adhere of the chromatographic column, endotoxin, host DNA and host protein are still hung on the column, and finally, the purification and separation are realized.

In the step 8), after impurity washing is finished, timely detaching the capto Q ImpRes column, and then eluting, otherwise, the impurity protein and endotoxin adsorbed and combined in the capto Q ImpRes column, even part of HCD and HCP can enter the capto adhere column, so that the final detection items of endotoxin, HCD and the like are unqualified.

After the feed liquid enters the capto Q improes column, most of foreign proteins, endotoxin, host DNA, host proteins and the like in the feed liquid can be combined with the filler, and the target protein flows into the capto adhere column at the lower end to be combined with the capto adhere. The capto Q imprmes column was removed to allow efficient separation of MNR2 target protein from the above impurities.

After the capto Q Impres column is removed, gradient elution is set in the range of 20% -25% in the purification system, the purification instrument can enable the high-low salt buffer with the concentration of 20% -25% to enter the chromatographic column (20% means that the high-salt buffer and the low-salt buffer are set by the purification system according to the volume ratio of 20: 80 and 25% means that the high-salt buffer and the low-salt buffer are set by the purification system according to the volume ratio of 25: 75), and the target protein is eluted. Putting the collecting tube in a collector in advance, and performing protein UV₂₈₀The absorption value rises to 100 +/-50 mAU, clicking and collecting, and the collector starts to collect the target protein, UV₂₈₀The concentration starts to decrease after reaching the maximum value, and the collection is stopped by clicking after the concentration is reduced to 100 +/-50 mAU, which is the final purified feed liquid.

Further, in the step 8) of the invention, when the target protein MNR2 of the capto adhere chromatographic column is eluted, the elution is carried out with the high-low salt gradient of 20-25%. When the gradient is lower than 20%, the elution strength of the target protein is not enough, and the yield is reduced; too high an elution gradient may cause elution of foreign proteins, endotoxins, etc., which may result in purification failure.

Further, the step 8) further comprises a step 9) of column cleaning and storage: after the elution is finished, the capto Q Impres column and the capto adhere column are connected in series again, the column is washed by 2M sodium chloride with the column volume of 3-5 times, then the column is washed by ultrapure water with the column volume of 3-5 times until the conductivity value is almost 0, and then the column is washed by 20% ethanol with the column volume of 3-5 times; the two chromatographic columns are disassembled and respectively and properly stored. Wherein, the column is firstly washed by 3-5 times of 2M high-concentration sodium chloride solution in column volume in order to wash out the residual foreign proteins and other substances in the column; then washing the column with ultrapure water of 3-5 times of column volume until the conductivity value is almost 0, and finally sealing the chromatographic column with 20% ethanol of 3-5 times of column volume for storing the chromatographic column, which is not easy to be infected with bacteria, so as to avoid affecting the next use.

Further, the protein electrophoresis and index detection method of the purified final feed liquid obtained in the step 8) is as follows: respectively preparing samples of the sample retention samples such as the sample loading solution, the impurity washing solution, the eluent and the like, dispensing, performing SDS-page electrophoresis, and inspecting the purification effects such as protein purity and the like; and detecting the protein content of the purified sample by adopting a bradford method in China pharmacopoeia 2020 edition; the detection of endotoxin content, the detection of host protein residue, the detection of host DNA residue and antibiotic residue are carried out by the relevant detection methods in the 2020 edition of Chinese pharmacopoeia.

The method can greatly improve the working efficiency, changes two-step purification into one-step purification, saves the purification time of each step and the configuration time of various purification buffers, and saves related reagents. The operation is simple, and the related detection indexes are superior to other purification modes, so that the requirements of related indexes of the medicine are met; in addition, the loss is increased by adding one-step purification, the loss can be reduced by one-step purification, the product yield is obviously improved, and all detection indexes can meet the relevant requirements of Chinese pharmacopoeia; moreover, the purification and the amplification are very convenient.

Compared with the general purification method, the method has the following technical effects:

firstly, capto Q imprmes and capto adhere are used in series, only low-salt buffer and high-salt buffer are required to be prepared and purified by ion exchange, and endotoxin-removing buffer is not required to be prepared; saving the time for configuring the buffer and saving the related reagents.

Capto Q imprves and capto adhere are used in series, the capto Q imprves are used for removing endotoxin in a combined manner and removing most of impure proteins and the like through combination, the capto adhere is combined and removes the residual impure leukorrhea, endotoxin and the like, the protein purification effect is easily achieved, and the purity is over 95 percent.

③ as above, after affinity of MBP, only 1 sample loading or 1 step purification is needed, and repeated operation of 2 sample loading or 2 step purification is not needed, the effects of removing impurity band and endotoxin can be easily realized, and HCP, HCD and the like can reach the standard.

Both columns can be cleaned, regenerated and equilibrated in the same way before loading, without having to repeat for 2 times: 3-5 times of column volume is washed by ultrapure water, 3-5 times of column volume is washed by 0.5M sodium hydroxide, 3-5 times of column volume is washed by ultrapure water, 3-5 times of column volume is balanced by balance liquid, sample loading of feed liquid, and 3-5 times of column volume is washed (then a cat Q ImRes column is dismantled), so that the experimental time is greatly saved, and the working efficiency is improved.

After finishing capto adhere purification and elution, connecting the capto adhere purification and elution in series again, and cleaning two columns by the same cleaning means to avoid 2 times of repeated operation, namely 2 times of working time is spent, namely 3 to 5 times of column volume is cleaned by 2M sodium chloride, 3 to 5 times of column volume is cleaned by ultrapure water, and 3 to 5 times of column volume is cleaned by 20 percent ethanol.

Sixthly, the operation is simple and convenient, the amplification is easy, and the laboratory and pilot scale amplification can be realized only by connecting 1/8 two internal thread connecting pieces; during production amplification, only a 3-way valve is added in front of the capto Q ImpRes column for switching, namely after washing impurities, the feed liquid does not enter the capto Q ImpRes column and is switched to enter the capto adhere column; when the target protein is eluted, the column is cleaned, and then the column is switched into a capto Q ImpRes column and a capto adhere column, two chromatographic columns are cleaned at one time, and the two chromatographic columns do not need to be cleaned in 2 times of time, so that a large amount of time is saved.

Drawings

FIG. 1-1 is a 1 st sample purification scheme of affinity chromatography for example 1 purification lot YB01-C202109014A MBP

FIG. 1-2 is a2 nd sample purification scheme of affinity chromatography for example 1, purification lot YB01-C202109014A MBP

FIGS. 1-3 are tandem chromatography purification profiles of YB01-C202109015B batches of capto Q imprrs + capto adhere of example 1.

FIGS. 1-4 show the results of electrophoresis of samples from the YB01-C202109015B batch purification process of example 1.

FIG. 2-1 is a schematic diagram of tandem chromatography purification of YB01-C202109018B batches of capto Q imprrs + capto adhere of example 2.

FIG. 2-2 shows the results of electrophoresis of samples from the YB01-C202109018B batch purification process of example 2.

FIG. 3-1 is a graph of the purification of batch 1 step capto adhere chromatography (20% elution) from YB01-C202109019B of example 3.

FIG. 3-2 is a chromatogram of the batch 2 step capto Q Impres chromatography purification from YB01-C202109019B of example 3.

FIGS. 3-3 show the results of electrophoresis of samples from the YB01-C202109019B batch purification process of example 3.

FIG. 4-1 is a graph of the purification of batch 1 step capto adhere chromatography (30% elution) from YB01-C202109020B of example 4.

FIG. 4-2 is a chromatogram of the batch 2 step capto Q Impres chromatography purification from YB01-C202109020B of example 4.

FIGS. 4-3 show the results of electrophoresis of samples from the YB01-C202109020B batch purification process of example 4.

FIG. 5-1 is a chromatogram of the capto Q Impres in batch 1 step from YB01-C202109021B of example 5.

FIG. 5-2 is a schematic representation of the chromatographic purification of batch 2 step capto adhere chromatography (20% elution) from YB01-C202109021B of example 5.

FIGS. 5-3 show the results of electrophoresis of samples from the YB01-C202109021B batch purification process of example 5.

