CN114316052A - Bispecific antibody for resisting CD3 and CA125 antigen - Google Patents

Abstract

The invention discloses a nano antibody for resisting a CD3 antigen and a bispecific antibody containing two VHH domains. The nano-antibody for resisting the CD3 antigen has unique 3 complementarity determining regions CDR1, CDR2 and CDR 3. The bispecific antibody is formed by fusing two different heavy chain sequences and can respectively recognize CD3 antigen and CA125 antigen on the surface of a T cell. And the bispecific antibody can obviously enhance the activity of the T cell mediated by the antibody to kill the tumor target cell.

Description

Bispecific antibody for resisting CD3 and CA125 antigen

Technical Field

The invention discloses a polypeptide, and more particularly discloses an antibody, belonging to the field of immunology.

Background

CA125 (Cancer Antigen 125) ovarian Cancer associated Antigen was found in 1981 to be a relevant Antigen for epithelial carcinoid of the ovary. The ovarian cancer cell is secreted by epithelial cells in an embryonic stage, and is not secreted or rarely secreted under normal conditions, but when the ovary has malignant lesion, even if the ovarian cancer cell does not show clinically or is difficult to identify pathologically, the CA125 value is increased, so that the ovarian cancer cell is a better ovarian cancer diagnosis and screening index and has close relation with the metastasis and prognosis of the ovarian cancer. CA125 initially mediated a murine monoclonal antibody OC125 response by Bast et al through the ovarian cell line OVCA433 immunogen, followed by recognition and confirmation of its presence. The CA125 antigen is glycoprotein with the relative molecular mass of 200 ku, has two attitudes of membrane-bound type and free type, and is one of the most comprehensively researched ovarian cancer serum markers so far. CA125 concentration in the serum of 90% of advanced ovarian cancer patients will show various increases.

Although the ovarian cancer patients are first selected by surgery or chemotherapy, the prognosis is still not very ideal. Tumor recurrence, especially intra-abdominal recurrence, and chemotherapy resistance are often important factors affecting prognosis. At present, new therapeutic regimens for ovarian cancer, particularly for biological therapy, are rapidly evolving and have been applied in part in ex vivo and in vivo studies and clinical trials. Biological treatment for ovarian cancer includes various forms of cytokines, monoclonal antibodies, transgenic therapy, and the like. Among the approaches, ovarian cancer associated antigen CA125 monoclonal antibody therapy is of interest. The current technology for treating ovarian cancer by using the CA125 monoclonal antibody comprises two types of antigen-antibody compound mediated immune response of a human body and targeting induction of radioactive elements and antitumor drugs. The mediated immunity of the antigen-antibody complex depends on the stimulation of endogenous anti-tumor reaction of an organism, so as to achieve the purposes of removing focus and self-repairing regulation. The most representative antibodies used in this technology are anti-CA 125/anti-T cell surface molecule bispecific antibody (BsAb) and murine monoclonal antibody B43.13. The anti-CA 125/anti-T cell surface molecule bispecific antibody is combined with the CA125 antigen on the surface of the ovarian cancer cell, and then the anti-T cell surface molecule epitope is used for recognizing and inducing T cells, so that the cytotoxic effect of the T cells aiming at tumor tissues is generated, and the focus is killed. In addition, the therapy can stimulate the body to produce and maintain active immune status for a long time. Although the anti-CA 125/anti-T cell surface molecule BsAb shows excellent treatment effect, more problems still need to be solved, for example, the detailed in vivo pharmacokinetic characteristics are not clear; the preparation process has lower humanization level and obvious toxic and side effects; BsAb, tumor and T lymphocyte are required to be further improved in the aspects of specificity and affinity; the function of the Fc fragment of the antibody still needs to be improved; the permeability of antibody tumor tissue is not high, thereby bringing about the technical problems of weak tumor localization and high unintended clearance rate in vivo. The murine monoclonal antibody B43.13 initiates a classical idiotypic immune response by binding to the CA125 antigen to form an immune complex. The action mechanism is that the human anti-mouse antibody activates anti-idiotype chain reaction, and then the polyclonal antibody humoral immune response aiming at CA125 is caused. The immune response therapy has good tolerance, no adverse reaction or non-compliance and other drug suspension situations, but cannot always keep the sensitive response state of the human body to the tumor cells and also cannot overcome the tumor immune escape mechanism. A targeting induction technology of radioactive elements and antitumor drugs is another CA125 monoclonal antibody treatment technology. After the ovarian cancer tumor cell debulking operation, residual cancer cells are still planted in the abdominal cavity. Generally, such seeded cells or cell clusters are not easily clinically detectable and have high chemotherapy resistance, but are rather vulnerable to radio-immune destruction. Based on the characteristics, the radiation immunotherapy for ovarian cancer develops rapidly. The existing radioimmunotherapy mainly selects a mouse monoclonal antibody containing anti-CA 125 epitope, and after isotope labeling, targeting positioning and radiotherapy are carried out. Several experiments demonstrated that the affinity of the CA125 monoclonal antibody to its antigen did not decrease after radioactive element labeling. However, the conventional direct radiolabelling of monoclonal antibodies has many drawbacks, especially the accumulation of radiotoxicity in the reticuloendothelial system and poor therapeutic effect on solid tumors. The reticuloendothelial system accumulates, and the target localization rate of the isotope labeled antibody is greatly weakened. For solid tumor, poor radio-immune efficacy is generally attributed to tumor tissue uptake concentration lower than the optimal radiotherapy concentration, low plasma clearance, bone marrow toxicity, and the like.

Based on the outstanding characteristics of CA125 in clinical diagnosis and the great application prospect in the field of tumor therapy, the development of specific binding antibodies against CA125 and the improvement of clinical diagnosis and therapeutic efficiency become urgent needs in the prior art. However, the traditional antibodies have some disadvantages, such as low affinity, low immune recognition efficiency, and difficulty in achieving ideal binding and neutralization effects for some antigens with high hiding degree. Bispecific antibodies are an antibody technology developed in recent years that can simultaneously recognize 2 different antigens. By using the bispecific antibody, bispecific antibody can be developed which is directed against tumor cells and T cells simultaneously, and which recognizes tumor cell antigens, induces ADCC effect, recognizes T effector cells, directs T cells to the vicinity of tumor cells, and enhances the killing effect of T effector cells on tumor cells, such as CA125 antigen and CD3 antigen of T cells.

