CN114306326B - Application of pyrrolidine dithioformic acid ammonium salt - Google Patents
Application of pyrrolidine dithioformic acid ammonium salt Download PDFInfo
- Publication number
- CN114306326B CN114306326B CN202210051206.1A CN202210051206A CN114306326B CN 114306326 B CN114306326 B CN 114306326B CN 202210051206 A CN202210051206 A CN 202210051206A CN 114306326 B CN114306326 B CN 114306326B
- Authority
- CN
- China
- Prior art keywords
- ammonium salt
- pyrrolidine
- fever
- pdtc
- sftsv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention relates to the technical field of medicine application, in particular to application of pyrrolidine dithioformic acid ammonium salt. The application of pyrrolidine dithioformic acid ammonium salt shown in the following structural formula in preparing medicines for resisting bunyavirus is shown in the structural formula:
the pyrrolidine dithioformic acid ammonium salt has stronger antiviral activity on the bunyavirus, can obviously reduce the protein expression, RNA replication, proliferation titer and progeny virus genome copy number of the bunyavirus of the fever with thrombocytopenia syndrome, has good effects of inhibiting the infection and replication proliferation of the bunyavirus of the fever with thrombocytopenia syndrome, can be used for preparing medicines for resisting the bunyavirus, the white fiber virus, the ban virus or the fever with thrombocytopenia syndrome virus, and further can also be used for treating the fever with thrombocytopenia syndrome and related clinical symptoms thereof.
Description
Technical Field
The invention relates to the technical field of medicine application, in particular to application of pyrrolidine dithioformic acid ammonium salt.
Background
Fever with thrombocytopenia syndrome (Severe fever with thrombocytopenia syndrome, SFTS) is a virulent new tick-borne disease caused by infection with the fever with thrombocytopenia syndrome bunyavirus (Severe fever with thrombocytopenia syndrome bunyavirus, SFTSV). SFTSV is also called a novel bunyavirus in China, is a spherical, enveloped segmented negative-strand RNA virus (genome RNA contains L, M and S segments), and belongs to the genus bunyaviridae, the family of white fiber viruses and the genus Bangaviridae. The main transmission mode of the SFTSV reported at present is tick bite, and most SFTS patients have work history of forest lands or fields and tick exposure history. However, in recent years, there have been more and more cases reported by people and domestic animals, suggesting that we should have sufficient knowledge and increased vigilance of the potential spread and epidemic risk of SFTSV.
Typical clinical symptoms of patients with SFTS include fever, thrombocytopenia and leukopenia, digestive tract symptoms, neurological symptoms, bleeding tendency and the like, and the disease of partial infected patients is rapid in development, multiple organ failure and the like can occur, and the mortality rate can reach 30%. Currently, clinical treatment regimens for SFTS patients are mainly symptomatic supportive treatments, and there is no approved vaccine or effective antiviral for the prevention and treatment of SFTS. In view of its high mortality, complex pathogenic mechanisms, potential risk of epidemic outbreaks, and lack of vaccines and drugs, SFTS is listed by the world health organization as one of the ten major important infectious diseases that are urgently needed to be studied; the pathogen SFTSV has also become one of the representative highly pathogenic bunyaviruses and the representative virulent new viruses in recent years. Therefore, the research and development and application of related antiviral drugs have urgent clinical demands and have great significance for preventing outbreaks of public health events.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims to provide application of pyrrolidine dithioformic acid ammonium salt. The application of the pyrrolidine dithioformic acid ammonium salt provided by the embodiment of the invention has stronger antiviral activity on bunyaviruses, can obviously reduce protein expression, RNA replication, proliferation titer and progeny virus genome copy number of the bunyaviruses of the fever with thrombocytopenia syndrome, has good effects of inhibiting infection and replication proliferation of the bunyaviruses of the fever with thrombocytopenia syndrome, and can be further used for preparing medicines for resisting the bunyaviruses, the white fiber viruses, the bantavirus or the fever with thrombocytopenia syndrome viruses, and further can also be used for treating the fever with thrombocytopenia syndrome and related clinical symptoms thereof.