FIG. 6-1 is a chromatogram of the capto Q Impres in batch 1 step from YB01-C202109022B of example 6.

FIG. 6-2 is a graph of the purification of batch 2 step capto adhere chromatography (30% elution) from YB01-C202109022B of example 6.

FIGS. 6-3 show the results of electrophoresis of samples from the YB01-C202109022B batch purification process of example 6.

FIG. 7-1 is a graph of the 1 st sample purification of the YB01-C202110035A batch MBP affinity chromatography of example 7.

FIG. 7-2 is a2 nd sample purification of the YB01-C202110035A batch MBP affinity chromatography of example 7.

FIGS. 7-3 are 3 rd sample purifications from YB01-C202110035A batch MBP affinity chromatography of example 7.

FIGS. 7-4 are magnified chromatographic purifications from YB01-C202110035A batches of capto Q imprcs + capto adhere in tandem chromatography of example 7.

FIGS. 7-5 show the results of electrophoresis of samples from the YB01-C202110035A batch purification process of example 7.

Figure 8 shows a two-end male connection. Wherein, 1 is a capto Q imprres column, 2 is a capto adhere column, and 3 is connected by external thread connecting pieces at two ends of AKTA 1/16.

Figure 9 is the post direct insertion connection. Wherein, 1 is a capto Q ImpRes column, and 2 is a capto adhere column.

Fig. 10 shows a two-end female connection. Wherein, 2 is a capto Q imprres column, 1 is a capto adhere column, and the capto adhere column is connected through internal thread connecting pieces at two ends of AKTA 1/16.

Detailed Description

For the purpose of enhancing the understanding of the present invention, the present invention will be further explained with reference to the accompanying drawings and examples, which are only for the purpose of explaining the present invention and do not limit the scope of the present invention.

Various 4.7mL prepacked chromatographic columns, capto Q ImpRes and capto adhere fillers used in the invention are purchased from GE company (today Cytiva company); the hollow chromatographic column filled with 20mL, 25mL and 85mL of fillers is purchased from Beijing Huideyi company; MBP filler was purchased from NEB corporation under article number E8021L.

In the invention, the preparation method of the escherichia coli genetic engineering bacteria for expressing the target protein MNR2 comprises the following steps: by the gene recombination technology, the MNR2 target gene and the MBP tag protein gene are integrated on a pET26b (+) vector and are introduced into Escherichia coli. The MNR2 of the target protein is expressed in the thalli of the escherichia coli through the fermentation of the escherichia coli and the induction of the escherichia coli by IPTG.

The method comprises the following specific steps:

1) according to the gene sequences of MBP and MNR genes, oligonucleotide sequences 1a _1, 1a _2, 1a _3, 1a _4, 1a _5, 1a _6, 1a _7, 1a _8, 1a _9, 1a _10, 1a _11, 1a _12, 1a _13, 1a _14, 1a _15, 1a _16, 1a _17, 1a _18, 1a _19, 1a _20, 1a _21, 1a _22, 1a _23, 1a _24, 1a _25, 1a _26, 1a _27, 1a _28, 1a _29 and 1a _30 are synthesized, then sequences 1b _1, 1b _2, 1b _3 and 1b _4 are synthesized, and the sequences 1a _1 and 1b _4 are used for gene amplification to obtain the MBP-MNR optimized gene sequences.

2) The MBP-MNR optimized gene is used as a substrate, and primers are used for PCR amplification. The 5 'primer of MNR-MBP gene has NcoI cutting site, and the 3' primer has EcoRI cutting site. The PCR product obtained was subjected to double digestion with NcoI and EcoRI (from NEB), purified, and inserted into pET26b (+) E.coli expression vector (pET26b (+) E.coli expression vector from Novagen) which had been subjected to the same double digestion with ligase (from NEB). Then, the plasmid vector with correct sequencing is pET26b-mbp-mnr expression plasmid vector after the screening and the single clone selection of kana resistant bacterial culture plate and the sequencing identification.

5' forward primer (SEQ ID NO.38), sequence:

CTCCTCGCTGCCCAGCCGGCGATGGCCATGGATAAAATCGAAGAAGGCAAACTGGTG

3' reverse primer (SEQ ID No.39), sequence:

GGCCGCAAGCTTGTCGACGGAGCTCGAATTCTCAGTGCGCCGGCGGGGCGGTGCTGCCCGGAGCCGGACGGGTGTCTGGAGCAG

3) pET26b-mbp-MNR expression plasmid vector is transformed into E.coli BL21(DE)3 host bacterium (E.coli BL21(DE)3 host bacterium is purchased from Novagen company), and then antibiotic kan screening is carried out to obtain the Escherichia coli genetic engineering bacterium for expressing the target protein MNR 2.

The experimental method not referring to the specific conditions was carried out according to the conventional method. Such as "molecular cloning instructions (fourth edition)" (month 3 2017, published by scientific publishers, llc, authors j. sambrook, m.r. green, congratulatory fortunes).

Example 1

The purification batch is YB01-C202109015B, and the specific serial one-step purification process is adopted.

In this example, the specific steps of the MNR2 protein purification process are as follows:

1) the target protein MNR2 is expressed by fermentation induction of the escherichia coli genetically engineered bacteria, and bacterial sludge collected after centrifugation is selected as a fermentation batch F202108007A.

2) Taking 30g of bacterial sludge, adding 240mL of lysis buffer for resuspension, then crushing for 3 times under the condition of 800bar pressure of a homogenizer, centrifuging 25000rpm for 30 minutes on the crushed liquid, removing crushed bacterial slag, collecting 240mL of supernatant, and sterilizing through a 0.22um filter membrane.

The cracking buffer component is as follows: 20mM Tris-HCl, 0.2M NaCl, 1mM EDTA, pH 7.40. + -. 0.05/25 ℃;

3) MBP affinity chromatography (purification run YB 01-C202109014A): the MBP chromatographic column medium is 85mL, the flow rate is adjusted to 10mL/min for column washing, 450mL of ultrapure water is used firstly, then 450mL of wash buffer is used for balancing, and UV₂₈₀After the calibration is 0, loading the membrane-passing supernatant into an MBP affinity chromatographic column, collecting flow-through liquid 300mL, and then washing impurities by using 500mL wash buffer to remove the impure protein and the like which are not firmly combined with the medium; then using 340mLElute buffer to elute the MNR2 (the target protein) with the elution conductivity value of 16.2mS/cm and UV₂₈₀The collection range is 147-2003-75mAu, the elution volume is 106mL, the detected protein concentration is 2.19mg/mL, and the purity of MNR2 protein is about 90%; because more target protein still exists in the collected flow penetrating liquid, after the column washing and the balancing process are repeated, 300mL of the flow penetrating liquid is loaded, impurities are washed and eluted, the target protein MNR2 serving as eluent is collected again, the eluting conductivity value is 16.5mS/cm, and the UV conductivity value is UV (ultraviolet) 16.5mS/cm₂₈₀The collection range is 57-481-74mAu, the elution volume is 80mL, the detected protein concentration is 0.69mg/mL, and the purity of MNR2 protein is about 90%; the eluted target protein MNR2 (r) and the eluted target protein MNR2 (r) are mixed uniformly to obtain 186mL of MNR2 target protein, and the concentration of the mixed solution is detected to be 1.46mg/mL (30 mL of MNR is taken as a sample respectively in the follow-up process, and the experiment of the embodiment 1-2-3-4-5-6 is carried out)。

The wash buffer comprises the following components: 20mM Tris-HCl, 0.2M NaCl, 1mM EDTA, pH 7.40. + -. 0.05/25 ℃;

the Elute buffer comprises the following components: 20mM Tris-HCl, 0.2M NaCl, 1mM EDTA, 10mM maltose, pH 7.40. + -. 0.05/25 ℃.

4) Sample dilution: taking 30mL of sample for experiment (namely total protein amount is 30 x 1.46 ═ 43.8mg), diluting the sample after the MBP affinity chromatography elution by 2.5 times by using low-salt buffer, namely adding 45mL of low-salt buffer into 30mL of feed liquid, mixing uniformly without floccule, and using the feed liquid for standby. And additionally, preparing 5% high-low salt buffer, namely adding 95mL of low salt buffer into 5mL of high salt buffer, uniformly mixing, and preparing 100mL of the mixture for later use.

