CN114316052B - Bispecific antibody for resisting CD3 and CA125 antigens - Google Patents

Abstract

The invention discloses a nanometer antibody of an anti-CD 3 antigen and a bispecific antibody containing two VHH domains. The anti-CD 3 antigen nanobody has unique 3 complementarity determining regions CDR1, CDR2, CDR3. The bispecific antibody is formed by fusing two different heavy chain sequences, and can respectively recognize a CD3 antigen and a CA125 antigen on the surface of a T cell. And the bispecific antibody can obviously enhance the activity of the T cell for killing tumor target cells mediated by the antibody.

Description

Bispecific antibody for resisting CD3 and CA125 antigens

Technical Field

The invention discloses a polypeptide, in particular an antibody, and belongs to the field of immunology.

Background

CA125 (Cancer Antigen 125) ovarian Cancer-associated Antigen was found in 1981 to be an ovarian epithelial carcinoid-associated Antigen. Is secreted by embryo epithelial cells, is not secreted or seldom secreted under normal conditions, but when the ovary is subjected to malignant lesions, the CA125 value is increased even if the malignant lesions are clinically not represented or are difficult to identify, so that the method is a good diagnostic and screening index of ovarian cancer and has close relation with metastasis and prognosis of the ovarian cancer. CA125 was initially an immunogen from Bast et al via the ovarian cell line OVCA433, mediating the murine monoclonal antibody OC125 response, which in turn recognized and confirmed its presence. The CA125 antigen is glycoprotein with the relative molecular mass of 200 ku, has two states of membrane binding and free, and is one of the most comprehensive ovarian cancer serum markers studied so far. CA125 concentrations in serum of 90% of patients with advanced ovarian cancer all exhibited varying degrees of elevation.

Although surgery or chemotherapy is the preferred method for patients with ovarian cancer, the prognosis is still not very ideal. Tumor recurrence, particularly intraperitoneal recurrence, and chemotherapy resistance are often important factors affecting prognosis. At present, new therapeutic regimens for ovarian cancer, particularly biotherapeutic techniques, are rapidly developing and have been partially applied in ex vivo and in vivo research and clinical trials. Ovarian cancer biotherapy includes cytokines, monoclonal antibodies, transgene therapies, and the like. Among the many approaches, ovarian cancer associated antigen CA125 monoclonal antibody therapy is of great interest. Current technology for treating ovarian cancer with CA125 monoclonal antibodies includes two types, antigen-antibody complex mediated human immune response and targeted induction of radioactive elements and antitumor drugs. The antigen-antibody complex mediated immunity is based on exciting endogenous antitumor reaction of organism to reach the aim of eliminating focus and self-repairing regulation. The most representative antibodies used in this technology are anti-CA 125/anti-T cell surface molecule bispecific antibody (BsAb) and murine monoclonal antibody B43.13. The bispecific antibody of the anti-CA 125/anti-T cell surface molecule can induce T cells by combining with the CA125 antigen on the surface of ovarian cancer cells, and then the epitope recognition of the anti-T cell surface molecule can generate the cytotoxic effect of the T cells on tumor tissues so as to kill the focus. In addition, the therapy can stimulate the body to generate and maintain an active immune state for a longer time. At present, although anti-CA 125/anti-T cell surface molecule BsAb shows excellent therapeutic effect, more problems still need to be solved, such as the detailed in vivo pharmacokinetic characteristics are not clear; the preparation process has low humanization level and obvious toxic and side effects; bsAb, tumor and T lymphocyte specificity and affinity are all further improved; the function of the Fc fragment of the antibody still needs to be improved; the antibody has low tumor tissue permeability, thereby bringing the technical problems of weak tumor localization and higher non-target clearance rate in vivo. Murine monoclonal antibody B43.13 initiates a classical idiotype immune response by binding to the CA125 antigen to form an immune complex. The mechanism of action is that anti-murine antibodies of human origin activate an anti-idiotype chain reaction, which in turn elicits a polyclonal antibody humoral immune response against CA 125. The immune response therapy has good tolerance, has no adverse reaction or non-compliance and other medication suspension conditions, but can not always keep the sensitive response state of the human body to tumor cells, and can not overcome the tumor immune escape mechanism. The targeting induction technology of radioactive elements and antitumor drugs is another CA125 monoclonal antibody treatment technology. Residual cancer cells remain implanted intraperitoneally after the ovarian cancer tumor cell debulking operation. In general, such seeded cells or clusters of cells are not readily found clinically, and have high chemotherapy resistance, but are quite fragile under radioimmunoassay. Based on this feature, the development of radioimmunotherapy for ovarian cancer is rapid. The current radioimmunotherapy mainly selects a murine monoclonal antibody containing an anti-CA 125 epitope, and targets positioning and radiotherapy after isotope labeling. Multiple experiments demonstrated that the affinity of the CA125 monoclonal antibody for its antigen was not diminished after radiolabeling. However, the conventional monoclonal antibody direct radiolabeling method has many defects, and especially has poor curative effects on the accumulation of radiation toxicity and solid tumors in reticuloendothelial system. Reticuloendothelial system accumulation greatly weakens the targeting localization rate of the isotope labeled antibody. The poor radioimmunoassay of solid tumors is generally attributed to tumor tissue uptake concentrations below optimal radiotherapy concentration, low plasma clearance, bone marrow toxicity, and the like.

Based on the outstanding characteristics of CA125 in clinical diagnosis and the huge application prospect in the tumor treatment field, developing specific binding antibodies aiming at CA125 has become urgent need of the prior art for improving clinical diagnosis and treatment efficiency. However, based on some disadvantages of conventional antibodies, such as low affinity, low immune recognition efficiency, it is difficult to achieve the desired binding and neutralization effect for some antigens with high degree of masking. Bispecific antibodies are an antibody technology developed in recent years that can recognize 2 different antigens simultaneously. By using the bispecific antibody, the bispecific antibody can be developed for tumor cells and T cells, and can recognize tumor cell antigens, induce ADCC effect, recognize effector T cells, guide the T cells to the vicinity of the tumor cells, and strengthen the killing effect of the effector T cells on the tumor cells, such as CA125 antigen and CD3 antigen of the T cells.