The invention is realized in the following way:
in a first aspect, the invention provides an application of a pyrrolidine dithioformic acid ammonium salt in preparing a bunyavirus-resistant medicament, wherein the pyrrolidine dithioformic acid ammonium salt has a structural formula as follows:
in an alternative embodiment, the bunyavirus comprises a fiber-white virus.
In an alternative embodiment, the bunyavirus comprises a banjo virus.
In an alternative embodiment, the bunyavirus comprises a fever with thrombocytopenia syndrome virus.
In an alternative embodiment, the agent comprises an agent that reduces protein expression of fever with thrombocytopenia syndrome virus.
In an alternative embodiment, the agent comprises an agent that reduces RNA replication of febrile concomitant thrombocytopenia syndrome virus.
In an alternative embodiment, the agent comprises an agent that reduces the proliferative titer of a febrile concomitant thrombocytopenia syndrome virus.
In an alternative embodiment, the agent comprises an agent that reduces the number of progeny viral genome copies of the febrile concomitant thrombocytopenia syndrome virus.
In an alternative embodiment, the agent comprises an agent that inhibits infection and replication and proliferation of febrile concomitant thrombocytopenia syndrome virus.
In a second aspect, the invention provides an application of pyrrolidine dithioformate ammonium salt in preparing a medicament for treating fever with thrombocytopenia syndrome, wherein the pyrrolidine dithioformate ammonium salt has a structural formula as follows:
the invention has the following beneficial effects: the application of the pyrrolidine dithioformic acid ammonium salt provided by the embodiment of the invention has stronger antiviral activity on bunyaviruses, can obviously reduce protein expression, RNA replication, titer and progeny virus genome copy number of the fever with thrombocytopenia syndrome viruses, has good effects of inhibiting infection, replication and proliferation of the fever with thrombocytopenia syndrome viruses, and can be further used for preparing medicines for resisting the bunyaviruses, the white fiber viruses, the bantaviruses or the fever with thrombocytopenia syndrome viruses, and further can also be used for treating the fever with thrombocytopenia syndrome and related clinical symptoms thereof.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 shows the results of the cytotoxicity test of ammonium Pyrrolidinedichioformate (PDTC) provided in Experimental example 1 of the present invention;
FIG. 2 is a graph showing the results of PDTC inhibition of Nucleocapsid Protein (NP) expression of SFTSV by PDTC provided in Experimental example 2 of the present invention;
FIG. 3 is a graph showing the result of the relative quantitative analysis of the gray scale of immunoblotted strips of PDTC for inhibiting NP expression of SFTSV provided in Experimental example 2 of the present invention;
FIG. 4 is a graph showing the result of PDTC inhibition of intracellular SFTSV RNA replication provided in Experimental example 3 of the present invention;
FIG. 5 is a graph showing the results of PDTC inhibition of SFTSV proliferation titer provided in Experimental example 4 of the present invention;
FIG. 6 is a graph showing the result of PDTC inhibition of the proliferation of the progeny copies of SFTSV provided in Experimental example 5 of the present invention;
FIG. 7 is a graph showing the inhibition of SFTSV virus proliferation by PDTC provided in Experimental example 5 of the present invention;
FIGS. 8 and 9 are graphs showing the results of the SOCS3 provided in Experimental example 6 of the present invention for supporting viral replication by key host factors for efficient replication of SFTSV;
FIG. 10 is a graph showing the results of PDTC inhibition of SOCS3 transcriptional expression provided in Experimental example 7 of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
The embodiment of the invention provides application of pyrrolidine dithioformic acid ammonium salt, in particular to application of pyrrolidine dithioformic acid ammonium salt:
the structural formula of the pyrrolidine dithioformate (Pyrrolidinedithiocarbamic acid, ammonium salt, PDTC for short) is shown as follows:
PDTC is a cell membrane permeable antioxidant and inhibitor of inflammatory injury and is known to have anti-inflammatory, antioxidant and free radical scavenger functions. In addition, PDTC shows some anti-inflammatory, antioxidant activity in various cell types, including fibroblasts, endothelial cells, monocytes and B lymphocytes. In recent years, the role of PDTC in alleviating tumor cachexia has also been of great concern. PDTC has been reported to reduce the progression of cancer cachexia in C26 tumor-bearing mice by inhibiting the increase in IL-6 levels in serum and tumor tissue and inhibiting the effects of NF- κB at the tumor site. In addition, PDTC can reduce STAT3 and other phosphorylation in muscle cells, and alleviate cachexia of Lewis Lung Cancer (LLC) tumor-bearing mice. At present, the compound PDTC is widely applied to the research of an anti-tumor mechanism. However, whether the compound PDTC can inhibit the replication of bunyavirus has not been reported yet.