The composition of the low-salt buffer is 20mM Tris-HCl and 1mM EDTA, and the pH value is 7.0/25 ℃;

high salt buffer, 20mM Tris-HCl, 1mM EDTA, 1M NaCl, pH7.0/25 ℃.

5) The columns are connected in series: a capto Q Impres 4.7mL chromatography column (code number Q3) and a capto adhere 4.7mL chromatography column (code number A2) were connected in series, with the capto Q Impres column on top and the capto adhere column on bottom, to the purifier column position valve, through 1/16 external threaded two-way connections on both ends (see FIG. 8);

6) column washing and balancing: the flow rate is adjusted to be 2.0 mL/min; washing the column with 50mL of ultrapure water, washing the column with 30mL of 0.5M sodium hydroxide, washing the column with 100mL of ultrapure water, and balancing the column with 50mL of 5% high and low salt buffer, wherein the conductivity value is about 6.7ms/cm, and the UV value and the conductivity value have substantially no fluctuation₂₈₀The value is calibrated to 0;

7) sampling and removing impurities: loading the purified and diluted feed liquid in one step to a series of chromatographic columns, and adjusting the flow rate to 2.0 mL/min; the conductivity value is about 6.9ms/cm, after 75mL of sample loading is finished, 50mL of prepared 5% concentration high-low salt buffer is used for washing impurities, part of impurity proteins and endotoxin which are weakly combined with the filler are removed, and 35mL of impurity washing liquid (no target protein is dispensed) is collected;

8) protein elution and collection: removing capto Q Impres column, eluting protein from capto adhere column, placing collection tube in collector in advance, and setting 20% gradient washing for purifierDe-targeting proteins, as proteins UV₂₈₀After the absorption value rises to 68mAU, clicking to collect, and then collecting the target protein by a collector, namely UV₂₈₀Collection range 68-560-70mAu, UV₂₈₀After the value is reduced to 70mAU, the collection is stopped by clicking, and the conductivity value in the elution process is about 17.4-20.4 ms/cm. Collecting 2 tubes together, wherein the concentration of protein in the X1 tube is 0.62 mg/mL; 22mL of X2 tube, and the protein concentration is 0.19 mg/mL; this is the final feed solution for purification, i.e. 35.2mg of the target protein is obtained altogether, and the total yield of this purification is 80.4%.

The composition of the low-salt buffer is 20mM Tris-HCl and 1mM EDTA, and the pH value is 7.0/25 ℃; high salt buffer, 20mM Tris-HCl, 1mM EDTA, 1M NaCl, pH7.0/25 ℃.

9) And (3) column cleaning and preservation: after the elution is finished, the capto Q imprmes column and the capto adhere column are connected in series, 50mL of 2M sodium chloride is used for washing the column, then 100mL of ultrapure water is used for washing the column until the conductivity value is almost 0, and then 30mL of 20% ethanol is used for washing the column and liquid sealing is carried out; the two chromatographic columns are disassembled and respectively and properly stored.

10) Protein electrophoresis and index detection: respectively preparing samples such as a sample loading solution, a washing solution, an eluent and the like, dispensing, carrying out SDS-page electrophoresis, inspecting the purification effects such as protein purity and the like, wherein the protein purity of the eluent X1 and X2 is more than 95%; and detecting the protein content of the purified sample by adopting a bradford method in the 2020 edition of Chinese pharmacopoeia, wherein the concentration of the protein in an X1 tube is 0.62mg/mL, and the concentration of the protein in an X2 tube is 0.19 mg/mL; qualified products with endotoxin less than 75EU/mg, qualified products with host protein residue of 12.6ng/mg (standard 1000ng/mg) and qualified products with host DNA residue of 0.4ng/mg (standard 20ng/mg) are obtained by adopting related detection methods in the 2020 edition of Chinese pharmacopoeia.

The results are shown in FIGS. 1-1, 1-2, 1-3 and 1-4.

Example 2 (as a comparative example)

The purification batch is YB 01-C202109018B.

steps 1) -4) are the same as steps 1) -4) in example 1.

5) The columns are connected in series: a capto Q imprres (code No. Q9)5.0mL column was connected in series with a capto adhere (code No. a2)4.7mL column, the capto Q imprres column being above and the capto adhere column being below, by direct insertion linkage (see fig. 9), to the purifier column position valve;

6) column washing and balancing: the flow rate is adjusted to be 2.0 mL/min; washing the column with 60mL of ultrapure water, washing the column with 30mL of 0.5M sodium hydroxide, washing the column with 100mL of ultrapure water, balancing the column with 60mL of 5% high-low salt buffer, wherein the conductivity value is 6.7ms/cm, and the UV value and the conductivity value have no fluctuation basically₂₈₀The value is calibrated to 0;

7) sampling and removing impurities: loading the feed liquid diluted by 2.5 times after the one-step purification into a series chromatographic column, and adjusting the flow rate to 3.0 mL/min; the conductivity value is about 6.2ms/cm, after 75mL of sample loading is finished, 50mL of prepared 5% concentration high-low salt buffer is used for washing impurities, part of impurity proteins and endotoxin which are weakly combined with the filler are removed, and 22.5mL of impurity washing liquid (no target protein is dispensed) is collected;

8) protein elution and collection: removing the capto Q Impres column, starting to elute proteins from the capto adhere column, putting the collection tube in a collector in advance, setting 30% gradient elution target proteins in a purifier, and eluting the target proteins when the proteins are UV₂₈₀After the absorption value rises to 61mAU, clicking and collecting, and then collecting the target protein by a collector, namely UV₂₈₀Collection range 61-1376-66mAu, UV₂₈₀The value is reduced to 66mAU click to stop collection, and the conductivity value of the elution process is about 18.3-28.6 ms/cm. Collecting 1 tube, wherein the concentration of protein in the X1 tube is 0.85 mg/mL; this is the final feed solution for purification, i.e., 42.5mg of the target protein is obtained in total, and the yield of this purification step is 97.0%.

9) And (3) column cleaning and preservation: after the elution is finished, the capto Q imprmes column and the capto adhere column are connected in series, 40mL of 2M sodium chloride is used for washing the column, then 100mL of ultrapure water is used for washing the column until the conductivity value is almost 0, and then 30mL of 20% ethanol is used for washing the column and liquid sealing is carried out; the two chromatographic columns are disassembled and respectively and properly stored.

10) Protein electrophoresis and index detection: respectively preparing samples of a sample loading solution, a impurity washing solution, an eluent and the like, dispensing, performing SDS-page electrophoresis, inspecting the purification effects of protein purity and the like, wherein the purity of the eluent X1 protein is more than 95%; and detecting the protein content of the purified sample by adopting a bradford method in the China pharmacopoeia 2020 edition, wherein the concentration of the X1 tube protein is 0.85 mg/mL; the detection of endotoxin content of more than 75EU/mg is qualified, the detection of host protein residue of 9.4ng/mg is qualified (standard 1000ng/mg), the detection of host DNA residue of 1.54ng/mg is qualified (standard 20ng/mg), and relevant detection methods in the 2020 edition of Chinese pharmacopoeia are adopted.

The results are shown in FIGS. 2-1 and 2-2.

Example 3 (as a comparative example)

The purification batch is YB 01-C202109019B.

steps 1) -4) are the same as steps 1) -4) in example 1.