In 1993, hamers-Casterman et al have found that a class of heavy chain-only dimers (H) are found in vivo in camelids (camels, dromedaries and llamas) ₂ ) Such antibodies, which are predominantly of the IgG2 and IgG3 type, are referred to as heavy chain-only antibodies (Heavy chain only like Antibody, HCAbs) due to the lack of light chains, whereas their antigen binding site consists of one domain, referred to as the VHH region, and are therefore also referred to as single domain antibodies or single domain antibodies (sdabs). Since this type of antibody is a variable region sequence with the constant region removed, the molecular weight is only 15kDa, and the diameter is about 10 nanometers, and thus is also called nanobody (Nbs). In addition, such single domain antibodies, known as VNARs, are also observed in sharks. Such heavy chain-only antibodies were originally recognized as only one of the pathological forms of human B cell proliferative diseases (heavy chain disease). Such heavy chain-only antibodies may be due to mutations and deletions at the genomic level that result in the inability of the heavy chain CH1 domain to be expressed, such that the expressed heavy chain lacks CH1 and thus lacks the ability to bind to the light chain, thus forming a heavy chain dimer.

Nanobodies are comparable in affinity to their corresponding scFv relative to conventional four-chain antibodies, but exceed scFv in terms of solubility, stability, resistance to aggregation, refolding, expression yield, and ease of DNA manipulation, library construction, and 3-D structure determination.

Nanobodies have a minimal functional antigen binding fragment derived from HCAbs in adult camels, have high stability and high affinity for antigen binding, and can interact with protein clefts and enzyme active sites to act like inhibitors. Therefore, nanobodies can provide a new idea for designing small molecule enzyme inhibitors from peptide mimetic drugs. Because of the heavy chain only, nanobodies are easier to manufacture than monoclonal antibodies. The unique properties of nanobodies, such as stability in extreme temperature and pH environments, can be manufactured in large yields at low cost. Therefore, the nano antibody has great value in the treatment and diagnosis of diseases and has great development prospect in the antibody targeting diagnosis and treatment of tumors.

Based on the problems that a single recognition site or a traditional antibody molecule is difficult to reach a functional cell and the like in the prior art in the field of tumor treatment, the invention aims to provide a bispecific nanometer antibody for tumor cells and T cells, which can recognize a CA125 antigen of the cancer cells, induce ADCC effect, recognize a CD3 antigen of the effector T cells, guide the T cells to the vicinity of the tumor cells and strengthen the killing effect of the effector T cells on the tumor cells. And can overcome the inherent defects of poor permeability, low targeting effect and the like of the traditional antibody solid tumor.

Disclosure of Invention

Based on the above objects, the present invention provides a nanobody against T cell surface antigen CD3, wherein the variable region of the nanobody has 3 complementarity determining regions CDR1, CDR2, and CDR3, wherein the CDR1 sequence consists of the amino acid sequence set forth in SEQ ID No.1, the CDR2 sequence consists of the amino acid sequence set forth in SEQ ID No.2, and the CDR3 sequence consists of the amino acid sequence set forth in SEQ ID No. 3.

In a preferred embodiment, the variable region sequence of the nanobody consists of the amino acid sequence depicted in SEQ ID NO. 4. A preferred embodiment of the nanobody having the variable region sequence in the present invention is nanobody 7A5.

The invention further provides a nucleic acid for encoding the nano antibody, and the sequence of the nucleic acid is shown as SEQ ID NO. 5.

Third, the present invention provides an expression vector comprising the above nucleic acid, which is pMES4.

Fourth, the present invention provides a host cell containing the above expression vector, which is E.coli BL21 (DE 3).

Fifth, the present invention also provides a bispecific nanobody comprising a first heavy chain and a second heavy chain, wherein the variable region of the first heavy chain recognizes CD3 antigen, the variable region sequence of which consists of the amino acid sequence of SEQ ID No. 4; the variable region of the second heavy chain recognizes CA125 antigen, and the variable region sequence thereof consists of the amino acid sequence shown in SEQ ID NO. 6.

In a preferred embodiment, a connecting peptide is provided between the first heavy chain and the second heavy chain, wherein the connecting peptide is (G ₄ S） _n Wherein n is an integer between 1 and 6.

More preferably, the amino acid sequence of the bispecific antibody is as shown in SEQ ID No.7, n=4.

It is particularly preferred that the bispecific antibody further has an antibody constant region at the carboxy terminus, the constant region sequence of which is shown in the amino acid sequence of SEQ ID NO. 8.

Sixth, the present invention also provides a nucleic acid encoding the above bispecific antibody, the sequence of which is shown in SEQ ID NO. 9.

Seventh, the present invention also provides a nucleic acid encoding the above bispecific antibody with constant region, the coding sequence is shown in SEQ ID NO. 10.

Eighth, the invention provides an expression vector containing the nucleic acid, wherein the expression vector is pFUSE hIgG1-Fc2.

Ninth, the invention provides a host cell containing the expression vector, wherein the host cell is HEK293 cell.

Finally, the invention also provides application of the nano antibody for resisting the T cell surface antigen CD3 in preparing tumor therapeutic medicaments.

The anti-CD 3 nano antibody provided by the invention has higher affinity, and the bispecific nano antibody can respectively recognize the CA125 antigen and the CD3 antigen on the surface of the T cell. In an ADCC cytotoxicity experiment aiming at OVCAR-3, the bispecific antibody provided by the invention shows excellent cytotoxicity, obviously enhances the activity of killing tumor target cells by T cells mediated by the antibody, and has a killing rate up to 75%, which is higher than that of the combined application of a CA125 antibody and a CD3 antibody, and is more obviously higher than that of the single application of the two antibodies. Compared with the single nano antibody, the bispecific antibody provided by the invention has longer in vivo half-life, which shows the application value of the bispecific antibody in the clinical treatment of CA125 antigen positive tumors and the field of medicine preparation.

Drawings

FIG. 1 is a diagram showing the electrophoretically identified total RNA extracted;

FIG. 2 shows a first round of PCR amplified antibody variable region gene electrophoresis identification;

FIG. 3 shows a second round of PCR amplified antibody variable region gene electrophoresis identification;

FIG. 4 shows an electrophoretically identified map of pMES4 vector double cleavage reaction products;

FIG. 5 shows an electrophoretically identified map of colony PCR identified transformants;

FIG. 6 shows SDS-PAGE of nanobody 7A5 purification;

FIG. 7 shows a graph of Biacore analysis nanobody 7A5 affinity;

FIG. 8 shows a SDS-PAGE of bispecific antibody purification;

FIG. 9 shows the results of ADCC cytotoxicity test;

FIG. 10 is a graph of the metabolism of bispecific antibodies versus nanobodies in rabbits.