The inventors found that the compound PDTC can inhibit the Bangavirus in the Brinella order white fiber virus, fever with thrombocytopenia syndrome virus. In particular, the compound PDTC has stronger antiviral activity on the bunyavirus, can obviously reduce the protein expression, RNA replication, titer proliferation and progeny virus genome copy number of the fever with thrombocytopenia syndrome virus at the cellular level, has good effects of inhibiting the infection and replication proliferation of the fever with thrombocytopenia syndrome bunyavirus, and can be further used for preparing medicines for resisting the bunyavirus, the white fiber virus, the ban virus or the fever with thrombocytopenia syndrome virus, and further can also be used for treating the fever with thrombocytopenia syndrome and related clinical symptoms thereof.
The features and capabilities of the present invention are described in further detail below in connection with the examples.
Experimental example 1
Cytotoxicity detection of PDTC of target compound
The method comprises the following steps:
in HEK293 cells, PDTC cytotoxicity was tested. Inoculation of 5X 10 4 Cells/well to 96 well cell culture plates at 37℃with 5% CO 2 Culturing in an incubator for 24 hours. PDTC was dissolved in dimethyl sulfoxide (DMSO) as stock solution, diluted to different working PDTC concentrations with cell culture DMEM at 0. Mu.M (DMSO only, as control), 40. Mu.M, 80. Mu.M, 160. Mu.M, 320. Mu.M, 640. Mu.M, 1280. Mu.M, 2560. Mu.M, 5120. Mu.M and 10240. Mu.M, respectively, and cells incubated with each group of three multiplex wells. After 24h, the cell activity was detected with CCK-8 kit and PDTC cytotoxicity was analyzed by OD450 nm.
The test results are shown in FIG. 1. As can be seen from FIG. 1, the cells have high tolerance to PDTC, the cell viability at 1584.89. Mu.M concentration can be maintained at more than 80% of that of the control group, and at 2560. Mu.M concentration the cell viability is still close to 80% of that of the control group, and PDTC is applied to CC of HEK239 cells 50 6633.0. Mu.M.
Experimental example 2
Detection of influence of PDTC (PDTC) of target compound on SFTSV (small form factor TSV virus) protein expression
The method comprises the following steps:
in HEK293 cells, the effect of PDTC on the expression of SFTSV viral protein was examined. Specifically, inoculation of 4X 10 5 Cells/well to 24-well cell culture plate at 37℃with 5% CO 2 Culturing overnight in an incubator. HEK293 cells were infected with SFTSV with MOI of 0.1, incubated at 37℃for 2 hours, after which the supernatant was discarded, the cells were rinsed 3 times with PBS, fresh medium containing PDTC (final concentrations of 160. Mu.M, 320. Mu.M, 640. Mu.M and 1280. Mu.M, respectively) or DMSO was added,the culture was continued at 37 ℃. Three duplicate wells were set up for each experimental group. After 24 hours, collecting cell culture medium supernatant for virus titer detection, rinsing cells with PBS for 3 times, adding 80 μl of RIPA cell lysate into each well to fully lyse the cells to extract total cell proteins, adding 20 μl of 5 XSDS PAGE loading buffer, fully mixing, boiling for 5min to denature proteins, and detecting the expression levels of viral Nucleocapsid Protein (NP) and intracellular reference protein beta-actin by Western blot immunoblotting.