5) First, capto adhere purification: capto adhere was attached to the purifier column position valve:

column washing and balancing: adjusting the flow rate to 5.0mL/min, washing the column with 50mL of ultrapure water, washing the column with 20mL of 0.5M sodium hydroxide, washing the column with 60mL of ultrapure water, balancing the column with 5% of high and low salt buffer with 65mL of column volume, adjusting the conductivity value to 6.8ms/cm, and after the UV value and the conductivity value are basically not fluctuated, adjusting the UV value₂₈₀The value is calibrated to 0;

sample loading and impurity removal: the MBP is purified in one step, and the diluted 2.5 times of material liquid is loaded on a capto adhere column, and the flow rate is adjusted to 5.0 mL/min; the conductivity value is about 6.5ms/cm, after 75mL of sample loading is finished, 50mL of prepared 5% high-low salt buffer is used for washing impurities, part of impurity proteins and endotoxin which are weakly combined with the filler are removed, and 50mL of impurity washing liquid (no target protein is dispensed) is collected. ③ eluting and collecting the protein: eluting protein from capto adhere column, putting collecting tube in collector in advance, gradient eluting target protein with 20% concentration gradient in purifier, and eluting target protein when protein UV₂₈₀After the absorption value rises to 53mAU, clicking and collecting, and then collecting the target protein by a collector, namely UV₂₈₀Collection range 53-409-70mAu, UV₂₈₀The value is reduced to 79mAu click to stop collection, and the conductivity value of the elution process is about 18.0-20.5 ms/cm.Collecting 2 tubes, wherein 50mL of X1 tubes are used, and the concentration of the detected protein is 0.56 mg/mL; 21mL of X2 tube, and the concentration of the detected protein is 0.2mg/mL, namely the total yield of the target protein 28+4.2 is 32.2mg, and the yield of the purification step is 73.5%.

The low-salt buffer component comprises: 20mM Tris-HCl, 1mM EDTA, pH7.0/25 ℃; the high-salt buffer component is as follows: 20mM Tris-HCl, 1mM EDTA, 1M NaCl, pH7.0/25 ℃.

6) And (3) column cleaning and preservation: after the capto adhere is eluted, washing the column by using 40mL of 2M sodium chloride, then washing the column by using 110mL of ultrapure water until the conductivity value is almost 0, and finally washing the column by using 30mL of 20% ethanol and sealing the column by liquid; it is stored properly.

7) Then capto Q ImpRes purification: capto Q imprres was connected to the purifier column position valve:

column washing and balancing: adjusting the flow rate to 2.0mL/min, washing the column with 50mL of ultrapure water, washing the column with 20mL of 0.5M sodium hydroxide, washing the column with 80mL of ultrapure water, balancing the column with 80mL of endotoxin-removing buffer, adjusting the conductivity to 19.7ms/cm, and adjusting the UV value and the conductivity value without fluctuation₂₈₀The value is calibrated to 0;

sample loading and flow-through liquid collection: the flow rate is adjusted to be 2.0 mL/min; loading the sample X1+ X2 ═ 71mL of the purified capto adhere column on a capto Q Impres column, collecting the flow-through liquid, and performing UV protein purification₂₈₀Clicking to collect the target protein after the absorption value begins to rise to 50mAU, and improving endotoxin buffer after the collection is finished, wherein UV is used for removing endotoxin₂₈₀Collection range 50-181-52mAu, UV₂₈₀Stopping collection when the value is reduced to 52mAu, stopping endotoxin buffer, collecting 70mL of flow-through liquid and detecting the protein concentration to be 0.46mg/mL, wherein the conductivity value is 20.2 ms/cm; this is the final feed for purification, i.e., 32.2mg of the target protein was obtained, which is 100% yield in this purification step. The overall yield of 2-step purification is 73.8%.

The endotoxin-removing buffer component comprises: 20mM Tris-HCl, 200mM sodium chloride, pH7.40/25.0 ℃.

8) And (3) column cleaning and preservation: after the capto Q Impres column is completely eluted, the column is washed by using 40mL of 2M sodium chloride, then by using 100mL of ultrapure water until the conductivity value is almost 0, and then by using 30mL of 20% ethanol for washing the column and sealing the column; it is stored properly.

9) Protein electrophoresis and index detection: respectively collecting samples of the sample loading solution, the impurity washing solution, the eluent and the like, preparing samples, dispensing, carrying out SDS-page electrophoresis, inspecting the purification effects of protein purity and the like, wherein the purity of the eluent X1 protein is more than 95%; detecting the protein content of the purified sample by adopting a bradford method in the 2020 edition of Chinese pharmacopoeia, and collecting 70mL of feed liquid with the protein concentration of 0.46 mg/mL; the detection of endotoxin content less than 75EU/mg is qualified, the detection of host protein residue is 18.1ng/mg is qualified (standard 1000ng/mg), the detection of host DNA residue is 1.29ng/mg is qualified (standard 20ng/mg), and relevant detection methods in the 2020 edition of Chinese pharmacopoeia are adopted.

The results are shown in FIGS. 3-1, 3-2 and 3-3.

Example 4 (as a comparative example)

The purification batch is YB 01-C202109020B.

steps 1) -4) are the same as steps 1) -4) in example 1.

column washing and balancing: adjusting the flow rate to 6.0mL/min, washing the column with 50mL of ultrapure water, washing the column with 20mL of 0.5M sodium hydroxide, washing the column with 75mL of ultrapure water, balancing the column with 5% high and low salt buffer with 60mL of column volume, wherein the conductivity value is 6.8ms/cm, and after the UV value and the conductivity value are basically not fluctuated, the UV value is adjusted₂₈₀The value is calibrated to 0;

sample loading and impurity removal: purifying MBP in one step, diluting the MBP by 2.5 times, loading 75mL of feed liquid to a capto adhere column, and adjusting the flow rate to 6.0 mL/min; the conductivity value is about 6.7ms/cm, after 75mL of sample loading is finished, 55mL of prepared 5% high-low salt buffer is used for washing impurities, part of impurity proteins and endotoxin which are weakly combined with the filler are removed, and 55mL of impurity washing liquid (no target protein is dispensed) is collected. ③ eluting and collecting the protein: eluting protein from capto adhere column, putting collecting tube in collector, gradient eluting target protein with 30% concentration gradient in purifier, and eluting target protein when protein UV₂₈₀After the absorption value rises to 50mAUCollecting target protein by hitting collector, and collecting UV₂₈₀Collection range 50-954-54mAU, UV₂₈₀The value drops to 54mAU clicks to stop collection, and the conductivity value in the elution process ranges from about 16.4 to 29.5 ms/cm. Collecting 50mL of 1X 1 tube, and detecting the protein concentration to be 0.79 mg/mL; this step yielded target protein 28+4.2 ═ 39.5mg, 90.2% yield from this purification step.

6) And (3) column cleaning and preservation: after the capto adhere is eluted, washing the column with 40mL of 2M sodium chloride, then washing the column with 100mL of ultrapure water until the conductivity value is almost 0, then washing the column with 30mL of 20% ethanol and sealing the column with liquid; it is stored properly.

column washing and balancing: adjusting the flow rate to 1.7mL/min, washing the column with 50mL of ultrapure water, washing the column with 20mL of 0.5M sodium hydroxide, washing the column with 60mL of ultrapure water, balancing the column with 65mL of endotoxin-removing buffer, adjusting the conductivity to 19.7ms/cm, and adjusting the UV value and the conductivity value without fluctuation₂₈₀The value is calibrated to 0;

sample loading and flow-through liquid collection: the flow rate is adjusted to be 1.7 mL/min; the sample purified by capto adhere column, X1 ═ 50mL of feed solution, was applied to capto Q imprmes column, and the flow-through was collected as protein UV₂₈₀Clicking to collect the target protein after the absorption value begins to rise to 58mAU, and improving endotoxin buffer after the collection is finished, wherein the collection is started, and UV is used for removing endotoxin₂₈₀Collection range 58-347-68mAu, UV₂₈₀Stopping collection when the value is reduced to 68mAu, stopping endotoxin buffer, collecting 55mL of flow-through liquid and detecting the protein concentration to be 0.51mg/mL, wherein the conductivity value is 28.5 ms/cm; this was the final feed purified, which yielded 28.1mg of target protein 55 x 0.51 after this purification step, yielding 71.1% yield from this purification step. The overall yield of the 2-step purification is 64.1%.

9) Protein electrophoresis and index detection: respectively collecting samples of the sample loading solution, the impurity washing solution, the eluent and the like, preparing samples, dispensing, carrying out SDS-page electrophoresis, inspecting the purification effects of protein purity and the like, wherein the purity of the eluent X1 protein is more than 95%; detecting the protein content of the purified sample by adopting a bradford method in the 2020 edition of Chinese pharmacopoeia, and collecting 55mL of feed liquid with the protein concentration of 0.51 mg/mL; the detection of endotoxin content of more than 75EU/mg is qualified, the detection of host protein residue of 16.8ng/mg is qualified (standard 1000ng/mg), the detection of host DNA residue of 0.37ng/mg is qualified (standard 20ng/mg), and relevant detection methods in the 2020 edition of Chinese pharmacopoeia are adopted.