In 1993, Hamers-Casterman et al found that a class of heavy chain-only dimers (H) was found in camelids (camels, dromedary and llamas) in vivo₂) The antibodies of (1) are mainly of the IgG2 and IgG3 type, which antibodies are lacking a light chain, and thus are referred to as Heavy chain-only antibodies (HCabs) and have an antigen binding site comprising a single domainCompositions, referred to as VHH regions, such antibodies are therefore also referred to as single domain antibodies or single domain antibodies (sdabs). Since this class of antibodies is a variable region sequence after removal of the constant region, the molecular weight is only 15kDa, about 10 nm in diameter, and is therefore also referred to as nanobodies (Nbs). In addition, such single domain antibodies, called VNARs, are also observed in sharks. This heavy chain-only antibody was originally recognized only as a pathological form of a human B-cell proliferative disease (heavy chain disease). This heavy chain-only antibody may be due to genomic level mutations and deletions that result in the inability of the heavy chain CH1 domain to be expressed, such that the expressed heavy chain lacks CH1 and thus lacks the ability to bind to the light chain, thus forming a heavy chain dimer.

Nanobodies are comparable in affinity to their corresponding scFv, but surpass scfvs in solubility, stability, resistance to aggregation, refolding, expression yield, and ease of DNA manipulation, library construction, and 3-D structure determination, relative to scfvs of conventional four-chain antibodies.

Nanobodies have minimal functional antigen-binding fragments derived from HCabs in adult camelids, have high stability and high avidity for antigen binding, and can interact with protein clefts and enzymatic active sites, making their action similar to inhibitors. Therefore, the nano-antibody can provide a new idea for designing small molecule enzyme inhibitors from peptide-mimetic drugs. Due to the heavy chain only, nanobodies are easier to manufacture than monoclonal antibodies. The unique properties of nanobodies, such as stability in extreme temperature and pH environments, allow for large yields to be produced at low cost. Therefore, the nano antibody has great value in the treatment and diagnosis of diseases and has great development prospect in the antibody target diagnosis and treatment of tumors.

Based on the problems that a single recognition site or a traditional antibody molecule in the prior art in the field of tumor treatment is large and difficult to reach an acting cell and the like, the invention aims to provide the bispecific nanobody which simultaneously aims at a tumor cell and a T cell, and the bispecific nanobody can recognize a CA125 antigen of the cancer cell, induce ADCC effect, simultaneously recognize a CD3 antigen of the T cell, guide the T cell to the vicinity of the tumor cell and strengthen the killing effect of the T cell on the tumor cell. And can overcome the inherent defects of poor permeability, low targeting effect and the like of the traditional antibody solid tumor.

Disclosure of Invention

Based on the above objects, the present invention provides a nanobody against T cell surface antigen CD3, wherein the variable region of the nanobody has 3 complementarity determining regions CDR1, CDR2 and CDR3, wherein the CDR1 sequence consists of the amino acid sequence depicted in SEQ ID No.1, the CDR2 sequence consists of the amino acid sequence depicted in SEQ ID No.2, and the CDR3 sequence consists of the amino acid sequence depicted in SEQ ID No. 3.

In a preferred technical scheme, the variable region sequence of the nanobody consists of the amino acid sequence shown in SEQ ID NO. 4. One preferred example of a nanobody having such a variable region sequence in the present invention is nanobody 7a 5.

Secondly, the invention also provides a nucleic acid for coding the nano antibody, and the sequence of the nucleic acid is shown by SEQ ID NO. 5.

Thirdly, the present invention provides an expression vector containing the above nucleic acid, which is pMES 4.

Fourth, the present invention provides a host cell comprising the above expression vector, said host cell being E.coli BL21(DE 3).

Fifth, the present invention also provides a bispecific nanobody, which comprises a first heavy chain and a second heavy chain, wherein the variable region of the first heavy chain recognizes the CD3 antigen, and the sequence of the variable region thereof consists of the amino acid sequence shown in SEQ ID No. 4; the variable region of the second heavy chain recognizes the CA125 antigen, and the sequence of the variable region thereof consists of the amino acid sequence shown in SEQ ID NO. 6.

In a preferred embodiment, a connecting peptide is disposed between the first heavy chain and the second heavy chain, and the connecting peptide is (G)₄S）_nWherein n is an integer between 1 and 6.

More preferably, n =4, and the amino acid sequence of the bispecific antibody is represented by SEQ ID No. 7.

Particularly preferably, the bispecific antibody also has an antibody constant region at the carboxyl terminal, and the sequence of the constant region is shown as the amino acid sequence in SEQ ID NO. 8.

Sixth, the present invention also provides a nucleic acid encoding the bispecific antibody, the sequence of which is shown by SEQ ID NO. 9.

Seventh, the present invention also provides a nucleic acid encoding the bispecific antibody with a constant region as described above, wherein the coding sequence is represented by SEQ ID NO. 10.

Eighth, the invention provides an expression vector containing the nucleic acid, wherein the expression vector is pFUSE hIgG1-Fc 2.

Ninth, the invention provides a host cell containing the expression vector, and the host cell is an HEK293 cell.

Finally, the invention also provides the application of the nano antibody of the anti-T cell surface antigen CD3 and the bispecific antibody in the preparation of tumor treatment drugs.

The anti-CD 3 nano antibody provided by the invention has higher affinity, and the bispecific nano antibody can respectively recognize CA125 antigen and CD3 antigen on the surface of T cells. In an ADCC cytotoxicity experiment aiming at OVCAR-3, the bispecific antibody provided by the invention shows excellent cytotoxicity, remarkably enhances the activity of killing tumor target cells by T cells mediated by the antibody, and has the killing rate of 75 percent, which is higher than the combined application of a CA125 antibody and a CD3 antibody, and is more remarkably higher than the single application of the two antibodies. Compared with a single nano antibody, the bispecific antibody provided by the invention has longer in vivo half-life, which shows the application value of the bispecific antibody in the fields of clinical treatment of CA125 antigen-positive tumors and drug preparation.