The results of the assay are shown in FIG. 2, in which the expression of viral NPs was significantly inhibited in the PDTC-treated group compared to the control group, and a dose-dependent trend was exhibited, i.e., the higher the PDTC concentration, the lower the expression level of viral proteins. The results demonstrate that PDTC has a strong and effective inhibition effect on SFTSV virus NP expression.
Further, gray value statistics (three replicates) were performed on the Western blot results of PDTC inhibiting SFTSV NP expression, and the results are shown in fig. 3 (mean±sd), further confirming the inhibitory effect of PDTC on SFTSV viral protein expression.
Experimental example 3
Effect of the target Compound PDTC on intracellular SFTSV RNA replication
The method comprises the following steps:
in HEK293 cells, the effect of PDTC treatment on intracellular SFTSV viral RNA replication was examined. Specifically, inoculation of 4X 10 5 Cells/well to 24-well cell culture plate at 37℃in 5% CO 2 Culturing overnight in an incubator. HEK293 cells were infected with SFTSV at MOI 0.1, incubated at 37℃for 2 hours, the supernatant was discarded after incubation, the cells were rinsed 3 times with PBS, fresh medium containing PDTC (final concentrations of 0. Mu.M, 160. Mu.M, 320. Mu.M, 640. Mu.M, and 1280. Mu.M, respectively) was added, and culture was continued at 37 ℃. Three duplicate wells were set up for each experimental group. Cells were collected 24 hours later and the level of replication of reference genes and viral S genome segments (Ssegmentor S seg) in the cells was detected by a real-time fluorescent quantitative PCR (qRT-PCR) method. Specific primers for the reference gene GAPDH and viral SRNA are as follows,
GAPDH-F：ACCACAGTCCATGCCATCAC；
GAPDH-R：TCCACCACCCTGTTGCTGTA；
SFTSV-S-qF：CTGGGCAATGGAAACCGGAAG；
SFTSV-S-qR：CAATGAGGAAGAAGTGAACAAGT。
according to 2 -△△CT The method calculates viral S RNA replication levels.
The results of the assay are shown in FIG. 4 (mean.+ -. SD), where the intracellular viral S genomic RNA levels of the PDTC treated groups were significantly reduced compared to the control groups and showed a dose-dependent trend, i.e., the higher the PDTC concentration, the lower the viral RNA replication level. This result demonstrates that PDTC inhibits replication of intracellular SFTSV viral RNA.
Experimental example 4
Detection of the influence of PDTC of the target Compound on the titer of SFTSV Virus
The method comprises the following steps:
the effect of PDTC on SFTSV virus proliferation titer was examined. Instant TCID 50 Method the infectious viral particle titer in the cell culture supernatant collected in experimental example 2 was determined. Specifically, 5X 10 inoculation 3 Vero cells/well to 96 well cell culture plates at 37℃with 5% CO 2 Culturing overnight in an incubator. The cell culture supernatant of Experimental example 2 was collected, centrifuged at 5000g at 4℃for 2min to remove cell debris, and 10-fold gradient dilution was performed with 2% FBS-containing medium (10 -1 、10 -2 、10 -3 、10 -4 、10 -5 、10 -6 、10 -7 And 10 -8 ). 100 μl of cell supernatant dilutions of different concentration gradients were added to each well of Vero cells, 7 multiplex wells were set per concentration gradient, 37℃at 5% CO 2 Culturing for 7 days. After discarding the cell culture medium, the cells were fixed with PBS containing 4% paraformaldehyde at room temperature for 20min, and permeabilized with PBS containing 0.25% Triton X-100 at room temperature for 10min. After three washes with PBS, 5% Bovine Serum Albumin (BSA) was blocked at 37℃for 1h and incubated overnight with a primary anti-SFTSV-NP antibody at 4 ℃. After three washes with PBS, incubation with AF488 fluorescein-conjugated secondary antibody for 2h at 37deg.C, fluorescence was observed under a fluorescence microscope and counted to determine the virus titer TCID after treatment with various concentrations of PDTC 50 。
As shown in FIG. 5 (mean.+ -. SD), 160. Mu.M PDTC has a significant inhibitory effect on SFTSV proliferation titer (-4 times inhibition, P < 0.05), 320. Mu.M PDTC has a-50 times inhibition on SFTSV proliferation titer (P < 0.001), 640. Mu.M PDTC has a-300 times inhibition on SFTSV proliferation titer (P < 0.001), 1280. Mu.M PDTC has a-2000 times inhibition on SFTSV proliferation titer (P < 0.001). The results demonstrate that PDTC has strong inhibitory activity against the proliferative titer of SFTSV-infectious viral particles.