The results are shown in FIGS. 4-1, 4-2 and 4-3.

Example 5 (as a comparative example)

The purification batch is YB 01-C202109021B.

steps 1) -3) are the same as steps 1) -3) in example 1.

4) First purified using capto Q ImpRes: capto Q imprres was connected to the purifier column position valve:

column washing and balancing: adjusting the flow rate to 1.5mL/min, washing the column with 50mL of ultrapure water, washing the column with 20mL of 0.5M sodium hydroxide, washing the column with 60mL of ultrapure water, balancing the column with 35mL of endotoxin-removing buffer, adjusting the conductivity to 20.4ms/cm, and adjusting the UV value and the conductivity value substantially without fluctuation₂₈₀The value is calibrated to 0;

sample loading and flow-through liquid collection: the flow rate is adjusted to be 1.5 mL/min; loading 30mL of purified sample of MBP affinity chromatography on capto Q Impres column, collecting flow-through liquid, and collecting protein UV₂₈₀Clicking to collect after the absorption value begins to rise to 51mAU, collecting the target protein by a collector, and changing to endotoxin buffer after the sample loading is finished, wherein UV is added₂₈₀Collection range 51-680-61mAu, UV₂₈₀Stopping collection when the value is reduced to 61mAu, stopping endotoxin buffer, collecting 43mL of flow-through liquid and detecting the protein concentration to be 1.01mg/mL, wherein the conductivity value is 20.3 ms/cm; after this purification, 43 × 1.01 to 43.4mg of the target protein was obtained, and the yield of this purification step was 99.1%.

The endotoxin removal buffer component used above was: 20mM Tris-HCl, 200mM sodium chloride, pH7.40/25.0 ℃.

5) And (3) column cleaning and preservation: after the capto Q Impres column is completely eluted, the column is washed by using 40mL of 2M sodium chloride, then by using 100mL of ultrapure water until the conductivity value is almost 0, and then by using 30mL of 20% ethanol for washing the column and sealing the column; it is stored properly.

6) 43mL of flow-through liquid collected from capto Q Impres was diluted 5-fold to obtain 215mL of feed liquid for use.

7) Then capto adhere purification: capto adhere was attached to the purifier column position valve:

column washing and balancing: adjusting the flow rate to 5.0mL/min, washing the column with 50mL of ultrapure water, washing the column with 20mL of 0.5M sodium hydroxide, washing the column with 75mL of ultrapure water, balancing the column with 40mL of 5% high-low salt buffer, adjusting the conductivity value to 6.6ms/cm, and after the UV value and the conductivity value are basically not fluctuated, performing UV₂₈₀The value is calibrated to 0;

sample loading and impurity removal: 215mL of the feed liquid diluted by 2.5 times is loaded on a capto adhere column, and the flow rate is adjusted to 5.0 mL/min; the conductivity value is about 6.7ms/cm, after 215mL of sample is loaded, 45mL of prepared 5% high-low salt buffer is used for washing impurities, part of impurity proteins and endotoxin which are weakly combined with the filler are removed, and 45mL of impurity washing liquid (no target protein is dispensed) is collected.

③ eluting and collecting the protein: eluting protein from capto adhere column, putting collecting tube in collector in advance, gradient eluting target protein with 20% concentration gradient in purifier, and eluting target protein when protein UV₂₈₀After the absorption value is increased to 51mAU, clicking and collecting, and then collecting the target protein by a collector, namely UV₂₈₀Collection range 51-314-56mAU, UV₂₈₀The value drops to 56mAU clicks to stop collection, and the conductivity value in the elution process ranges from about 19.2 to 20.7 ms/cm. Collecting 2 tubes, wherein 50mL of X1 tubes are used, and the concentration of the detected protein is 0.44 mg/mL; 25mL of X2 tube, and detectionThe protein concentration was 0.14mg, and this purification procedure yielded 25.5mg of MNR2 protein 22+3.5, 58.8% yield.

8) And (3) column cleaning and preservation: after the capto adhere is eluted, washing the column with 40mL of 2M sodium chloride, then washing the column with 100mL of ultrapure water until the conductivity value is almost 0, then washing the column with 30mL of 20% ethanol and sealing the column with liquid; it is stored properly.

9) Protein electrophoresis and index detection: respectively collecting samples of the sample loading solution, the impurity washing solution, the eluent and the like, preparing samples, dispensing, carrying out SDS-page electrophoresis, inspecting the purification effects of protein purity and the like, wherein the purity of the eluent X1 protein is more than 95%; detecting the protein content of the purified sample by adopting a bradford method in the 2020 edition of Chinese pharmacopoeia, and collecting 75mL of feed liquid and 25.5mg of total protein; the detection of endotoxin content less than 75EU/mg is qualified, the detection of host protein residue 13.6ng/mg is qualified (standard 1000ng/mg), the detection of host DNA residue 1.6ng/mg is qualified (standard 20ng/mg), and relevant detection methods in the 2020 edition of Chinese pharmacopoeia are adopted.

The results are shown in FIGS. 5-1, 5-2 and 5-3.

Example 6 (as a comparative example)

The purification batch is YB 01-C202109022B.

steps 1) -3) are the same as steps 1) -3) in example 1.

column washing and balancing: adjusting the flow rate to 1.7mL/min, washing the column with 50mL of ultrapure water, washing the column with 20mL of 0.5M sodium hydroxide, washing the column with 60mL of ultrapure water, balancing the column with 35mL of endotoxin-removing buffer, adjusting the conductivity to 20.5ms/cm, and adjusting the UV value and the conductivity value substantially without fluctuation₂₈₀The value is calibrated to 0;

sample loading and flow-through liquid collection: the flow rate is adjusted to be 1.7 mL/min; affinity of MBPLoading 30mL of purified sample to capto Q Impres column, collecting flow-through liquid, and collecting the flow-through liquid as protein UV₂₈₀Clicking to collect the target protein after the absorption value begins to rise to 68mAU, and changing the collection into endotoxin buffer after the sample loading is finished, wherein UV is added₂₈₀Collection range 68-684-65mAu, UV₂₈₀Stopping collection when the value is reduced to 65mAu, stopping endotoxin buffer, collecting 47mL of flow-through liquid and detecting the protein concentration to be 0.83mg/mL, wherein the conductivity value is 20.3 ms/cm; after this purification, target protein 47 × 0.83 ═ 39.0mg was obtained, with a yield of 89.0% in this purification step.

6) 42mL of flow-through liquid collected by capto Q Impres is diluted by 5 times to obtain 210mL of feed liquid for later use.

column washing and balancing: adjusting the flow rate to 6.0mL/min, washing the column with 50mL of ultrapure water, washing the column with 20mL of 0.5M sodium hydroxide, washing the column with 75mL of ultrapure water, balancing the column with 5% of high and low salt buffer with 40mL of column volume, adjusting the conductivity value to 6.6ms/cm, and after the UV value and the conductivity value are basically not fluctuated, adjusting the UV value₂₈₀The value is calibrated to 0;

sample loading and impurity removal: loading 210mL of the feed liquid diluted by 2.5 times to a capto adhere column, and adjusting the flow rate to 6.0 mL/min; the conductivity value is about 6.6ms/cm, after 210mL of sample loading is finished, 45mL of prepared 5% high-low salt buffer is used for washing impurities, part of impurity proteins and endotoxin which are weakly combined with the filler are removed, and 40mL of impurity washing liquid (no target protein is dispensed) is collected.

③ eluting and collecting the protein: eluting protein from capto adhere column, putting collecting tube in collector, gradient eluting target protein with 30% concentration gradient in purifier, and eluting target protein when protein UV₂₈₀Absorption value ofAfter the protein is raised to 51mAU, clicking to collect the protein, and starting to collect the target protein by a collector, namely UV₂₈₀Collection range 51-954-50mAU, UV₂₈₀The value drops to 50mAU clicks to stop collection, and the conductivity value in the elution process ranges from about 17.2 to 29.4 ms/cm. Collecting 1 tube, X1 tube 51mL, detecting protein concentration 0.73mg/mL, obtaining MNR2-MBP protein 51 0.73 ═ 37.2mg in the purification step, the yield in the step is 95.4%; the total yield of the 2-step purification is 84.9%.