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. These examples are only exemplary and do not limit the scope of the invention in any way, which is defined by the claims.

Example 1 preparation of anti-CD 3 monovalent nanobodies.

1.1 immunization of alpaca

One healthy adult alpaca is selected, the recombinant human CD3 antigen (manufacturer: abcam, product number ab 229518) and Freund's adjuvant are uniformly mixed according to the proportion of 1:1, 6-7 mug/kg is used for immunizing the alpaca by adopting a back subcutaneous multipoint injection mode, and the immunization is performed four times, and the immunization interval is 2 weeks. Then, 10ml of alpaca peripheral blood was collected and used to construct phage display library.

1.2 separation of camel-derived lymphocytes

The collected alpaca peripheral blood was subjected to lymphocyte separation every 2.5X10 by using the camel peripheral blood lymphocyte separation liquid kit (Tianjin line ocean company, cat# LTS 1076) in the instruction manual ⁷ 1ml of RNA isolation reagent was added to each living cell, 1ml was extracted from the cells, and the rest was stored at-80 ℃.

1.3 Total RNA extraction

Repeatedly blowing 1ml Tipure Isolation Reagent containing lymphocyte, and standing for 5 min; 200 μl chloroform was added and left to stand for an additional 5 minutes after vortexing for 30 seconds; centrifuging at 4 ℃ for 15 minutes at 12000g, sucking the aqueous phase and transferring the aqueous phase into a new EP tube; adding equal amount of isopropanol, and standing for 10 minutes; centrifuging at 4 ℃ for 10 minutes at 12000g, and discarding the supernatant; washing with 1ml of precooled 70% ethanol, centrifuging at 4 ℃ and 7500g for 5 minutes, discarding the supernatant and drying for 5 minutes; the pellet was dissolved by adding 30. Mu.l RNase-free water, and the concentration was adjusted to 1. Mu.g/. Mu.l for detection by gel electrophoresis (FIG. 1:M is Trans 2K DNA marker;1 is RNA).

1.4 reverse transcription to cDNA

Reverse transcription of cDNA was performed using the RNA obtained in step 1.3 as a template according to the reverse transcription kit (transcripor first stand cDNA synthesis KIT of Roche Co.).

1.5 antibody variable region Gene amplification

The cDNA obtained by reverse transcription was used as a template for PCR reaction. Amplification was performed in two rounds, and the primer sequences for the first round of PCR were as follows:

CALL001：GTCCTGGCTGCTCTTCTACAAGG；

CALL002：GGTACGTGCTGTTGAACTGTTCC。

the PCR reaction conditions and procedures were: 95 ℃ for 5 minutes; 95℃for 30 seconds, 57℃for 30 seconds, 72℃for 30 seconds, 30 cycles; 7 minutes at 72 ℃. The band of about 700bp was recovered using agarose gel recovery kit gel, and finally the nucleic acid concentration was adjusted to 5 ng/. Mu.l with water (FIG. 2:M is Trans 2K DNA marker;1 is negative control; 2 is first round PCR product). The primer sequences for the second round of PCR were as follows:

VHH-Back：GATGTGCAGCTGCAGGAGTCTGGRGGAGG；

VHH-For：CTAGTGCGGCCGCTGGAGACGGTGACCTGGGT。

the PCR reaction conditions and procedures were: 95 ℃ for 5 minutes; 95℃for 30 seconds, 55℃for 30 seconds, 72℃for 30 seconds, 15 cycles; 7 minutes at 72 ℃. The PCR products were purified using a PCR product recovery kit (FIG. 3:M is Trans 2K DNA marker;1 is the second round PCR product; 2 is the negative control).

1.6 vector construction

pMES4 (from Biovector) was digested with PstI and BstEII, respectively, and 1.5. Mu.g of the digested vector and 450ng of the digested secondary PCR product were taken, 15. Mu. l T4 DNA ligase was added thereto, and the buffer solution and water were supplemented to a total volume of 150. Mu.l, and the ligation products were recovered at 16℃overnight. The PCR product recovery kit was used for product recovery, eluting with 20. Mu.l water. The double digestion result of the pMES4 vector was detected by 1% agarose electrophoresis gel (FIG. 4:M shows that Trans 5K plus DNA Marker;1 shows that the pMES4 vector is not digested with plasmid, and 2 shows that the pMES4 vector is double digested with plasmid).

1.7 electric conversion and storage Capacity determination

10. Mu.l of the purified ligation product was added to a pre-chilled electrocuvette containing 50. Mu.l of E.coli TG1 competent cells, and electrotransformation was performed using an electrotransformation apparatus (ECM 630 electrotransformation apparatus of BTX, USA), the electrocuvette was removed, and the transformants were resuscitated and cultured. Clones were randomly picked and colony PCR identified (FIG. 5:M is Trans 2K DNA marker;1 is negative control; 2-11 is randomly picked monoclonal PCR identified products). The stock capacity was estimated from the PCR positive rate (stock capacity = number of clones x dilution x PCR identification positive rate x 10). The primer sequences were as follows:

MP57：TTATGCTTCCGGCTCGTATG；

GIII：CCACAGACAGCCCTCATAG。

1.8 phage amplification

Inoculating the resuscitated bacterial solution into YT-AG culture medium, and culturing at 37deg.C and 200rpm until the culture OD ₆₀₀ =0.5. 10ml of the bacterial liquid is taken out and added with 4 multiplied by 10 ¹⁰ VCSM13, resting at 37 ℃ for 30 min. Centrifugation at 4000rpm for 10min at normal temperature and removal of supernatant. The cells were resuspended in 2 XYT-AK (ampicillin and kanamycin) medium and incubated overnight at 37℃at 200 rpm. The supernatant was centrifuged in a 40ml tube, 10ml of PEG/NaCl (20%/2.5M) solution was added and thoroughly mixed, the supernatant was discarded by centrifugation, the pellet was washed with 1ml of ice PBS and centrifuged, 250. Mu.l of pre-chilled PEG/NaCl was taken, thoroughly mixed and washed for resuspension.