Drawings

FIG. 1 shows the electrophoretic identification of total RNA extracted;

FIG. 2 shows the first round of PCR amplification of antibody variable region gene electrophoresis identification map;

FIG. 3 is the second round of PCR amplification of antibody variable region gene electrophoresis identification map;

FIG. 4 shows the electrophoretic identification chart of the product of the double digestion reaction of pMES4 vector;

FIG. 5 shows the electrophoretic identification chart of the transformant identified by colony PCR;

FIG. 6 is a SDS-PAGE picture of the nanobody 7A 5;

FIG. 7 Biacore analysis of Nanobody 7A5 affinity profile;

FIG. 8 shows an SDS-PAGE profile of bispecific antibody purification;

FIG. 9 is a graph showing the results of ADCC cytotoxicity assays;

figure 10 metabolic profile of bispecific antibody and nanobody in rabbit.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are only illustrative and do not limit the scope of protection defined by the claims of the present invention.

Example 1. preparation of monovalent nanobodies against CD 3.

1.1 immunization of alpaca

Selecting one healthy adult alpaca, uniformly mixing a recombinant humanized CD3 antigen (a manufacturer: abcam, a product number is ab 229518) and Freund's adjuvant according to a ratio of 1:1, immunizing the alpaca by adopting a back subcutaneous multipoint injection mode according to 6-7 mu g/kg for four times, and the immunization interval is 2 weeks. Then 10ml of alpaca peripheral blood is collected for constructing a phage display library.

1.2 isolation of Camel-derived lymphocytes

Separating collected alpaca peripheral blood lymphocytes by using camel peripheral blood lymphocyte separation kit (Tianjin tertiary ocean company, Cat. LTS 1076) instruction manual operation, each 2.5 × 10⁷Adding 1ml RNA separating agent into each living cell, taking 1ml for RNA extraction, and storing at-80 ℃.

1.3 Total RNA extraction

Repeatedly blowing 1ml of the Tipure Isolation Reagent containing lymphocytes, and standing for 5 minutes; add 200. mu.l chloroform, vortex for 30 seconds and then place for 5 minutes; centrifuging at 4 ℃ and 12000g for 15 minutes, sucking the water phase and transferring into a new EP tube; adding equal amount of isopropanol, and standing for 10 minutes; centrifuging at 12000g for 10min at 4 ℃, and removing supernatant; washing with 1ml of pre-cooled 70% ethanol, centrifuging at 4 ℃ and 7500g for 5 minutes, discarding the supernatant and drying for 5 minutes; 30 μ l of RNase-free water was added to dissolve the precipitate, and the concentration was adjusted to 1 μ g/μ l for detection by gel electrophoresis (FIG. 1: M is Trans 2K DNA Marker; 1 is RNA).

1.4 Synthesis of cDNA by reverse transcription

The cDNA was reverse-transcribed using the RNA obtained in step 1.3 as a template according to the reverse transcription KIT (Transcriptor first stand cDNA Synthesis KIT from Roche).

1.5 antibody variable region Gene amplification

And carrying out PCR reaction by using cDNA obtained by reverse transcription as a template. Amplification was performed in two rounds, and the primer sequences for the first round of PCR were as follows:

CALL001：GTCCTGGCTGCTCTTCTACAAGG；

CALL002：GGTACGTGCTGTTGAACTGTTCC。

the PCR reaction conditions and procedures were: 5 minutes at 95 ℃; 30 cycles of 95 ℃ for 30 seconds, 57 ℃ for 30 seconds, 72 ℃ for 30 seconds; 7 minutes at 72 ℃. The agarose gel recovery kit gel was used to recover a band of about 700bp, and the final nucleic acid concentration was adjusted to 5 ng/. mu.l with water (FIG. 2: M is Trans 2K DNA Marker; 1 is negative control; 2 is first round PCR product). The primer sequences for the second round of PCR were as follows:

VHH-Back：GATGTGCAGCTGCAGGAGTCTGGRGGAGG；

VHH-For：CTAGTGCGGCCGCTGGAGACGGTGACCTGGGT。

the PCR reaction conditions and procedures were: 5 minutes at 95 ℃; 30 seconds at 95 ℃, 30 seconds at 55 ℃, 30 seconds at 72 ℃ and 15 cycles; 7 minutes at 72 ℃. PCR products were purified using a PCR product recovery kit (FIG. 3: M is Trans 2K DNA Marker; 1 is the second round PCR product; 2 is the negative control).

1.6 vector construction

pMES4 (purchased from Biovector) and the second PCR product were subjected to PstI and BstEII double digestion, respectively, and 1.5. mu.g of the digested vector and 450ng of the digested second PCR product were taken, and 15. mu. l T4 DNA ligase was added to the digested vector and water to a total volume of 150. mu.l, ligated overnight at 16 ℃ and the ligated product was recovered. The product was recovered using a PCR product recovery kit and eluted with 20. mu.l of water. The double-restriction enzyme digestion result of the pMES4 vector was detected by 1% agarose electrophoresis gel (FIG. 4: M is Trans 5K plus DNA Marker; 1 is pMES4 vector non-restriction enzyme digestion plasmid; and 2 is pMES4 vector double-restriction enzyme digestion product).

1.7 electrotransformation and determination of the storage volume

Mu.l of the purified ligation product was taken and added to a pre-cooled electric cuvette containing 50. mu.l of E.coli TG1 competent cells and placed in an electric converter (ECM 630 electric converter of BTX, USA) for electric conversion, and the electric cuvette was taken out, and the transformant was recovered and cultured. Clones were randomly selected and colony PCR identified (FIG. 5: M is Trans 2K DNA Marker; 1 is negative control; 2-11 is randomly selected monoclonal PCR identified product). The pool capacity was estimated from the PCR positive rate (pool capacity = number of clones × dilution × PCR identification positive rate × 10). The primer sequences are as follows:

MP57：TTATGCTTCCGGCTCGTATG；

GIII：CCACAGACAGCCCTCATAG。

1.8 phage amplification

Inoculating recovered bacteria solution into YT-AG culture medium, culturing at 37 deg.C and 200rpm until culture OD₆₀₀= 0.5. 10ml of the bacterial suspension was taken out and added to 4X 10¹⁰VCSM13, 30min at 37 ℃ for static infection. At 4000rpm, the mixture was centrifuged at room temperature for 10 minutes, and the supernatant was removed. The cells were resuspended in 2 XYT-AK (ampicillin and kanamycin) medium and incubated overnight at 37 ℃ and 200 rpm. Centrifuging, taking a supernatant in a 40ml tube, adding 10ml of PEG/NaCl (20%/2.5M) solution, mixing thoroughly, centrifuging, discarding the supernatant, washing the precipitate with 1ml of ice PBS, centrifuging, taking 250 μ l of precooled PEG/NaCl from the supernatant, mixing thoroughly, washing and resuspending.