Experimental example 5
Detection of the Effect of the target Compound PDTC on SFTSV progeny proliferation (progeny viral genome RNA copy number)
The method comprises the following steps:
in HEK293 cells, the effect of PDTC on the proliferation of SFTSV progeny virus (genomic RNA copy number) was examined. Specifically, 5X 10 inoculation 5 Cells/well to 24-well cell culture plate at 37℃with 5% CO 2 Cells were incubated in an incubator for 24h, infected with SFTSV (moi=0.1), incubated for 2h at 37 ℃, virus solution removed and rinsed three times with fresh medium, treated with PDTC for 24h at 0 μm,20 μm,40 μm,80 μm,160 μm,320 μm,640 μm,1280 μm and 2560 μm, respectively, and three multiplex wells were set per group. Cell culture supernatant was collected and analyzed for PDTC inhibitory effect on SFTSV progeny virus proliferation from the standpoint of genomic RNA copy number of the progeny virus produced by qRT-PCR and standard curve method. qRT-PCR standard curve method specific primers and probes for SFTSV S RNA were as follows:
SFTSV-S-F：GGGTCCCTGAAGGAGTTGTAAA；
SFTSV-S-R：TGCCTTCACCAAGACTATCAATGT；
SFTSV-S-probe：TexasRed-TTCTGTCTTGCTGGCTCCGCGC-BHQ。
the loading of progeny virus released from SFTSV infected cells was measured in combination with standard curve method. The full length of the SFTSV S fragment was obtained by PCR, RNA of the corresponding S fragment was obtained by in vitro transcription, and the DNA was amplified by dilution (10 1-8 cobies/ml) was used to establish a detection standard curve for detection and calculation of viral load.
The detection results are shown in FIG. 6 (mean.+ -. SD). From fig. 6, it can be seen that PDTC can significantly inhibit the progeny viral load (progeny viral genome RNA copy number) of SFTSV, and the antiviral effect presents a significant doseDependencies. Further fitting PDTC to SFTSV inhibition rate, and calculating EC 50 As shown in FIG. 7, PDTC inhibits the EC of SFTSV 50 =37.40 μΜ, selection index si=cc 50 /EC 50 ＝177.35。
Experimental example 6
Effect of host factor SOCS3 on SFTSV replication
(1) SOCS3 expression supports SFTSV replication.
The target fragment is obtained: according to SOCS3 gene sequence with NM_003955.5 gene sequence in NCBI, designing primer for amplifying full-length sequence of SOCS3 coding region, wherein two ends of the primer are respectively provided with enzyme cutting sites (Nhe I and HindIII), and the primer sequences are respectively as follows:
forward direction F: GCTAGCATGGTCACCCACAGCAAGTT;
reverse R: AAGCTTTTAAAGCGGGGCATCGTACTGG.
Amplifying the target fragment by using human cell cDNA as a template and using high-fidelity enzyme (KOD, TOYOBO), performing gel running identification to obtain a 690bp band, and performing gel cutting recovery (Omega gel recovery kit) to obtain the target fragment.
Linearizing the carrier: pcDNA3.1-HA was purchased from (Addgene), the vector was double digested with Nhe I and HindIII restriction enzymes, the digested vector was identified by running, and the linearized vector fragment was obtained by cut gel recovery (Omega gel recovery kit).