9) Protein electrophoresis and index detection: respectively collecting samples of the sample loading solution, the impurity washing solution, the eluent and the like, preparing samples, dispensing, carrying out SDS-page electrophoresis, inspecting the purification effects of protein purity and the like, wherein the purity of the eluent X1 protein is more than 95%; detecting the protein content of the purified sample by adopting a bradford method in the 2020 edition of Chinese pharmacopoeia, and collecting 75mL of feed liquid and 25.5mg of total protein; the detection of endotoxin content of more than 75EU/mg is qualified, the detection of host protein residue of 13.6ng/mg is qualified (standard 1000ng/mg), the detection of host DNA residue of 1.6ng/mg is qualified (standard 20ng/mg), and relevant detection methods in the 2020 edition of Chinese pharmacopoeia are adopted.

The results are shown in FIGS. 6-1, 6-2 and 6-3.

Example 7 (enlargement of example 1)

In the invention, the specific steps of the MNR2 protein purification process are as follows: purification batch C202110015B was cascaded with one-step purification process 3: the fractions were purified by 4.7mL chromatography columns for capto Q imprs and capto adhere, respectively, and amplified to capto Q imprs 20mL and capto adhere 25 mL.

1) The target protein MNR-MBP is expressed by fermentation induction of genetically engineered bacteria escherichia coli, and bacterial sludge collected after centrifugation is selected as a fermentation batch F202110012A.

2) Taking 50g of bacterial sludge, adding 500mL of lysis buffer for resuspension, then crushing for 3 times by a homogenizer under the pressure of 800bar, centrifuging the crushed liquid for 25000rpm for 30 minutes, removing crushed bacterial residues, collecting 500mL of supernatant, and sterilizing by a 0.22um filter membrane.

The cracking buffer component is as follows: 20mM Tris-HCl, 0.2M NaCl, 1mM EDTA, pH 7.40. + -. 0.05/25 ℃.

3) MBP affinity chromatography: the column was washed with 85mL of MBP column medium at a flow rate of 10 mL/min.

First, 450mL of ultrapure water is used, then 260mL of wash buffer is used for balancing, the equilibrium conductivity value is 17.0mS/cm, and UV₂₈₀After calibration to 0, the membrane-bound supernatant is applied to an MBP affinity column and UV is applied after application₂₈₀Collecting flow-through liquid (530 mL) when the value begins to rise, removing impure protein which is loosely combined with a medium by using 250mL wash buffer after the sample loading is finished, and collecting wash impure liquid (260 mL); then the MNR2 of the target protein is eluted by using 200 mLEluete buffer, the conductivity value of the elution is 16.7mS/cm, and UV is applied₂₈₀The collection range of 146-1502-100mAu, the elution volume of 125mL, the detected protein concentration of 1.56mg/mL, and the purity of the MNR2 protein of 195mg obtained by one-time elution are about 92%.

(II) since there are still many target proteins in the flow-through solution, repeat the above procedure, load (530 mL) of flow-through solution when UV₂₈₀Collecting flow-through liquid (600 mL) when the value begins to rise, collecting wash impurity-washing liquid (230 mL) in sequence, collecting target protein MNR2 (70 mL), and UV₂₈₀The collection range is 150-896-150mAu, and the protein concentration is detected to be 1.06 mg/mL. (III) flow-through liquid is added to 600mL of sample, when UV is applied₂₈₀Collecting flow penetrating liquid (600 mL), collecting wash impurity washing liquid (235 mL), eluting and collecting target protein MNR2 (48 mL) and UV₂₈₀The collection range is 141-623-120mAu, and the concentration of the detected protein is 0.99 mg/mL. Then mixing the target protein MNR2 eluted in the 3 steps for 243mL, detecting the concentration of the protein in the mixed solution to be 1.27mg/mL, and counting 308.6mg of the MNR2 protein for tandem purification.

The wash buffer comprises the following components: 20mM Tris-HCl, 0.2M NaCl, 1mM EDTA, pH 7.40. + -. 0.05/25 deg.C

The Elute buffer comprises the following components: 20mM Tris-HCl, 0.2M NaCl, 1mM EDTA, 10mM maltose, pH 7.40. + -. 0.05/25 deg.C

4) Sample dilution: taking 200mL of the mixed solution to carry out next purification (namely the total amount of the protein is 200 x 1.27 ═ 254mg), diluting the sample eluted by the MBP affinity chromatography by 2.5 times by using a low-salt buffer, namely adding 300mL of the low-salt buffer into 200mL of the mixed solution, uniformly mixing the mixed solution by 500mL, and keeping the mixed solution without floccules for later use. And additionally configuring a 5% high-low salt buffer, namely adding 20mL of the high-salt buffer into 380mL of the low-salt buffer, and uniformly mixing for later use.

high salt buffer, 20mM Tris-HCl, 1mM EDTA, 1M NaCl, pH7.0/25 ℃.

5) The columns are connected in series: a capto QImpRes 20mL column (code No. Q10) was connected in series with a capto adhere 20mL column (code No. A3) through an 1/16PEEK two-way female adapter (see FIG. 10), the capto Q Impres column being the front and the capto adhere column being the rear. The upper end joint of the capto Q Impres column is connected with a column position valve at the inlet end of the purifier, the lower end joint of the capto Q Impres column is connected with the upper end joint of the capto adhere column through an 1/16PEEK two-way internal thread adapter, and the lower end joint of the capto adhere column is connected to the column position valve at the outlet end of the purifier;

6) column washing and balancing: adjusting the flow rate to 6 mL/min; washing the column with 180mL of ultrapure water, washing the column with 135mL of 0.5M sodium hydroxide, washing the column with 300mL of ultrapure water, and balancing the column with 250mL of 5% high-low salt buffer with conductivity value of 7.0ms/cm, wherein the UV value and the conductivity value have no fluctuation basically₂₈₀The value is calibrated to 0;

7) sampling and removing impurities: loading the sample of the feed liquid which is purified and diluted in one step to carry out series chromatography, and adjusting the flow rate to 10 mL/min; the conductivity value is 6.9ms/cm, after 500mL of sample loading is finished, 350mL of prepared 5% concentration high-low salt buffer is used for washing impurities, part of impurity proteins and endotoxin which are weakly combined with the filler are removed, and 350mL of impurity washing liquid (no target protein is dispensed) is collected;

8) protein elution and collection: removing the capto Q Impres column, eluting proteins on the capto adhere column, putting the collection tube in a collector in advance, setting 25% gradient elution target protein in a purifier, and eluting the target protein when the proteins are UV₂₈₀After the absorption value rises to 93mAU, clicking and collecting, and then collecting the target protein by a collector, namely UV₂₈₀Collection range 93-1379-100mAU, UV₂₈₀After the value is reduced to 100mAU, the collection is stopped by clicking, and the conductivity value in the elution process is about 19.4-21.2 ms/cm. Collecting 170mL of eluent with the protein concentration of 1.35mg/mL to obtain 229.5mg of MNR2 protein; this was the final feed purified in 90.4% yield.

9) And (3) column cleaning and preservation: after the elution is finished, the capto Q imprmes column and the capto adhere column are connected in series, the column is washed by 150mL of 2M sodium chloride and then by 250mL of ultrapure water until the conductivity value is almost 0, and then the column is washed by 135mL of 20% ethanol and sealed by liquid; the two chromatographic columns are disassembled and respectively and properly stored.

10) Protein electrophoresis and index detection: respectively preparing samples of the sample loading solution, the impurity washing solution, the eluent and the like, dispensing, performing SDS-page electrophoresis, inspecting the purification effects of protein purity and the like, wherein the protein purity of the eluent is more than 95%; and detecting the protein content of the purified sample by adopting a bradford method in the 2020 edition of Chinese pharmacopoeia, wherein the protein concentration is 1.35 mg/mL; qualified products with endotoxin less than 75EU/mg, qualified products with host protein residue of 17.1ng/mg (standard 1000ng/mg), qualified products with host DNA residue of 1.9ng/mg (standard 20ng/mg) are obtained by adopting related detection methods in the 2020 edition of Chinese pharmacopoeia.