Phage titer was determined: culturing TG1 to OD ₆₀₀ Phage were diluted in gradient with LB medium, mixed with phage TG1 culture diluted in a double ratio, observed for plaque formation in the plate the next day, counted on dilution gradient plates with plaque numbers ranging from 30 to 300 and phage titer (pfu) was calculated according to the following formula.

Phage titer (pfu/ml) =dilution x number of plaques x 100.

1.9 nanobody screening

Positive clones were screened for antigen by ELISA method. ELISA plates were coated with antigen, blocked with 5% BSA, and washed with PBST. Mu.l phage supernatant was added to each well and left at 37℃for 1 hour. The supernatant was discarded, and HRP-labeled secondary antibody against M13 was added and left at 37 ℃ for 1 hour. The supernatant was discarded, TMB solution was added, incubated at room temperature for 5 hours, 2M sulfuric acid stop solution was added to each well, and the wells were read with a microplate reader at 450 nm.

Expression and purification of 1.10 nanobody in E.coli

Selecting clones positive to the ELISA result of phage, extracting plasmids and transforming the plasmids into competent cells of the strain BL21, inducing nanobody protein expression by IPTG, collecting supernatant (periplasm extract), dialyzing the periplasm extract to PBS, purifying by using Ni-NTA resin, eluting and collecting by using imidazole with different concentrations, subjecting the collected samples to reduced protein electrophoresis analysis, and finally dialyzing the nanobody to PBS.

The anti-CD 3 nanobody is screened out through alpaca immunity, cell separation, phage library construction and nanobody screening. Analysis of antibody light and heavy chain genes was performed on the sequencing results using Vector NTI software to determine the framework regions (Framework Regions, FR) and complementarity determining regions (Complementary Determining Regions, CDR) of the variable regions.

The nanobody of one preferred embodiment selected by the present invention is designated as "7A5". Through DNA sequencing, the heavy chain nucleic acid sequence of the nano antibody 7A5 is shown as SEQ ID NO.5, the amino acid sequence of the variable region is shown as SEQ ID NO.4, wherein the amino acid sequence of the 1 st to 25 th positions is FR1, the amino acid sequence of the 26 th to 33 th positions is CDR1, the amino acid sequence of the 34 th to 50 th positions is FR2, the amino acid sequence of the 51 th to 58 th positions is CDR2, the amino acid sequence of the 59 th to 96 th positions is FR3, the amino acid sequence of the 97 th to 113 th positions is CDR3, and the amino acid sequence of the 114 th to 124 th positions is FR4.

Example 2 preparation of nanobody 7A5.

2.1 nanobody original Strain TG1 amplification and nanobody recombinant plasmid transformation E.coli BL21 (DE 3)

The original strain TG1 glyceromycetes containing nanobody nucleic acid are inoculated in 5ml of fresh LB-A medium according to the proportion of 1:1000, and cultured overnight at 37 ℃ at 200 rpm. The following day, plasmids were extracted using the Plasmid mini kit (OMEGA) according to the instructions. After verification, 1. Mu.l of the above plasmid was transformed into 100. Mu.l of competent cells, gently mixed, placed on ice for 30 minutes, heat-shocked in a 42℃water bath for 90 seconds, and cooled in an ice bath for 3 minutes. 600 μl LB medium was added to the centrifuge tube and incubated with shaking at 37deg.C for 60 minutes. 100 μl of the supernatant was spread on LB-A plates with ase:Sub>A triangular spreader and incubated overnight at 37deg.C with inversion.

2.2 Induction of expression of nanobodies

The above monoclonal colonies were picked up in LB-A medium and cultured overnight at 37℃with shaking. The next day, 100ml of fresh LB-A culture medium is added into the bacterial liquid according to the proportion of 1:100, and the bacterial liquid is cultured for 3 hours at 37 ℃ in ase:Sub>A shaking way until the bacterial liquid OD ₆₀₀ About=0.8, 1mm iptg was added to the final concentration and induced overnight at 30 ℃. On the third day, 8000rpm, the cells were collected by centrifugation for 10 minutes, and 1.5ml of pre-chilled TES buffer was added to resuspend the pellet. IceAfter 2 minutes of bathing, the cycle was repeated 6 times with gentle shaking for 30 seconds. 3.0ml TES/4 (4-fold dilution of TES with water) was added, and after gentle shaking for 30 seconds, the ice bath was allowed to stand for 2 minutes, and the shaking and standing steps were repeated 6 times as much. Centrifugation was performed at 9000rpm at 4℃for 10 minutes, and about 4.5ml of the supernatant (periplasmic extract) was collected.

2.3 purification and identification of nanobodies

After the IMAC Sepharose (GE company) was resuspended, 2ml was added to the gravity column, and allowed to stand for 30 minutes to allow the Sepharose to naturally settle to the bottom of the gravity column and the preservation buffer was drained. 2 column volumes of nickel sulfate solution (0.1M) were added and the nickel sulfate solution was tapped at a flow rate of about 8 seconds/drop; adding 10 times of column volume of balance buffer to balance and wash sepharose, and keeping the flow rate unchanged; diluting a sample with a balancing buffer solution for 2 times, adding the diluted sample into a gravity column, regulating the flow rate to 6 seconds/drop, and collecting penetrating fluid; adding a washing buffer solution with a volume of 10 times of the column volume to wash sepharose, maintaining the flow rate unchanged, and collecting washing solution; adding an elution buffer solution with the volume of 3 times of the column, maintaining the flow rate at 6 seconds/drop, and collecting the elution solution containing the target protein; finally, 10 times of column volume of equilibration buffer, 10 times of column volume of pure water and 10 times of column volume of 20% ethanol are sequentially added to wash sepharose, and finally 4ml of 20% ethanol is reserved to preserve the column. The collected samples were subjected to SDS-PAGE detection (FIG. 6: M is rainbow 180 broad-spectrum protein Marker;1 is E.coli induced expression purified nanobody 7A 5).

Example 3. Determination of affinity Activity of nanobodies with antigens.

3.1 chip antigen coupling

The antigen is prepared into 20 mug/ml working solution by using sodium acetate buffer solutions with different pH values (pH 5.5, pH 5.0, pH 4.5 and pH 4.0), 50mM NaOH regenerating solution is prepared at the same time, the electrostatic combination between the antigen with different pH values and the surface of a chip (GE company) is analyzed by using a template method in a Biacore T100 protein interaction analysis system instrument, the signal increment amount reaches 5 times RL as a standard, and a proper most neutral pH system is selected and the antigen concentration is adjusted as required as the condition during coupling. The chip is coupled according to a template method in the instrument: wherein, the 1 channel selects a blank coupling mode, the 2 channel selects a Target coupling mode, and the Target is set as the designed theoretical coupling amount. The coupling process takes approximately 60 minutes.