Cloning and constructing: the target fragment and the carrier fragment were mixed in a 5:1 molar ratio, and 1. Mu.l of T4 ligase and 1. Mu.l of 10 XT 4 ligase buffer were added in a total volume of 10. Mu.l. After being evenly mixed, the mixture is placed at 16 ℃ for connection for 2 hours; 2 μl of the ligation product was electroporated into E.coli DH5 a competence; then 500 μl of SOC solution is added and placed on a shaking table at 37 ℃ at 150rpm/min for resuscitation for 1 hour; uniformly coating the SOC solution containing the transformed competent bacteria on a plate containing ampicillin resistance; culturing at 37deg.C. After 16 hours, single colonies were picked for cultivation and plasmid extraction (Omega plasmid extraction cassette), and the correct clone identified by digestion and sequencing was designated pcDNA3.1-SOCS3-HA.
Detection of effects of SOCS3 overexpression on viral replication: inoculation of 5X 10 5 HEK293 cell/well to 24-well cell cultureIn the plate, at 37℃5% CO 2 The cells were incubated overnight in an incubator until the confluence of the cells was 70%, and pcDNA3.1-HA (Vector, empty plasmid control) and pcDNA3.1-SOCS3-HA were transfected with lipo3000 (Invitrogen), respectively. 24 hours after transfection, cells were infected with SFTSV (moi=0.1), incubated for 2 hours at 37 ℃ and rinsed three times with fresh medium. Cells were collected after 36 hours and the level of replication of reference genes and viral S fragments in the cells was detected by real-time fluorescent quantitative PCR (qRT-PCR) (2 -△△CT Method), primer information is shown in experimental example 3.
The results are shown in FIG. 8 (mean.+ -. SD). Compared with a control group, the RNA replication of the virus in the SOCS3 over-expression cells is obviously enhanced, which suggests that the SOCS3 can support the efficient replication of SFTSV.
(2) SOCS3 deletions severely affect SFTSV replication.
SOCS 3-deficient cell line construction: SOCS3 defective cell line is constructed based on CRISPR-Cas9 gene editing technology, the used guide-RNA sequence is knocked out,
SOCS3KOgRNA：CACCGCAGCAGGTTCGCCTCGCCGC。
the knocking-out steps are as follows: firstly cloning the guide-RNA sequence into pSpCas9 (BB) plasmid; the correct plasmid was verified by sequencing to transfect HEK293 cells with lipo 3000; 48 hours after transfection, cells were pressure-screened with puromycin (Sigma, germany) at a final concentration of 3. Mu.g/ml; screening the cells for monoclonal by limiting dilution after screening for 2-3 days; and obtaining the SOCS3-KO cell line through sequencing and gene expression verification.
Detection of the effects of SOCS3 defects on viral replication: inoculating 5×10 respectively 5 HEK293 control cells and SOCS3-KO cells/well in 24 well cell culture plates at 37℃in 5% CO 2 Cells were cultured overnight in an incubator, infected with SFTSV (moi=0.1), incubated at 37 ℃ for 2h, and rinsed three times with fresh medium. Cells were collected 12, 24 and 36 hours after infection and levels of viral S fragments were detected in the cells by real-time fluorescent quantitative PCR method (2 -△△CT The method, reference gene GAPDH and virus S fragment specific primers are as described in example 3).
The detection results are shown in FIG. 9. Viral RNA replication in SOCS 3-deficient cells is significantly greatly impaired compared to wild-type cells, suggesting that SOCS3 is a key host factor required for efficient replication of SFTSV.
Experimental example 7
PDTC inhibits transcriptional expression of SOCS3 in SFTSV infected cells
The method comprises the following steps: inoculation of 5X 10 5 HEK293 cells/well to 24 well cell culture plates at 37℃in 5% CO 2 Cells were incubated overnight in the incubator, infected with SFTSV (moi=5) at-80% confluency, incubated for 2h at 37 ℃, rinsed three times with fresh medium, incubated with 160 μm and 320 μm PDTC (or control), respectively, and each set was set up with three independent replicates. Cells were collected at 6, 12 and 24 hours post infection and the effect of PDTC on SOCS3 expression in SFTSV infected cells was examined by real-time fluorescent quantitative PCR method. Primers for the reference gene GAPDH were as described above, and qRT-PCR specific primers for the objective gene SOCS3 were as follows,
SOCS3-F：GGAGTCCCCCCAGAAGAGCCTATT；
SOCS3-R：TTGACGGTCTTCCGACAGAGATGCT。
according to 2 -△△CT The method calculates SOCS3 transcriptional expression levels.