The results are shown in FIG. 7-1, FIG. 7-2, FIG. 7-3, FIG. 7-4 and FIG. 7-5.

Example 8 analysis of purification Effect of examples 1 to 7

And (4) conclusion:

the detection standard of host protein, namely HCP, is less than 100ng/mg, all batches are qualified and are far lower than the limit value of 1000ng/mg of the standard guided by Chinese pharmacopoeia 2020.

② the detection standard of host DNA (HCD) is less than 20ng/mg, and all batches are qualified.

Thirdly, according to the 2020 edition of Chinese pharmacopoeia, the endotoxin limit calculation mode, because the dosage of MNR2 protein is very low, the MNR2 protein endotoxin content is less than 150EU/mg, the qualification can be judged, and the index is less than 75 EU/mg.

And fourthly, purifying the raw materials in the batches to realize no impurity band.

Common Capto adhere purification with 30% of large elution strength, high protein concentration and high yield; however, 30% elution easily causes the risk of endotoxin exceeding the standard.

EXAMPLE 7, further verification of further purification and amplification feasibility, simple and convenient operation.

Although 2 steps of purification process are carried out after the MBP affinity chromatography or the index requirement can be met, the efficiency of the purification process is far lower than that of the 1 step of purification process of the invention, and the operation is convenient.

Supplementary explanation: the molecular weight of the target protein MNR2(-MBP) is 55.9kd, and a weak MBP label protein band 43.6kd is arranged below the target protein MNR2(-MBP), so that the target protein is allowed to exist in the product and has a physiological activity function.

The above description is only an example of the present invention and is not intended to limit the scope of the present invention, and all equivalent modifications made by the present invention as described in the specification of the present invention or directly or indirectly applied to other related technical fields are included in the scope of the present invention.

Sequence listing

<110> Yuan (Zhuhai horizontal organ) Biotechnology Co., Ltd

<120> a method for purifying MNR2 protein

<160> 39

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tacttcactt ggccgctgat 20

<210> 2

<211> 116

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggcctctgca gtcgacgggc ccggggaaga cttggacgcg tatccggtgc agaagtaacg 60

ccgtgtgccg gcggtgcagt ggaacccggc gctggacgag tatccggcgc agacgt 116

<210> 3

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aacgacggcc agagaattcg agctcggtac cggatccctc ctcgctgccc agccggcgat 60

ggcc 64

<210> 4

<211> 68

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cccttatcac cgttgatcca gatcaccagt ttgccttctt cgattttatc catggccatc 60

gccggctg 68

<210> 5

<211> 68

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

caacggtgat aagggttata acggtctggc ggaagtaggc aagaaattcg aaaaagacac 60

cggtatca 68

<210> 6

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

acctgaggga atttttcttc cagtttgtct ggatgttcaa cggtaacttt gataccggtg 60

tctt 64

<210> 7

<211> 68

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aaaattccct caggtggcgg ctaccggcga cggccctgat atcattttct gggcacatga 60

tcgttttg 68

<210> 8

<211> 67

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aacgccttat ccggcgtgat ttctgccagc aggccagact gcgcgtaacc gccaaaacga 60

tcatgtg 67

<210> 9

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gccggataag gcgttccagg acaaactgta cccttttacc tgggacgcgg tgcgttacaa 60

cggcaa 66

<210> 10

<211> 67

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cttattgtag atcagggaca gagcttccac tgcgatcggg taagcgatca gtttgccgtt 60

gtaacgc 67

<210> 11

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctgatctaca ataaggacct gctgccgaac ccgcctaaaa cgtgggaaga aatcccggcc 60

ctggacaaa 69

<210> 12

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cggttcctgc agattgaaca tcagagcgct cttacctttt gctttcagtt ctttgtccag 60

ggccgg 66

<210> 13

<211> 67

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

aatctgcagg aaccgtactt cacttggccg ctgatcgcag ctgacggcgg ttatgcgttt 60

aaatacg 67

<210> 14

<211> 68

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tttggcgccg gcgttatcaa cgccgacgtc cttaatgtca tatttaccgt tttcgtattt 60

aaacgcat 68

<210> 15

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

aacgccggcg ccaaagcggg cctgaccttt ctggtcgacc tgatcaaaaa caaacacatg 60

aacgct 66

<210> 16

<211> 65

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gcggtctcgc ccttgttaaa agccgcctcc gcaatagaat aatcggtgtc agcgttcatg 60

tgttt 65

<210> 17

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

caagggcgag accgcaatga ccatcaacgg tccgtgggct tggtctaaca tcgacacctc 60

caa 63

<210> 18

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ttgctcggtt gacctttgaa ggtcggcagg acggtaacac cgtaatttac tttggaggtg 60

tcgatg 66

<210> 19

<211> 67

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

aggtcaaccg agcaaaccgt tcgtgggcgt gctgtccgca ggtatcaacg ctgcctcccc 60

aaacaaa 67

<210> 20

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ccttcgtcgg tcagcagata gttttccagg aactctttgg ccagctcttt gtttggggag 60

gc 62

<210> 21

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gctgaccgac gaaggcctgg aagctgttaa taaagacaaa ccgctgggtg ctgttgcact 60

gaaa 64

<210> 22

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ctccatagtg gcggcaatac gcggatcttt gaccagttct tcttcatagg atttcagtgc 60

aacagc 66

<210> 23

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

gccgccacta tggagaacgc gcagaaaggt gaaatcatgc cgaacatccc gcaaatgtcc 60

gc 62

<210> 24

<211> 67

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ctgacgaccg gacgccgcgt taattacagc ggtacgcacc gcgtaccaaa aagcggacat 60

ttgcggg 67

<210> 25

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gcgtccggtc gtcagactgt cgatgaagcg ctgaaagatg ctcagactaa ctctagctct 60