3.2 analyte concentration setting Condition exploration and regeneration Condition optimization

And adopting a manual sample injection mode, selecting a1, 2-channel 2-1 mode sample injection mode, and setting the flow rate to be 30 mu l/min. The sample injection conditions were 120 seconds and 30. Mu.l/min. Regeneration conditions were 30 seconds, 30. Mu.l/min. First, running buffer was kept empty until all baselines were stable. Nanobody solutions with large concentration spans were prepared for running buffer configurations, suggesting that 200 μg/ml,150 μg/ml,100 μg/ml,50 μg/ml,20 μg/ml,10 μg/ml,2 μg/ml were set. Preparing a regeneration solution, and selecting four pH gradient regeneration solutions of a glutamic acid hydrochloric acid system: 1.5,2.0,2.5,3.0. Samples of 200 μg/ml analyte were manually injected and 2 channels were observed for regeneration from the most neutral pH regeneration buffer until the response line after 2 channel regeneration returned to the same height as baseline. And manually feeding an analyte sample once again by 200 mug/ml, observing the signal change of the 2-1 channel, recording the binding amount, recovering the analyte sample again by 200 mug/ml after regenerating the regeneration solution which returns the response line to the base line in the last step, observing the signal change of the 2-1 channel, recording the comparison between the binding amount and the value of the binding amount just before, and if the deviation is less than 5%, confirming that the regeneration solution with the pH value is the optimal regeneration solution, and if the binding amount of the reinjection is lower, continuing to perform experiments by using the regeneration buffer solution with the lower pH value. And taking the selected optimal regeneration solution as a chip surface regeneration reagent after each sample injection. The analyte concentration samples set forth above were separately sampled and the binding capacity for each concentration was analyzed to finally determine the concentration gradient required for the affinity test.

3.3 affinity test

According to the optimized sample concentration gradient, regenerating the solution, and testing the affinity between the nano antibody and the antigen by using a template method (wherein the sampling condition is set to be 60 seconds, 30 mu l/min, the dissociation time is 600 seconds, and the regeneration condition is 30 seconds, 30 mu l/min) carried out by the instrument. The signal condition of the 2-1 channel is observed at any time. The affinity test procedure takes approximately 200 minutes.

3.4 analysis of results

The binding dissociation curve for selecting the appropriate several concentration gradients was 1: the 1binding pattern fits all curves to finally obtain the affinity value and important parameters such as the binding constant and the dissociation constant (see FIG. 7). The affinity value of the anti-CD 3 nanobody 7A5 was 5.291E-10.

Example 4 preparation of bispecific nanobodies against CA125 and CD 3.

The pFUSE hIgG1-Fc2 vector (Qingdao Jieshikang organism, product number JR 442) expresses the Fc fragment of human IgG1, and the bispecific antibody with constant region can be obtained by connecting the bispecific antibody to the pFUSE hIgG1-Fc2. The specific operation is as follows: the amino acid sequence of the anti-CA 125 nanobody is referred to the amino acid sequence of nanobody 5D2 in Chinese patent No. CN 113512119A. Selecting anti-CA 125 nano antibody 5D2 and anti-CD 3 nano antibody 7A5 for protein fusion expression, and utilizing flexible polypeptide (GGGGS) in heavy chain variable regions of the two antibodies ₄ And after connection, the gene is sent to Huada gene company for gene synthesis. Two restriction enzyme sites of EcoRI and BglII are reserved at two ends of the synthesized gene and are connected to a pUC57 vector to obtain pUC57-5D2- (GGGGS) ₄ -7A5. The desired fragment of the fusion nanobody was excised using EcoRI and BglII and ligated by T4 ligase into the pFUSE hIgG1-Fc2 vector to construct the recombinant plasmid pFUSE hIgG1-Fc2-5D2- (GGGGS) ₄ 7A5, plasmid was extracted after transformation of DH 5. Alpha. Competence using endotoxin-free large extraction kit (Tiangen). Human 293 cells were transfected, bispecific nanobodies were purified from the culture supernatants of 293 cells using Protein A chromatography, and SDS-PAGE analysis was performed on the purified bispecific nanobodies (FIG. 8:1 for purified bispecific nanobodies; 2 for rainbow 180 broad-spectrum Protein Marker).

Example 5 ADCC cytotoxicity assay.

5.1 Leukocyte separation

2ml of venous blood is taken and put into a test tube with anticoagulant, and the mixture is gently mixed. Standing the test tube in room temperature or 37 deg.C incubator for 30-60min until the red blood cells are obtainedAnd (5) naturally settling. At this time, the suspension in the test tube is divided into 3 layers, the upper layer is faint yellow blood plasma, the bottom layer is red blood cells, and an off-white leukocyte layer (normal human peripheral blood leukocyte) is arranged on the layer which is clung to the red blood cells. The leukocyte-enriched cell suspension above the erythrocyte layer was aspirated with a capillary tube and transferred into another tube. Adding Ca-free ²⁺ 、Mg ²⁺ Hank's solution was mixed at a distance of 3cm from the mouth of the tube, centrifuged at 2000r/min for 10min in a horizontal centrifuge, and the supernatant was discarded and washed twice in the same manner. The precipitated cells are resuspended in an appropriate amount of 10% -20% of Hank's solution of inactivated calf serum, counted to prepare a suspension of the desired cell concentration, usually 2X 10 ⁶ /ml。

5.2 Culture of tumor cells

Culturing OVCAR-3 cells (human ovarian cancer cells purchased from ATCC) with high expression of CA125 in RPMI-1640 medium containing 10% fetal bovine serum to 75-80% density, discarding the medium, washing the cells with PBS preheated to 37deg.C for 2 times, adding 2ml trypsin-EDTA solution, standing at room temperature for 5min, adding 2ml medium containing 10% fetal bovine serum to terminate reaction, repeatedly blowing the cells into single cell suspension with a disposable sterile pipette, centrifuging at 2000r/min for 10min, discarding supernatant, washing with PBS twice again, and re-suspending the cells with medium to 2×10 after counting ⁶ The sample is ready for use.