Determining the phage titer: TG1 was cultured to OD₆₀₀=0.4, the phage was diluted with LB medium gradient, phage TG1 culture was mixed and cultured in multiple dilutions, plaque formation in the plate was observed the next day, the number of plaques was counted on 30-300 dilution gradient plates and phage titer (pfu) was calculated according to the following formula.

Phage titer (pfu/ml) = dilution fold × number of plaques × 100.

1.9 Nanobody screening

Positive clones were screened for antigen by ELISA. ELISA plates were coated with antigen, blocked with 5% BSA, and washed with PBST. Mu.l phage supernatant was added to each well and left at 37 ℃ for 1 hour. The supernatant was discarded, and a secondary HRP-labeled mouse anti-M13 antibody was added thereto and the mixture was left at 37 ℃ for 1 hour. The supernatant was discarded, TMB solution was added, incubation was carried out at room temperature for 5 hours, 2M sulfuric acid stop solution was added to each well, and reading was carried out with a microplate reader at 450 nm.

Expression and purification of 1.10 Nano antibody in Escherichia coli

Selecting a clone with a positive phage ELISA result, extracting a plasmid, transforming the plasmid into a strain BL21 competent cell, inducing the protein expression of the nano antibody by IPTG, collecting a supernatant (periplasmic extract), dialyzing the periplasmic extract into PBS, purifying by using Ni-NTA resin, eluting and collecting by using imidazole with different concentrations, carrying out reduced protein electrophoresis analysis on the collected sample, and finally dialyzing the nano antibody into the PBS.

The nano antibody of anti-CD 3 is screened out through alpaca immunity, cell separation, phage library construction and nano antibody screening. Analysis of the antibody light and heavy chain genes was performed on the sequencing results using Vector NTI software to determine the Framework Regions (FRs) and Complementarity Determining Regions (CDRs) of the variable Regions.

The nanobody of one preferred embodiment screened by the present invention is named "7 a 5". Through DNA sequencing, the heavy chain nucleic acid sequence of the nanobody 7A5 is shown as SEQ ID number 5, the variable region amino acid sequence is shown as SEQ ID number 4, wherein the 1 st to 25 th amino acid sequences are FR1, the 26 th to 33 th amino acid sequences are CDR1, the 34 th to 50 th amino acid sequences are FR2, the 51 th to 58 th amino acid sequences are CDR2, the 59 th to 96 th amino acid sequences are FR3, the 97 th to 113 th amino acid sequences are CDR3, and the 114 th and 124 th amino acid sequences are FR 4.

Example 2 preparation of Nanobody 7A 5.

2.1 amplification of original strain TG1 of nano antibody and transformation of Escherichia coli BL21(DE3) by recombinant plasmid of nano antibody

The original strain TG1 glycerol strain containing the nano antibody nucleic acid is inoculated into 5ml of fresh LB-A culture medium according to the proportion of 1:1000, and the culture is carried out overnight at 37 ℃ and 200 rpm. The following day, Plasmid was extracted using a Plasmid mini kit (OMEGA) as per the instructions. After verification, 1. mu.l of the plasmid was transformed into 100. mu.l of competent cells, gently mixed, placed on ice for 30 minutes, heat-shocked in a water bath at 42 ℃ for 90 seconds, and cooled in an ice bath for 3 minutes. 600. mu.l of LB medium was added to the centrifuge tube, and the tube was cultured with shaking at 37 ℃ for 60 minutes. 100. mu.l of the supernatant was applied to an LB-A plate using a triangle spreader and cultured overnight at 37 ℃ in an inverted state.

2.2 inducible expression of Nanobodies

The above monoclonal colonies were picked up in LB-A medium and cultured overnight with shaking at 37 ℃. The next day, adding 100ml fresh LB-A culture medium into the bacterial liquid at a ratio of 1:100, and performing shaking culture at 37 deg.C for 3 hr to obtain bacterial liquid OD₆₀₀=0.8 or so, 1mM IPTG was added to the final concentration, and the mixture was induced overnight at 30 ℃. On the third day, 8000rpm, the cells were collected by centrifugation for 10 minutes, and 1.5ml of a precooled TES buffer was added to resuspend the pellet. After 2 minutes in ice bath, gently shake for 30 seconds and repeat this cycle 6 times. 3.0ml TES/4 (TES diluted 4-fold with water) was added, gently shaken for 30 seconds, and then allowed to stand on an ice bath for 2 minutes, and the shaking and standing steps were repeated a total of 6 times. After centrifugation at 9000rpm at 4 ℃ for 10 minutes, about 4.5ml of the supernatant (periplasmic extract) was collected.

2.3 purification and characterization of Nanobodies

After resuspending IMAC Sepharose (GE Co.), 2ml was added to the gravity column, and the column was allowed to stand for 30 minutes to allow Sepharose to naturally settle at the bottom of the gravity column, and the preservation buffer was discharged. Adding 2 column volumes of nickel sulfate solution (0.1M) and flowing out the nickel sulfate solution at a flow rate of about 8 seconds per drop; adding 10 times of column volume of balance buffer solution to balance and wash sepharose, and keeping the flow rate unchanged; diluting the sample by 2 times of a balance buffer solution, adding the diluted sample into a gravity column, adjusting the flow rate to be 6 seconds/drop, and collecting the penetration liquid; adding 10 times of column volume of washing buffer solution to wash sepharose, maintaining the flow rate unchanged, and collecting washing solution; adding elution buffer solution with the volume being 3 times of that of the column, maintaining the flow rate at 6 seconds per drop, and collecting the eluent containing the target protein; finally sepharose was washed by sequentially adding 10 column volumes of equilibration buffer, 10 column volumes of pure water and 10 column volumes of 20% ethanol, and finally 4ml of 20% ethanol was retained to preserve the column. The collected samples are respectively subjected to SDS-PAGE detection (figure 6: M is a rainbow 180 broad-spectrum protein Marker; 1 is a nano antibody 7A5 after escherichia coli induced expression and purification).

Example 3 determination of the affinity activity of Nanobodies to antigens.