aaca 64

<210> 26

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

gagatgcgac cttcaatacc cagattgttg ttgttgttat tattgttatt gttagagcta 60

gagt 64

<210> 27

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

tgaaggtcgc atctctggcg ttactagcgc accggatacc cgtccggcac cgggctctac 60

cgct 64

<210> 28

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

cggagcggaa gtaacaccgt gagcaggcgg agcggtagag cccgg 45

<210> 29

<211> 86

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

tgttacttcc gctccggaca cccgtccagc gccaggttcc accgcaccgc cggcacacgg 60

cgttacctcc gctccagata ctcgcc 86

<210> 30

<211> 71

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

agtatccggc gcagacgtga cgccgtgcgc tggcggtgca gtagaacccg gtgccgggcg 60

agtatctgga g 71

<210> 31

<211> 89

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

tctgcgccgg atactcgtcc agcgccgggt tccactgcac cgccggcaca cggcgttact 60

tctgcaccgg atacgcgtcc aagtcttcc 89

<210> 32

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

ggcctctgca gtcgacgggc ccggggaaga cttggacgc 39

<210> 33

<211> 60

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

ccaatggtct cagtccggct ccaggttcta ctgccccgcc ggcacatggc gttacctctg 60

<210> 34

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

cgtgcgccgg aggagcggtg ctgcctggtg cagggcgagt gtccggggca gaggtaacgc 60

cat 63

<210> 35

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

ctcctccggc gcacggtgtc acttctgctc cagacaccc 39

<210> 36

<211> 84

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

ggccgcaagc ttgtcgacgg agctcgaatt ctcagtgcgc cggcggggcg gtgctgcccg 60

gagccggacg ggtgtctgga gcag 84

<210> 37

<211> 1601

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

ccatggataa aatcgaagaa ggcaaactgg tgatctggat caacggtgat aagggttata 60

acggtctggc ggaagtaggc aagaaattcg aaaaagacac cggtatcaaa gttaccgttg 120

aacatccaga caaactggaa gaaaaattcc ctcaggtggc ggctaccggc gacggccctg 180

atatcatttt ctgggcacat gatcgttttg gcggttacgc gcagtctggc ctgctggcag 240

aaatcacgcc ggataaggcg ttccaggaca aactgtaccc ttttacctgg gacgcggtgc 300

gttacaacgg caaactgatc gcttacccga tcgcagtgga agctctgtcc ctgatctaca 360

ataaggacct gctgccgaac ccgcctaaaa cgtgggaaga aatcccggcc ctggacaaag 420

aactgaaagc aaaaggtaag agcgctctga tgttcaatct gcaggaaccg tacttcactt 480

ggccgctgat cgcagctgac ggcggttatg cgtttaaata cgaaaacggt aaatatgaca 540

ttaaggacgt cggcgttgat aacgccggcg ccaaagcggg cctgaccttt ctggtcgacc 600

tgatcaaaaa caaacacatg aacgctgaca ccgattattc tattgcggag gcggctttta 660

acaagggcga gaccgcaatg accatcaacg gtccgtgggc ttggtctaac atcgacacct 720

ccaaagtaaa ttacggtgtt accgtcctgc cgaccttcaa aggtcaaccg agcaaaccgt 780

tcgtgggcgt gctgtccgca ggtatcaacg ctgcctcccc aaacaaagag ctggccaaag 840

agttcctgga aaactatctg ctgaccgacg aaggcctgga agctgttaat aaagacaaac 900

cgctgggtgc tgttgcactg aaatcctatg aagaagaact ggtcaaagat ccgcgtattg 960

ccgccactat ggagaacgcg cagaaaggtg aaatcatgcc gaacatcccg caaatgtccg 1020

ctttttggta cgcggtgcgt accgctgtaa ttaacgcggc gtccggtcgt cagactgtcg 1080

atgaagcgct gaaagatgct cagactaact ctagctctaa caataacaat aataacaaca 1140

acaacaatct gggtattgaa ggtcgcatct ctggcgttac tagcgcaccg gatacccgtc 1200

cggcaccggg ctctaccgct ccgcctgctc acggtgttac ttccgctccg gacacccgtc 1260

cagcgccagg ttccaccgca ccgccggcac acggcgttac ctccgctcca gatactcgcc 1320

cggcaccggg ttctactgca ccgccagcgc acggcgtcac gtctgcgccg gatactcgtc 1380

cagcgccggg ttccactgca ccgccggcac acggcgttac ttctgcaccg gatacgcgtc 1440

cggctccagg ttctactgcc ccgccggcac atggcgttac ctctgccccg gacactcgcc 1500

ctgcaccagg cagcaccgct cctccggcgc acggtgtcac ttctgctcca gacacccgtc 1560

cggctccggg cagcaccgcc ccgccggcgc actgagaatt c 1601

<210> 38

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

ctcctcgctg cccagccggc gatggccatg gataaaatcg aagaaggcaa actggtg 57

<210> 39

<211> 84

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

ggccgcaagc ttgtcgacgg agctcgaatt ctcagtgcgc cggcggggcg gtgctgcccg 60

gagccggacg ggtgtctgga gcag 84

Claims

1. The MNR2 protein purification process is characterized in that the MNR2 protein is MNR2 protein with an MBP label, and the nucleotide sequence of a gene for coding the MNR2 protein with the MBP label is shown as SEQ ID NO. 37;

2. The process for purifying MNR2 protein according to claim 1, wherein the process for purifying MNR2 protein specifically comprises the following steps:

1) carrying out fermentation and induction expression on escherichia coli genetic engineering bacteria for expressing the target protein MNR2, and centrifuging the escherichia coli bacterial liquid after fermentation induction to obtain bacterial sludge;

4) sample dilution: diluting the sample eluted by the MBP affinity chromatography in the step 3) by 2.5 times by using a low-salt buffer, namely, the volume ratio of the sample to the low-salt buffer is 1: 1.5; preparing 5% high-low salt buffer at the same time, namely uniformly mixing 5 parts of high-salt buffer and 95 parts of low-salt buffer for later use;

6) column washing and balancing: regulating the flow rate to 2.0-10mL/min according to chromatographic columns with different specifications; washing the column with 5-10 times of ultrapure water, washing the column with 3-5 times of 0.5M sodium hydroxide or 2M sodium chloride, washing the column with 5-10 times of ultrapure water, balancing the column with 3-5 times of 5% high-low salt buffer, and UV₂₈₀After the value is stable, calibrating to be 0;

7) sampling and removing impurities: loading the diluted sample obtained in the step 4), and adjusting the flow rate to 2.0-10mL/min according to chromatographic columns with different specifications; after the sample loading is finished, washing impurities by using 5 percent high-low salt buffer with the volume of 3-5 times of the column volume;

8) protein elution and collection: firstly dismantling a capto Q impromes column, then carrying out protein elution on the capto adhere column, setting the elution gradient to be 20-25% high-low salt gradient elution, and collecting the eluent as UV₂₈₀The UV absorbance rose to 100. + -. 50mAU and collection commenced, followed by UV₂₈₀The value reached the highest and then dropped to 100. + -. 50mAU to stop collection, which is the purified final feed.

3. The process for purifying MNR2 protein according to claim 2, wherein the specific steps in the step 2) are as follows: re-suspending the bacterial sludge with lysine buffer of 5-10 times volume, crushing for 2-3 times with homogenizer of 700-800bar, centrifuging the crushed liquid at 25000rpm for 30 min, removing crushed bacterial dregs, collecting supernatant, and sterilizing with 0.22um or 0.45um filter membrane.

4. The MNR2 protein purification process according to claim 3, wherein, in the step 2), the Lysis buffer comprises the following components: 20mM Tris-HCl, 0.2M NaCl, 1mM EDTA, buffer pH 7.40. + -. 0.05/25 ℃.

5. The MNR2 protein purification process as claimed in claim 2, wherein, in the step 3), the specific steps of MBP affinity chromatography are as follows: washing the column with ultrapure water in 3-5 times of column volume, balancing wash buffer in 3-5 times of column volume, and performing UV₂₈₀After the calibration is 0, loading the filtrate obtained in the step 2) on an MBP affinity chromatographic column, washing impurities by using wash buffer with the volume 3-5 times of the column volume after the loading is finished, and removing the impure protein which is not firmly combined with the MBP medium; then eluting the target protein MNR2 by using Elute buffer, and carrying out UV₂₈₀The collection range was 100. + -. 50 mAu-max-100. + -. 50 mAu.

6. The MNR2 protein purification process according to claim 5, wherein in the step 3), the wash buffer and the lysine buffer have the same components as follows: 20mM Tris-HCl, 0.2M NaCl, 1mM EDTA, buffer pH 7.40. + -. 0.05/25 ℃; the Elute buffer composition is as follows: 20mM Tris-HCl, 0.2M NaCl, 1mM EDTA, 10mM maltose, buffer pH 7.40. + -. 0.05/25 ℃.

7. The MNR2 protein purification process according to claim 2, wherein in the step 4), the step 6), the step 7) and the step 8),

the low-salt buffer comprises 20-40mM Tris-HCl or phosphate, 1-2mM EDTA, and has pH of 6.50-8.50/25 deg.C;

the high-salt buffer comprises 20-40mM Tris-HCl or phosphate, 1-2mM EDTA, 1M NaCl and has a pH of 6.50-8.50/25 ℃.

8. The MNR2 protein purification process of claim 7, wherein in the step 4), the step 6), the step 7) and the step 8),

high salt buffer, 20mM Tris-HCl, 1mM EDTA, 1M NaCl, pH7.0/25 ℃.

9. The MNR2 protein purification process according to claim 2, wherein in the step 5), the serial connection mode is direct insertion connection, external screw joint connection at two ends of AKTA 1/16, or internal screw joint connection at two ends of AKTA 1/16.

10. The process for purifying MNR2 protein according to claim 2, wherein said step 8) is followed by step 9) column washing and storage: after the elution is finished, the capto Q Impres column and the capto adhere column are connected in series again, the column is washed by 2M sodium chloride with the column volume of 3-5 times, then the column is washed by ultrapure water with the column volume of 3-5 times until the conductivity value is almost 0, and then the column is washed by 20% ethanol with the column volume of 3-5 times; the two chromatographic columns are disassembled and respectively and properly stored.