5.3 Cytotoxicity test

10 μl (2×10) of resuspended tumor cells was taken ⁴ 30. Mu.l of RPMI-1640 medium containing 0.1% BSA was added, followed by 10. Mu.l (1 mg/ml) of each of the different antibodies, incubation at 37℃for 30min, and then 5X 10 ⁵ PMBC (effector/target = 25), volume 250 μl, incubation at 37 ℃ for 4h, centrifugation for 10min at 2000r/min with a horizontal centrifuge, detection of LDH activity in supernatant with Roche cytotoxicity detection kit to convert into tumor cell death degree, kit number: 11644793001. the results are shown in FIG. 9.

As shown in FIG. 9, the T cell killing rate on tumor target cells is shown on the ordinate, samples on the abscissa 1-6 are PMBC+OVCAR-3+bispecific antibody, PMBC+OVCAR-3+5D2-fc+7A5-fc, PMBC+OVCAR-3+5D2-fc, PMBC+OVCAR-3+7A5-fc, single PMBC and single OVCAR-3 cells in sequence (wherein the amino acid sequences of 5D2-fc and 7A5-fc are shown in SEQ ID NO.11, the nucleic acid sequence of 7A5-fc is shown in SEQ ID NO.12, the amino acid sequence of 7A5-fc is shown in SEQ ID NO.13, and the nucleic acid sequence is shown in SEQ ID NO. 14). The bispecific antibody provided by the invention is a column 1, which remarkably enhances the activity of the T cells mediated by the antibody in killing tumor target cells, shows excellent cytotoxicity, has a killing rate up to 75% (the killing rate of 6 samples on the abscissa is 75%, 44%, 39%, 15%, 2% and 3% in sequence), is higher than the combined application of the anti-CA 125 nanobody 5D2 and the anti-CD 3 nanobody 7A5, and is more remarkably higher than the single application of the two antibodies, so that the bispecific antibody disclosed by the invention has an application value in clinically treating tumors positive for CA125 antigens.

Example 6 metabolism of bispecific nanobodies in rabbit plasma.

In this example, the initial study of pharmacokinetics was performed on New Zealand rabbits, and every 6 New Zealand rabbits were taken as a group, and subcutaneous administration was performed on the back, with doses of 1nmol/kg for bispecific nanobody and anti-CA 125 nanobody 5D2 and anti-CD 3 nanobody 7A5. The blood is collected from the auricular veins at 0.5h, 1h, 2h, 4h, 8h, 12h, 18h, 24h, 36h, 48h, 60h, 72h, 84h, 96h, 120h and 144h after administration, serum is separated for measuring the antibody titer, and a time curve of the drug titer is drawn, and the result is shown in fig. 10.

The results show that the nanobody is basically metabolized after 72h, the nanobody is at a lower level, and the bispecific antibody still has a high concentration after 72h, thereby having a therapeutic effect. Pharmacokinetic parameters were analyzed using GraphPad Prism software and the results are shown in table 1.

TABLE 1 pharmacokinetic parameters in Rabbit of nanobody and bispecific antibody

。

In Table 1, t _max Refers to the time when the antibody titer reaches the maximum;t _1/2 refers to the time taken for the antibody to metabolize half way after reaching its maximum concentration. It can be seen from the table that the half-life of bispecific antibodies in New Zealand rabbits is up to 36 hours, significantly longer than 24 hours for nanobodies.

Sequence listing

<110> Shenzhen City Guozhen nanobody technology Co., ltd

<120> a bispecific antibody against CD3 and CA125 antigens

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8

<212> PRT

<213> Lama pacos

<400> 1

Gly Phe Thr Leu Ile Ser Tyr Thr

1 5

<210> 2

<211> 8

<212> PRT

<213> Lama pacos

<400> 2

Ile Ser Pro Ser Ser Gly Asn Thr

1 5

<210> 3

<211> 17

<212> PRT

<213> Lama pacos

<400> 3

Asn Ala Arg Ser Gly Tyr Tyr Leu Ile Phe Asp Pro Arg Asp Phe Ala

1 5 10 15

Tyr

<210> 4

<211> 124

<212> PRT

<213> Lama pacos

<400> 4

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Ile Ser Tyr

20 25 30

Thr Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val

35 40 45

Gly Tyr Ile Ser Pro Ser Ser Gly Asn Thr His Tyr Asn Asp Ser Leu

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Asn Ala Arg Ser Gly Tyr Tyr Leu Ile Pro Asp Phe Arg Asp Phe Ala

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120

<210> 5

<211> 372

<212> DNA

<213> Lama pacos

<400> 5

caggtgcagc tgcaggagag cggcggcggc ctggtgcagg cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt taccctgatt agctatacca tgggctggtt tcgccaggcg 120

ccgggcaaag aacgcgaatg ggtgggctat attagcccga gcagcggcaa cacccattat 180

aacgatagcc tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccgtgtat 240

ctgcagatga acagcctgaa accggaagat accgcggtgt attattgcaa cgcgcgcagc 300

ggctattatc tgattccgga ttttcgcgat tttgcgtatt ggggccaggg cacccaggtc 360

accgtctcct ca 372

<210> 6

<211> 124

<212> PRT

<213> Lama pacos

<400> 6

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Met Phe Ser Ile Asn

20 25 30

Ala Met Arg Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val

35 40 45

Ala Ala Ile Thr Ser Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Thr Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn

85 90 95

Ala Ala Gln Thr Arg Leu Pro Asn Ser Ala Asp Arg Tyr Glu Tyr Asp

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120

<210> 7

<211> 268

<212> PRT

<213> Artificial

<400> 7

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Ile Ser Tyr

20 25 30

Thr Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val

35 40 45

Gly Tyr Ile Ser Pro Ser Ser Gly Asn Thr His Tyr Asn Asp Ser Leu

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Asn Ala Arg Ser Gly Tyr Tyr Leu Ile Pro Asp Phe Arg Asp Phe Ala

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Gly Gly Gly Gly

115 120 125

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

130 135 140

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

145 150 155 160

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Met Phe Ser Ile Asn

165 170 175

Ala Met Arg Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val

180 185 190

Ala Ala Ile Thr Ser Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys

195 200 205

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Thr Tyr Leu

210 215 220

Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn

225 230 235 240

Ala Ala Gln Thr Arg Leu Pro Asn Ser Ala Asp Arg Tyr Glu Tyr Asp

245 250 255

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

260 265

<210> 8

<211> 227

<212> PRT

<213> Homo sapiens

<400> 8

Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly

1 5 10 15

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met

20 25 30

Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His

35 40 45

Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val

50 55 60

His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr

65 70 75 80

Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly

85 90 95

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile

100 105 110

Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val

115 120 125

Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser

130 135 140

Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu

145 150 155 160

Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro

165 170 175

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val

180 185 190

Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met

195 200 205

His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser

210 215 220

Pro Gly Lys

225

<210> 9

<211> 804

<212> DNA

<213> Artificial

<400> 9

caggtgcagc tgcaggagag cggcggcggc ctggtgcagg cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt taccctgatt agctatacca tgggctggtt tcgccaggcg 120

ccgggcaaag aacgcgaatg ggtgggctat attagcccga gcagcggcaa cacccattat 180

aacgatagcc tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccgtgtat 240

ctgcagatga acagcctgaa accggaagat accgcggtgt attattgcaa cgcgcgcagc 300

ggctattatc tgattccgga ttttcgcgat tttgcgtatt ggggccaggg cacccaggtc 360

accgtctcct caggtggagg tggaagcgga ggaggaggtt ctggaggtgg aggaagcgga 420

ggtggaggaa gccaggtgca gctgcaggag tctgggggag gcttggtgca ggctgggggg 480

tctctgagac tctcctgtgc agcctctgga agcatgttca gtatcaatgc catgcgctgg 540

taccgccagg ctccagggaa gcagcgcgag ctggtcgcgg ctattactag tggtggtagc 600

acaaactatg cagactccgt gaagggccga ttcaccatct ccagagacaa cgccaagaat 660

acgacgtatc tgcaaatgaa cagcctgaaa cctgaggaca cagccgtcta ttactgtaat 720

gcagcccaga cgcgacttcc taacagcgct gaccgttatg aatatgacta ctggggccag 780

gggacccagg tgaccgtctc ctca 804

<210> 10

<211> 1485

<212> DNA

<213> Artificial

<400> 10

caggtgcagc tgcaggagag cggcggcggc ctggtgcagg cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt taccctgatt agctatacca tgggctggtt tcgccaggcg 120

ccgggcaaag aacgcgaatg ggtgggctat attagcccga gcagcggcaa cacccattat 180

aacgatagcc tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccgtgtat 240

ctgcagatga acagcctgaa accggaagat accgcggtgt attattgcaa cgcgcgcagc 300

ggctattatc tgattccgga ttttcgcgat tttgcgtatt ggggccaggg cacccaggtc 360

accgtctcct caggtggagg tggaagcgga ggaggaggtt ctggaggtgg aggaagcgga 420

ggtggaggaa gccaggtgca gctgcaggag tctgggggag gcttggtgca ggctgggggg 480

tctctgagac tctcctgtgc agcctctgga agcatgttca gtatcaatgc catgcgctgg 540

taccgccagg ctccagggaa gcagcgcgag ctggtcgcgg ctattactag tggtggtagc 600

acaaactatg cagactccgt gaagggccga ttcaccatct ccagagacaa cgccaagaat 660

acgacgtatc tgcaaatgaa cagcctgaaa cctgaggaca cagccgtcta ttactgtaat 720

gcagcccaga cgcgacttcc taacagcgct gaccgttatg aatatgacta ctggggccag 780

gggacccagg tgaccgtctc ctcagacaaa actcacacat gcccaccgtg cccagcacct 840

gaactcctgg ggggaccgtc agtcttcctc ttccccccaa aacccaagga caccctcatg 900

atctcccgga cccctgaggt cacatgcgtg gtggtggacg tgagccacga agaccctgag 960

gtcaagttca actggtacgt ggacggcgtg gaggtgcata atgccaagac aaagccgcgg 1020

gaggagcagt acaacagcac gtaccgtgtg gtcagcgtcc tcaccgtcct gcaccaggac 1080

tggctgaatg gcaaggagta caagtgcaag gtctccaaca aagccctccc agcccccatc 1140

gagaaaacca tctccaaagc caaagggcag ccccgagaac cacaggtgta caccctgccc 1200

ccatcccggg aggagatgac caagaaccag gtcagcctga cctgcctggt caaaggcttc 1260

tatcccagcg acatcgccgt ggagtgggag agcaatgggc agccggagaa caactacaag 1320

accacgcctc ccgtgctgga ctccgacggc tccttcttcc tctacagcaa gctcaccgtg 1380

gacaagagca ggtggcagca ggggaacgtc ttctcatgct ccgtgatgca cgaggctctg 1440

cacaaccact acacgcagaa gagcctctcc ctgtctccgg gtaaa 1485

<210> 11

<211> 351

<212> PRT

<213> Artificial

<400> 11

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Met Phe Ser Ile Asn

20 25 30

Ala Met Arg Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val

35 40 45

Ala Ala Ile Thr Ser Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Thr Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn

85 90 95

Ala Ala Gln Thr Arg Leu Pro Asn Ser Ala Asp Arg Tyr Glu Tyr Asp

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Asp Lys Thr His

115 120 125

Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val

130 135 140

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

145 150 155 160

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

165 170 175

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

180 185 190

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser

195 200 205

Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys

210 215 220

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

225 230 235 240

Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro

245 250 255

Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu

260 265 270

Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn

275 280 285

Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

290 295 300

Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg

305 310 315 320

Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu

325 330 335

His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

340 345 350

<210> 12

<211> 1053

<212> DNA

<213> Artificial

<400> 12

caggtgcagc tgcaggagtc tgggggaggc ttggtgcagg ctggggggtc tctgagactc 60

tcctgtgcag cctctggaag catgttcagt atcaatgcca tgcgctggta ccgccaggct 120

ccagggaagc agcgcgagct ggtcgcggct attactagtg gtggtagcac aaactatgca 180

gactccgtga agggccgatt caccatctcc agagacaacg ccaagaatac gacgtatctg 240

caaatgaaca gcctgaaacc tgaggacaca gccgtctatt actgtaatgc agcccagacg 300

cgacttccta acagcgctga ccgttatgaa tatgactact ggggccaggg gacccaggtg 360

accgtctcct cagacaaaac tcacacatgc ccaccgtgcc cagcacctga actcctgggg 420

ggaccgtcag tcttcctctt ccccccaaaa cccaaggaca ccctcatgat ctcccggacc 480

cctgaggtca catgcgtggt ggtggacgtg agccacgaag accctgaggt caagttcaac 540

tggtacgtgg acggcgtgga ggtgcataat gccaagacaa agccgcggga ggagcagtac 600

aacagcacgt accgtgtggt cagcgtcctc accgtcctgc accaggactg gctgaatggc 660

aaggagtaca agtgcaaggt ctccaacaaa gccctcccag cccccatcga gaaaaccatc 720

tccaaagcca aagggcagcc ccgagaacca caggtgtaca ccctgccccc atcccgggag 780

gagatgacca agaaccaggt cagcctgacc tgcctggtca aaggcttcta tcccagcgac 840

atcgccgtgg agtgggagag caatgggcag ccggagaaca actacaagac cacgcctccc 900

gtgctggact ccgacggctc cttcttcctc tacagcaagc tcaccgtgga caagagcagg 960

tggcagcagg ggaacgtctt ctcatgctcc gtgatgcacg aggctctgca caaccactac 1020

acgcagaaga gcctctccct gtctccgggt aaa 1053

<210> 13

<211> 351

<212> PRT

<213> Artificial

<400> 13

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Ile Ser Tyr

20 25 30

Thr Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val

35 40 45

Gly Tyr Ile Ser Pro Ser Ser Gly Asn Thr His Tyr Asn Asp Ser Leu

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Asn Ala Arg Ser Gly Tyr Tyr Leu Ile Pro Asp Phe Arg Asp Phe Ala

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Asp Lys Thr His

115 120 125

Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val

130 135 140

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

145 150 155 160

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

165 170 175

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

180 185 190

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser

195 200 205

Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys

210 215 220

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

225 230 235 240

Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro

245 250 255

Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu

260 265 270

Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn

275 280 285

Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

290 295 300

Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg

305 310 315 320

Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu

325 330 335

His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

340 345 350

<210> 14

<211> 1053

<212> DNA

<213> Artificial

<400> 14

caggtgcagc tgcaggagag cggcggcggc ctggtgcagg cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt taccctgatt agctatacca tgggctggtt tcgccaggcg 120

ccgggcaaag aacgcgaatg ggtgggctat attagcccga gcagcggcaa cacccattat 180

aacgatagcc tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccgtgtat 240

ctgcagatga acagcctgaa accggaagat accgcggtgt attattgcaa cgcgcgcagc 300

ggctattatc tgattccgga ttttcgcgat tttgcgtatt ggggccaggg cacccaggtc 360

accgtctcct cagacaaaac tcacacatgc ccaccgtgcc cagcacctga actcctgggg 420

ggaccgtcag tcttcctctt ccccccaaaa cccaaggaca ccctcatgat ctcccggacc 480

cctgaggtca catgcgtggt ggtggacgtg agccacgaag accctgaggt caagttcaac 540

tggtacgtgg acggcgtgga ggtgcataat gccaagacaa agccgcggga ggagcagtac 600

aacagcacgt accgtgtggt cagcgtcctc accgtcctgc accaggactg gctgaatggc 660

aaggagtaca agtgcaaggt ctccaacaaa gccctcccag cccccatcga gaaaaccatc 720

tccaaagcca aagggcagcc ccgagaacca caggtgtaca ccctgccccc atcccgggag 780

gagatgacca agaaccaggt cagcctgacc tgcctggtca aaggcttcta tcccagcgac 840

atcgccgtgg agtgggagag caatgggcag ccggagaaca actacaagac cacgcctccc 900

gtgctggact ccgacggctc cttcttcctc tacagcaagc tcaccgtgga caagagcagg 960

tggcagcagg ggaacgtctt ctcatgctcc gtgatgcacg aggctctgca caaccactac 1020

acgcagaaga gcctctccct gtctccgggt aaa 1053

Claims (15)

1. A nanobody against a T cell surface antigen CD3, wherein the variable region of the nanobody has 3 complementarity determining regions CDR1, CDR2, and CDR3, wherein the CDR1 sequence consists of the amino acid sequence set forth in SEQ ID No.1, the CDR2 sequence consists of the amino acid sequence set forth in SEQ ID No.2, and the CDR3 sequence consists of the amino acid sequence set forth in SEQ ID No. 3.

2. The nanobody of claim 1, wherein the variable region sequence of the nanobody consists of the amino acid sequence of SEQ ID No. 4.

3. A nucleic acid encoding the nanobody of claim 2, wherein the sequence of the nucleic acid is shown in SEQ ID No. 5.

4. An expression vector comprising the nucleic acid of claim 3, wherein the vector is pMES4.

5. A host cell comprising the expression vector of claim 4, wherein the cell is e.coli BL21 (DE 3).

6. A bispecific antibody comprising a first heavy chain and a second heavy chain, wherein the variable region of the first heavy chain recognizes CD3 antigen and the variable region sequence consists of the amino acid sequence set forth in SEQ ID No. 4; the variable region of the second heavy chain recognizes CA125 antigen, and the variable region sequence thereof consists of the amino acid sequence shown in SEQ ID NO. 6.

7. The bispecific of claim 6A sex antibody characterized in that a connecting peptide is provided between the first heavy chain and the second heavy chain, the connecting peptide being (G) ₄ S） _n Wherein n is an integer between 1 and 6.

8. The bispecific antibody of claim 7, wherein the amino acid sequence of the bispecific antibody is shown in SEQ ID No.7, wherein n = 4.

9. The bispecific antibody of claim 8, further comprising an antibody constant region at the carboxy terminus of said bispecific antibody, wherein the constant region sequence is depicted as the amino acid sequence depicted in SEQ ID No. 8.

10. A nucleic acid encoding the bispecific antibody of claim 8, the sequence of which is shown in SEQ ID No. 9.

11. A nucleic acid encoding the bispecific antibody of claim 9, the sequence of which is shown by SEQ ID No. 10.

12. An expression vector comprising the nucleic acid of claim 11, wherein the vector is pFUSE hig 1-Fc2.

13. A host cell comprising the expression vector of claim 12, wherein the host cell is a HEK293 cell.

14. Use of the nanobody of claim 1 or 2 in the preparation of a medicament for the treatment of tumors.

15. Use of a bispecific antibody according to any one of claims 6-9 for the preparation of a medicament for the treatment of a tumor.

Images