3.1 chip antigen coupling

Preparing the antigen into working solution of 20 mu g/ml by using sodium acetate buffer solutions (pH 5.5, pH 5.0, pH 4.5 and pH 4.0) with different pH values, preparing 50mM NaOH regeneration solution, analyzing the electrostatic binding between the antigen and the surface of a chip (GE company) under different pH conditions by using a template method in a Biacore T100 protein interaction analysis system instrument, selecting a proper pH system with most neutral pH according to the standard that the signal increase amount reaches 5 times RL, and adjusting the antigen concentration as required to serve as the condition during coupling. Coupling the chip according to a template method carried by the instrument: wherein, the 1 channel selects a blank coupling mode, the 2 channel selects a Target coupling mode, and the Target is set as a designed theoretical coupling quantity. The coupling procedure took approximately 60 minutes.

3.2 analyte concentration setting Condition exploration and regeneration Condition optimization

A manual sample injection mode is adopted, a1, 2-channel 2-1 mode is selected for sample injection, and the flow rate is set to be 30 mu l/min. The injection conditions were 120 seconds, 30. mu.l/min. Regeneration conditions were 30 seconds, 30. mu.l/min. The buffer was run continuously empty first until all baselines were stable. Nanobody solutions with larger concentration spans were prepared in running buffer formulations, suggesting settings of 200. mu.g/ml, 150. mu.g/ml, 100. mu.g/ml, 50. mu.g/ml, 20. mu.g/ml, 10. mu.g/ml, 2. mu.g/ml. Preparing a regeneration solution, selecting the regeneration solution with four pH gradients of a glutamate acid system: 1.5,2.0,2.5,3.0. A200. mu.g/ml sample of analyte was manually injected and the 2-channel observed, regenerating from the most neutral pH regenerating buffer until the line of response after 2-channel regeneration returned to the same height as the baseline. And manually injecting a sample of 200 mu g/ml of analyte once again, observing the signal change of the 2-1 channel and recording the binding capacity, regenerating by using a regeneration solution which finally returns the response line to the base line in the previous step, then manually injecting a sample of 200 mu g/ml of analyte once again, observing the signal change of the 2-1 channel and recording the binding capacity, comparing with the value of the previous binding capacity, if the deviation is less than 5 percent, determining that the regeneration solution with the pH value is the optimal regeneration solution, and if the binding capacity of re-injection is lower, continuing to perform the experiment by using a regeneration buffer solution with lower pH value. And taking the selected optimal regeneration solution as a chip surface regeneration reagent after each sample introduction. And respectively injecting analyte concentration samples arranged on the sample injection device, and analyzing the binding capacity of each concentration to finally determine the concentration gradient required by the affinity test.

3.3 affinity assay

According to the optimized sample concentration gradient, the solution is regenerated, and the affinity between the nano antibody and the antigen is tested by using a template method carried by the instrument (wherein the sample introduction condition is set to be 60 seconds and 30 mul/min; the dissociation time is 600 seconds, and the regeneration condition is set to be 30 seconds and 30 mul/min). The signal condition of the 2-1 channel is observed at any time. The affinity testing process took approximately 200 minutes.

3.4 analysis of results

The binding dissociation curves for several concentration gradients were selected using a 1: the 1binding mode was fitted to all curves to obtain the affinity values and binding and dissociation constants (see FIG. 7). The affinity value of the anti-CD 3 nanobody 7A5 was 5.291E-10.

Example 4. preparation of anti-CA 125 and CD3 bispecific nanobodies.

The vector pFUSE hIgG1-Fc2 (Qingdao Jiekang organism, cat JR 442) expresses the Fc fragment of human IgG1, and the bispecific antibody is ligated to pFUSE hIgG1-Fc2 to obtain the bispecific antibody with a constant region. The specific operation is as follows: the amino acid sequence of the anti-CA 125 nano antibody refers to the amino acid sequence of the nano antibody 5D2 in Chinese patent CN 113512119A. Selecting anti-CA 125 nano antibody 5D2 and anti-CD 3 nano antibody 7A5 for protein fusion expression, and utilizing flexible polypeptide (GGGGS) in heavy chain variable regions of the two antibodies₄After ligation, the obtained product was sent to Huada Gene Co for gene synthesis. The two restriction enzyme sites EcoRI and BglII are reserved at both ends of the synthesized gene and are connected on a pUC57 vector to obtain pUC57-5D2- (GGGGS)₄-7A 5. Using EcoRI and BglIICutting target fragment fused with nano antibody, connecting into pFUSE hIgG1-Fc2 vector by T4 ligase, constructing recombinant plasmid pFUSE hIgG1-Fc2-5D2- (GGGGS)₄7A5, transforming DH5 alpha to competence, and extracting plasmids by using endotoxin-free macroextraction kit (Tiangen). Human 293 cells were transfected, bispecific nanobodies were purified from the culture supernatant of 293 cells by Protein A chromatography, and the purified bispecific nanobodies were subjected to SDS-PAGE analysis (FIG. 8: 1 for purified bispecific nanobodies; 2 for rainbow 180 broad-spectrum Protein Marker).

Example 5. ADCC cytotoxicity assay.

5.1 leukocyte isolation

2ml of venous blood is taken and put into a test tube added with anticoagulant, and the venous blood is gently mixed. Standing the test tube in an incubator at room temperature or 37 deg.C for 30-60min until the red blood cells naturally settle. At this time, the suspension in the tube was seen to be divided into 3 layers, the upper layer was light yellow plasma, the bottom layer was red blood cells, and a pale white leukocyte layer (normal human peripheral blood leukocytes) was formed on the layer adjacent to the red blood cells. The leukocyte-rich cell suspension located above the red blood cell layer was aspirated by a capillary tube and transferred to another tube. Adding Ca-free²⁺、Mg²⁺Hank's solution is added to the position 3cm away from the test tube port, mixed evenly, centrifuged for 10min at 2000r/min by a horizontal centrifuge, the supernatant is discarded, and the mixture is washed twice by the same method. The precipitated cells are resuspended and counted in a proper amount of Hank's solution of 10% -20% inactivated calf serum to prepare a suspension with the required cell concentration, and the suspension is usually 2X 10⁶/ml。

5.2 culture of tumor cells

Culturing OVCAR-3 cells (human ovarian cancer cells, purchased from ATCC) with high expression of CA125 in RPMI-1640 culture medium containing 10% fetal calf serum to 75-80% density, discarding the culture medium, washing the cells with PBS preheated to 37 deg.C for 2 times, adding 2ml trypsin-EDTA solution, standing at room temperature for 5min, adding 2ml culture medium containing 10% fetal calf serum to terminate the reaction, repeatedly blowing and beating the cells to single cell suspension with disposable sterile pipette, centrifuging with horizontal centrifuge 2000r/min for 10min, discarding the supernatant, washing with PBS for two times, counting, re-suspending the cells with culture medium to 2 × 10⁶One/ml is ready for use.

5.3 cytotoxicity assays

Take 10. mu.l (2X 10) of resuspended tumor cells⁴Respectively), adding 30 μ l of RPMI-1640 medium containing 0.1% BSA, adding 10 μ l (1 mg/ml) of different antibodies, incubating at 37 deg.C for 30min, and adding 5 × 10⁵PMBC (effector cells/target cells = 25) were incubated at 37 ℃ for 4h in a volume of 250 μ l, centrifuged at 2000r/min for 10min in a horizontal centrifuge, and the supernatant was taken and tested for LDH activity in the supernatant using a Roche cytotoxicity test kit to convert the activity into the degree of death of tumor cells, the kit having the following code: 11644793001. the results are shown in FIG. 9.

As shown in FIG. 9, the ordinate represents the killing rate of T cells on tumor target cells, and the abscissa 1-6 samples sequentially represent PMBC + OVCAR-3+ bispecific antibody, PMBC + OVCAR-3+5D2-fc +7A5-fc, PMBC + OVCAR-3+5D2-fc, PMBC + OVCAR-3+7A5-fc, pure PMBC, and pure OVCAR-3 cells (wherein 5D2-fc and 7A5-fc are prepared by the same method as in example 4, and 5D2-fc have the amino acid sequence shown in SEQ ID NO.11, the nucleic acid sequence shown in SEQ ID NO.12, the amino acid sequence of 7A5-fc shown in SEQ ID NO.13, and the nucleic acid sequence shown in SEQ ID NO. 14). The bispecific antibody provided by the invention is the column 1, which remarkably enhances the activity of killing tumor target cells by T cells mediated by the antibody, shows excellent cytotoxicity, has a killing rate as high as 75% (the killing rate of 6 samples on the abscissa is 75%, 44%, 39%, 15%, 2% and 3% in sequence), is higher than the combined application of an anti-CA 125 nano antibody 5D2 and an anti-CD 3 nano antibody 7A5, and is more remarkably higher than the single application of the two antibodies, thus showing the application value of the bispecific antibody in clinical treatment of CA125 antigen-positive tumors.

Example 6 metabolism of bispecific nanobodies in rabbit plasma.

In this example, the primary study of pharmacokinetics was performed with new zealand rabbits as subjects, each 6 new zealand rabbits were taken as a group, and the administration dose of the bispecific nanobody, the anti-CA 125 nanobody 5D2, and the anti-CD 3 nanobody 7a5 was 1nmol/kg by subcutaneous administration on the back. Blood sampling is carried out on the ear marginal vein at 0.5h, 1h, 2h, 4h, 8h, 12h, 18h, 24h, 36h, 48h, 60h, 72h, 84h, 96h, 120h and 144h after administration, serum is separated for measuring the antibody titer, and a drug titer time curve is drawn, and the result is shown in figure 10.

The results show that the nanobody is metabolized to a lower level after 72h, while the bispecific antibody still has a high concentration after 72h, with therapeutic effect. Pharmacokinetic parameters were analyzed using GraphPad Prism software and the results are shown in table 1.

TABLE 1 in vivo pharmacokinetic parameters of Nanobodies and bispecific antibodies in rabbits

。

In Table 1, t_maxRefers to the time at which the antibody titer reaches a maximum; t is t_1/2Refers to the time at which the antibody is half metabolized after reaching its maximum concentration. As can be seen from the table, the half-life of the bispecific antibody in new zealand rabbits was as long as 36 hours, significantly longer than 24 hours for the nanobody.

Sequence listing

<110> Shenzhen Shang Nanobody technology Limited

<120> a bispecific antibody against CD3 and CA125 antigens

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8

<212> PRT

<213> Lama pacos

<400> 1

Gly Phe Thr Leu Ile Ser Tyr Thr

1 5

<210> 2

<211> 8

<212> PRT

<213> Lama pacos

<400> 2

Ile Ser Pro Ser Ser Gly Asn Thr

1 5

<210> 3

<211> 17

<212> PRT

<213> Lama pacos

<400> 3

Asn Ala Arg Ser Gly Tyr Tyr Leu Ile Phe Asp Pro Arg Asp Phe Ala

1 5 10 15

Tyr

<210> 4

<211> 124

<212> PRT

<213> Lama pacos

<400> 4

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Ile Ser Tyr

20 25 30

Thr Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val

35 40 45

Gly Tyr Ile Ser Pro Ser Ser Gly Asn Thr His Tyr Asn Asp Ser Leu

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Asn Ala Arg Ser Gly Tyr Tyr Leu Ile Pro Asp Phe Arg Asp Phe Ala

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120

<210> 5

<211> 372

<212> DNA

<213> Lama pacos

<400> 5

caggtgcagc tgcaggagag cggcggcggc ctggtgcagg cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt taccctgatt agctatacca tgggctggtt tcgccaggcg 120

ccgggcaaag aacgcgaatg ggtgggctat attagcccga gcagcggcaa cacccattat 180

aacgatagcc tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccgtgtat 240

ctgcagatga acagcctgaa accggaagat accgcggtgt attattgcaa cgcgcgcagc 300

ggctattatc tgattccgga ttttcgcgat tttgcgtatt ggggccaggg cacccaggtc 360

accgtctcct ca 372

<210> 6

<211> 124

<212> PRT

<213> Lama pacos

<400> 6

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Met Phe Ser Ile Asn

20 25 30

Ala Met Arg Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val

35 40 45

Ala Ala Ile Thr Ser Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Thr Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn

85 90 95

Ala Ala Gln Thr Arg Leu Pro Asn Ser Ala Asp Arg Tyr Glu Tyr Asp

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120

<210> 7

<211> 268

<212> PRT

<213> Artificial

<400> 7

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Ile Ser Tyr

20 25 30

Thr Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val

35 40 45

Gly Tyr Ile Ser Pro Ser Ser Gly Asn Thr His Tyr Asn Asp Ser Leu

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Asn Ala Arg Ser Gly Tyr Tyr Leu Ile Pro Asp Phe Arg Asp Phe Ala