The results of the detection are shown in FIG. 10 (mean.+ -. SD). PDTC can significantly inhibit transcriptional expression of SOCS3 in SFTSV infected cells, and this inhibition capacity presents a dose-dependent trend. It is suggested that PDTC can inhibit the transcriptional expression of SOCS3 in SFTSV infected cells, thereby inhibiting the replication and proliferation of viruses, which may be an important mechanism for PDTC to inhibit the replication and proliferation of bunyavirus SFTSV.
It should be noted that, the sequence of the primer or the probe provided in the embodiment of the present invention is well known, and is only used in experiments in experimental examples, and does not affect the disclosure of the technical scheme and the display of the technical effects of the present invention, and the embodiment of the present invention will not be described in detail.
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims (7)
1. An application of pyrrolidine dithioformate ammonium salt in preparing a medicine for resisting fever with thrombocytopenia syndrome virus, which is characterized in that the pyrrolidine dithioformate ammonium salt has the structural formula:
。
2. the use according to claim 1, wherein the ammonium salt of pyrrolidinedicarboxylic acid reduces protein expression of fever with thrombocytopenia syndrome virus.
3. The use according to claim 1, wherein the ammonium salt of pyrrolidinedicarboxylic acid reduces RNA replication of febrile with thrombocytopenia syndrome virus.
4. The use according to claim 1, wherein the ammonium salt of pyrrolidinedicarboxylic acid reduces the proliferative titer of febrile thrombocytopenia syndrome virus.
5. The use according to claim 1, wherein the ammonium pyrrolidinedicarboxylate reduces the progeny viral genome copy number of fever with thrombocytopenia syndrome virus.
6. The use according to any one of claims 1 to 5, wherein the ammonium salt of pyrrolidine dithioformate inhibits infection and replication and proliferation of febrile concomitant thrombocytopenia syndrome virus.
7. An application of pyrrolidine dithioformate ammonium salt in preparing a medicament for treating fever with thrombocytopenia syndrome, which is characterized in that the pyrrolidine dithioformate ammonium salt has the structural formula:
。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210051206.1A CN114306326B (en) | 2022-01-17 | 2022-01-17 | Application of pyrrolidine dithioformic acid ammonium salt |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210051206.1A CN114306326B (en) | 2022-01-17 | 2022-01-17 | Application of pyrrolidine dithioformic acid ammonium salt |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114306326A CN114306326A (en) | 2022-04-12 |
| CN114306326B true CN114306326B (en) | 2023-06-20 |
Family
ID=81028722
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210051206.1A Active CN114306326B (en) | 2022-01-17 | 2022-01-17 | Application of pyrrolidine dithioformic acid ammonium salt |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114306326B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116440272B (en) * | 2023-01-29 | 2023-12-01 | 浙江大学 | Application of GPVI inhibitor in preparation of medicine for treating fever with thrombocytopenia syndrome |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2740660C1 (en) * | 2020-05-20 | 2021-01-19 | Общество С Ограниченной Ответственностью "Промомед Рус" | Antiviral composition |
| RU2740657C1 (en) * | 2020-05-15 | 2021-01-19 | Общество С Ограниченной Ответственностью "Промомед Рус" | Antiviral composition |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10300222A1 (en) * | 2003-01-03 | 2004-07-15 | MedInnova Gesellschaft für medizinische Innovationen aus akademischer Forschung mbH | Use of active substances for the prophylaxis and / or therapy of viral diseases |