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Gly Gly Gly Gly

115 120 125

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

130 135 140

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

145 150 155 160

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Met Phe Ser Ile Asn

165 170 175

Ala Met Arg Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val

180 185 190

Ala Ala Ile Thr Ser Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys

195 200 205

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Thr Tyr Leu

210 215 220

Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn

225 230 235 240

Ala Ala Gln Thr Arg Leu Pro Asn Ser Ala Asp Arg Tyr Glu Tyr Asp

245 250 255

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

260 265

<210> 8

<211> 227

<212> PRT

<213> Homo sapiens

<400> 8

Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly

1 5 10 15

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met

20 25 30

Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His

35 40 45

Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val

50 55 60

His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr

65 70 75 80

Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly

85 90 95

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile

100 105 110

Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val

115 120 125

Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser

130 135 140

Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu

145 150 155 160

Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro

165 170 175

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val

180 185 190

Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met

195 200 205

His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser

210 215 220

Pro Gly Lys

225

<210> 9

<211> 804

<212> DNA

<213> Artificial

<400> 9

caggtgcagc tgcaggagag cggcggcggc ctggtgcagg cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt taccctgatt agctatacca tgggctggtt tcgccaggcg 120

ccgggcaaag aacgcgaatg ggtgggctat attagcccga gcagcggcaa cacccattat 180

aacgatagcc tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccgtgtat 240

ctgcagatga acagcctgaa accggaagat accgcggtgt attattgcaa cgcgcgcagc 300

ggctattatc tgattccgga ttttcgcgat tttgcgtatt ggggccaggg cacccaggtc 360

accgtctcct caggtggagg tggaagcgga ggaggaggtt ctggaggtgg aggaagcgga 420

ggtggaggaa gccaggtgca gctgcaggag tctgggggag gcttggtgca ggctgggggg 480

tctctgagac tctcctgtgc agcctctgga agcatgttca gtatcaatgc catgcgctgg 540

taccgccagg ctccagggaa gcagcgcgag ctggtcgcgg ctattactag tggtggtagc 600

acaaactatg cagactccgt gaagggccga ttcaccatct ccagagacaa cgccaagaat 660

acgacgtatc tgcaaatgaa cagcctgaaa cctgaggaca cagccgtcta ttactgtaat 720

gcagcccaga cgcgacttcc taacagcgct gaccgttatg aatatgacta ctggggccag 780

gggacccagg tgaccgtctc ctca 804

<210> 10

<211> 1485

<212> DNA

<213> Artificial

<400> 10

caggtgcagc tgcaggagag cggcggcggc ctggtgcagg cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt taccctgatt agctatacca tgggctggtt tcgccaggcg 120

ccgggcaaag aacgcgaatg ggtgggctat attagcccga gcagcggcaa cacccattat 180

aacgatagcc tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccgtgtat 240

ctgcagatga acagcctgaa accggaagat accgcggtgt attattgcaa cgcgcgcagc 300

ggctattatc tgattccgga ttttcgcgat tttgcgtatt ggggccaggg cacccaggtc 360

accgtctcct caggtggagg tggaagcgga ggaggaggtt ctggaggtgg aggaagcgga 420

ggtggaggaa gccaggtgca gctgcaggag tctgggggag gcttggtgca ggctgggggg 480

tctctgagac tctcctgtgc agcctctgga agcatgttca gtatcaatgc catgcgctgg 540

taccgccagg ctccagggaa gcagcgcgag ctggtcgcgg ctattactag tggtggtagc 600

acaaactatg cagactccgt gaagggccga ttcaccatct ccagagacaa cgccaagaat 660

acgacgtatc tgcaaatgaa cagcctgaaa cctgaggaca cagccgtcta ttactgtaat 720

gcagcccaga cgcgacttcc taacagcgct gaccgttatg aatatgacta ctggggccag 780

gggacccagg tgaccgtctc ctcagacaaa actcacacat gcccaccgtg cccagcacct 840

gaactcctgg ggggaccgtc agtcttcctc ttccccccaa aacccaagga caccctcatg 900

atctcccgga cccctgaggt cacatgcgtg gtggtggacg tgagccacga agaccctgag 960

gtcaagttca actggtacgt ggacggcgtg gaggtgcata atgccaagac aaagccgcgg 1020

gaggagcagt acaacagcac gtaccgtgtg gtcagcgtcc tcaccgtcct gcaccaggac 1080

tggctgaatg gcaaggagta caagtgcaag gtctccaaca aagccctccc agcccccatc 1140

gagaaaacca tctccaaagc caaagggcag ccccgagaac cacaggtgta caccctgccc 1200

ccatcccggg aggagatgac caagaaccag gtcagcctga cctgcctggt caaaggcttc 1260

tatcccagcg acatcgccgt ggagtgggag agcaatgggc agccggagaa caactacaag 1320

accacgcctc ccgtgctgga ctccgacggc tccttcttcc tctacagcaa gctcaccgtg 1380

gacaagagca ggtggcagca ggggaacgtc ttctcatgct ccgtgatgca cgaggctctg 1440

cacaaccact acacgcagaa gagcctctcc ctgtctccgg gtaaa 1485

<210> 11

<211> 351

<212> PRT

<213> Artificial

<400> 11

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Met Phe Ser Ile Asn

20 25 30

Ala Met Arg Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val

35 40 45

Ala Ala Ile Thr Ser Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Thr Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn

85 90 95

Ala Ala Gln Thr Arg Leu Pro Asn Ser Ala Asp Arg Tyr Glu Tyr Asp

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Asp Lys Thr His

115 120 125

Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val

130 135 140

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

145 150 155 160

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

165 170 175

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

180 185 190

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser

195 200 205

Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys

210 215 220

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

225 230 235 240

Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro

245 250 255

Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu

260 265 270

Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn

275 280 285

Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

290 295 300

Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg

305 310 315 320

Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu

325 330 335

His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

340 345 350

<210> 12

<211> 1053

<212> DNA

<213> Artificial

<400> 12

caggtgcagc tgcaggagtc tgggggaggc ttggtgcagg ctggggggtc tctgagactc 60

tcctgtgcag cctctggaag catgttcagt atcaatgcca tgcgctggta ccgccaggct 120

ccagggaagc agcgcgagct ggtcgcggct attactagtg gtggtagcac aaactatgca 180

gactccgtga agggccgatt caccatctcc agagacaacg ccaagaatac gacgtatctg 240

caaatgaaca gcctgaaacc tgaggacaca gccgtctatt actgtaatgc agcccagacg 300

cgacttccta acagcgctga ccgttatgaa tatgactact ggggccaggg gacccaggtg 360

accgtctcct cagacaaaac tcacacatgc ccaccgtgcc cagcacctga actcctgggg 420

ggaccgtcag tcttcctctt ccccccaaaa cccaaggaca ccctcatgat ctcccggacc 480

cctgaggtca catgcgtggt ggtggacgtg agccacgaag accctgaggt caagttcaac 540

tggtacgtgg acggcgtgga ggtgcataat gccaagacaa agccgcggga ggagcagtac 600

aacagcacgt accgtgtggt cagcgtcctc accgtcctgc accaggactg gctgaatggc 660

aaggagtaca agtgcaaggt ctccaacaaa gccctcccag cccccatcga gaaaaccatc 720

tccaaagcca aagggcagcc ccgagaacca caggtgtaca ccctgccccc atcccgggag 780

gagatgacca agaaccaggt cagcctgacc tgcctggtca aaggcttcta tcccagcgac 840

atcgccgtgg agtgggagag caatgggcag ccggagaaca actacaagac cacgcctccc 900

gtgctggact ccgacggctc cttcttcctc tacagcaagc tcaccgtgga caagagcagg 960

tggcagcagg ggaacgtctt ctcatgctcc gtgatgcacg aggctctgca caaccactac 1020

acgcagaaga gcctctccct gtctccgggt aaa 1053

<210> 13

<211> 351

<212> PRT

<213> Artificial

<400> 13

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Ile Ser Tyr

20 25 30

Thr Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val

35 40 45

Gly Tyr Ile Ser Pro Ser Ser Gly Asn Thr His Tyr Asn Asp Ser Leu

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Asn Ala Arg Ser Gly Tyr Tyr Leu Ile Pro Asp Phe Arg Asp Phe Ala

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Asp Lys Thr His

115 120 125

Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val

130 135 140

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

145 150 155 160

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

165 170 175

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

180 185 190

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser

195 200 205

Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys

210 215 220

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

225 230 235 240

Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro

245 250 255

Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu

260 265 270

Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn

275 280 285

Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

290 295 300

Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg

305 310 315 320

Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu

325 330 335

His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

340 345 350

<210> 14

<211> 1053

<212> DNA

<213> Artificial

<400> 14

caggtgcagc tgcaggagag cggcggcggc ctggtgcagg cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt taccctgatt agctatacca tgggctggtt tcgccaggcg 120

ccgggcaaag aacgcgaatg ggtgggctat attagcccga gcagcggcaa cacccattat 180

aacgatagcc tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccgtgtat 240

ctgcagatga acagcctgaa accggaagat accgcggtgt attattgcaa cgcgcgcagc 300

ggctattatc tgattccgga ttttcgcgat tttgcgtatt ggggccaggg cacccaggtc 360

accgtctcct cagacaaaac tcacacatgc ccaccgtgcc cagcacctga actcctgggg 420

ggaccgtcag tcttcctctt ccccccaaaa cccaaggaca ccctcatgat ctcccggacc 480

cctgaggtca catgcgtggt ggtggacgtg agccacgaag accctgaggt caagttcaac 540

tggtacgtgg acggcgtgga ggtgcataat gccaagacaa agccgcggga ggagcagtac 600

aacagcacgt accgtgtggt cagcgtcctc accgtcctgc accaggactg gctgaatggc 660

aaggagtaca agtgcaaggt ctccaacaaa gccctcccag cccccatcga gaaaaccatc 720

tccaaagcca aagggcagcc ccgagaacca caggtgtaca ccctgccccc atcccgggag 780

gagatgacca agaaccaggt cagcctgacc tgcctggtca aaggcttcta tcccagcgac 840

atcgccgtgg agtgggagag caatgggcag ccggagaaca actacaagac cacgcctccc 900

gtgctggact ccgacggctc cttcttcctc tacagcaagc tcaccgtgga caagagcagg 960

tggcagcagg ggaacgtctt ctcatgctcc gtgatgcacg aggctctgca caaccactac 1020

acgcagaaga gcctctccct gtctccgggt aaa 1053

Claims (15)

1. A nanobody against the T cell surface antigen CD3, characterized in that the variable region of said nanobody has 3 complementarity determining regions CDR1, CDR2 and CDR3, wherein the CDR1 sequence consists of the amino acid sequence set forth in SEQ ID No.1, the CDR2 sequence consists of the amino acid sequence set forth in SEQ ID No.2 and the CDR3 sequence consists of the amino acid sequence set forth in SEQ ID No. 3.

2. The nanobody of claim 1, wherein the variable region sequence of the nanobody consists of the amino acid sequence set forth in SEQ ID No. 4.

3. A nucleic acid encoding the nanobody sequence of claim 2, wherein the sequence of said nucleic acid is represented by SEQ ID No. 5.

4. An expression vector comprising the nucleic acid of claim 3, wherein said vector is pMES 4.

5. A host cell comprising the expression vector of claim 4, wherein said cell is E.coli BL21(DE 3).

6. A bispecific antibody comprising a first heavy chain and a second heavy chain, wherein the variable region of said first heavy chain recognizes the CD3 antigen and the sequence of the variable region thereof consists of the amino acid sequence depicted in SEQ ID No. 4; the variable region of the second heavy chain recognizes the CA125 antigen, and the sequence of the variable region thereof consists of the amino acid sequence shown in SEQ ID NO. 6.

7. The bispecific antibody of claim 6, wherein a linker peptide is provided between the first heavy chain and the second heavy chain, wherein the linker peptide is (G)₄S）_nWherein n is an integer between 1 and 6.

8. The bispecific antibody of claim 7, wherein n =4, and the amino acid sequence of the bispecific antibody is represented by SEQ ID No. 7.

9. The bispecific antibody according to claim 8, further comprising an antibody constant region at the carboxy-terminus of said bispecific antibody, wherein the sequence of said constant region is as shown in the amino acid sequence of SEQ ID No. 8.

10. A nucleic acid encoding the bispecific antibody of claim 8, the sequence represented by SEQ ID No. 9.

11. A nucleic acid encoding the bispecific antibody of claim 10, the sequence represented by SEQ ID No. 10.

12. An expression vector comprising the nucleic acid of claim 11, wherein said vector is pFUSE hIgG1-Fc 2.

13. A host cell comprising the expression vector of claim 12, wherein the host cell is a HEK293 cell.

14. Use of the antibody of claim 1 or 2 for the preparation of a medicament for the treatment of tumors.

15. Use of an antibody according to any one of claims 6 to 9 in the manufacture of a medicament for the treatment of tumours.

Images