| WO2007139150A1 (en) * | 2006-05-30 | 2007-12-06 | The University Of Tokushima | ANTI-INFLUENZA VIRAL AGENT COMPRISING TNF-α INHIBITOR |
| DE102014111892A1 (en) * | 2014-08-20 | 2016-02-25 | Eberhard Karls Universität Tübingen Medizinische Fakultät | Prophylaxis and treatment of hantavirus infection |
-
2022
- 2022-01-17 CN CN202210051206.1A patent/CN114306326B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2740657C1 (en) * | 2020-05-15 | 2021-01-19 | Общество С Ограниченной Ответственностью "Промомед Рус" | Antiviral composition |
| RU2740660C1 (en) * | 2020-05-20 | 2021-01-19 | Общество С Ограниченной Ответственностью "Промомед Рус" | Antiviral composition |
Non-Patent Citations (1)
| Title |
|---|
| PDTC inhibits picornavirus polyprotein processing and RNA replication by transporting zinc ions into cells;K. Lanke等;《J Gen Virol》;第88卷(第4期);1206-1217 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114306326A (en) | 2022-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yan et al. | Towards better understanding of KSHV life cycle: from transcription and posttranscriptional regulations to pathogenesis | |
| Biering et al. | Genome-wide bidirectional CRISPR screens identify mucins as host factors modulating SARS-CoV-2 infection | |
| Warner et al. | In vitro and in vivo efficacy of tecovirimat against a recently emerged 2022 monkeypox virus isolate | |
| Manghera et al. | TDP-43 regulates endogenous retrovirus-K viral protein accumulation | |
| JP5674210B2 (en) | Use of a combination of myxoma virus and rapamycin for therapeutic treatment | |
| Proenca‐Modena et al. | Human adenovirus replication and persistence in hypertrophic adenoids and palatine tonsils in children | |
| JP2023526836A (en) | MEK inhibitors for the treatment or prevention of coronavirus infection and/or COVID-19 cytokine storm | |
| Kukoyi et al. | MiR-144 mediates Nrf2 inhibition and alveolar epithelial dysfunction in HIV-1 transgenic rats | |
| CN114306326B (en) | Application of pyrrolidine dithioformic acid ammonium salt | |
| Bedke et al. | Contribution of bronchial fibroblasts to the antiviral response in asthma | |
| Yan et al. | Novel host protein TBC1D16, a GTPase activating protein of Rab5C, inhibits prototype foamy virus replication | |
| Hurtado et al. | Antiviral activity of lauryl gallate against animal viruses | |
| US20210038661A1 (en) | Treatment of tumors by a combination of an oncolytic adenovirus and a cdk4/6 inhibitor | |
| Stubenrauch et al. | Expression of E8^ E2 is required for wart formation by mouse papillomavirus 1 in vivo | |
| EP4164749A1 (en) | Compound and method for the treatment of coronaviruses | |
| Al Dhamen et al. | COVID-19: an update on pathogenesis and treatment | |
| Yang et al. | Interaction of p10/p27 with macrophage migration inhibitory factor promotes avian leukosis virus subgroup J infection | |
| CN113528528B (en) | shRNA for promoting apoptosis of imatinib-resistant chronic myelocytic leukemia cell K562/G01 and application thereof | |
| Belouzard et al. | Large scale screening discovers clofoctol as an inhibitor of SARS-CoV-2 replication that reduces COVID-19-like pathology | |
| CN114246847A (en) | Application of chalcone compound in treatment of coronavirus infection | |
| Wang et al. | Adenovirus vector-mediated single chain variable fragments target the nucleocapsid protein of porcine epidemic diarrhea virus and protect against viral infection in piglets | |
| CN115252760B (en) | Broad-spectrum anti-coronavirus preparation and preparation method thereof | |
| Dang et al. | USP2 inhibition prevents infection with ACE2-dependent coronaviruses in vitro and is protective against SARS-CoV-2 in mice | |
| Yan et al. | Rutaecarpine Protects from Neuropathic Pain in a Rat Model of Chronic Compression Injury. | |
| Abilov et al. | Improving the treatment of coronovirus infection Covid-19 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |