CN114306326A

CN114306326A - Novel use of ammonium pyrrolidinedithiocarbamate salts

Info

Publication number: CN114306326A
Application number: CN202210051206.1A
Authority: CN
Inventors: 宁云佳; 张优; 王华林; 邓菲
Original assignee: Wuhan Institute of Virology of CAS
Current assignee: Wuhan Institute of Virology of CAS
Priority date: 2022-01-17
Filing date: 2022-01-17
Publication date: 2022-04-12
Anticipated expiration: 2042-01-17
Also published as: CN114306326B

Abstract

The invention relates to the technical field of new application of medicaments, in particular to new application of pyrrolidine dithioammonium formate. The application of pyrrolidine dithioammonium formate shown in the following structural formula in preparing anti-bunyavirus medicaments is disclosed, wherein the structural formula is as follows:

the pyrrolidine ammonium dithioformate salt has stronger antiviral activity on the bunyavirus, can obviously reduce the protein expression, RNA replication, proliferation titer and progeny virus genome copy number of the bunyavirus with the fever accompanied thrombocytopenia syndrome, and has good effect of inhibiting the bunyavirus with the fever accompanied thrombocytopenia syndromeThe effects of virus infection and replication and proliferation can be further used for preparing medicaments for resisting bunyavirus, leukosis virus, bang virus or fever with thrombocytopenia syndrome virus, and further can be used for treating fever with thrombocytopenia syndrome and relevant clinical symptoms thereof.

Description

Novel use of ammonium pyrrolidinedithiocarbamate salts

Technical Field

The invention relates to the technical field of new application of medicaments, in particular to new application of pyrrolidine dithioammonium formate.

Background

Fever with thrombocytopenia syndrome (SFTS) is a potent emerging tick borne disease caused by infection with fever with thrombocytopenia syndrome bunyavirus (SFTSV). SFTSV is also called new bunyavirus in China, is a spherical enveloped segmented negative strand RNA virus (genome RNA contains L, M and S segments), and belongs to the order of bunyaviruses, the family of leukoviridae and the genus of Banda viruses. The main transmission mode of SFTSV reported at present is tick bite, and most of SFTS patients have work history of forest high land or field and tick exposure history. However, in recent years, there have been increasing reports of cases of people and domestic animals, suggesting that we should have full awareness and increased vigilance of the potential spreading and epidemic risks of SFTSV.

Typical clinical symptoms of SFTS patients include fever, thrombocytopenia, leukopenia, digestive tract symptoms, neurological symptoms, bleeding tendency and the like, partial infected patients have rapid disease development, multi-organ failure and the like can occur, and the fatality rate can reach 30%. Currently, clinical treatment protocols for patients with SFTS are mainly symptomatic supportive therapy, and no approved vaccine or effective antiviral drug for the prevention and treatment of SFTS is available. In view of its high lethality, complex pathogenic mechanisms, potential epidemic outbreak risks, and lack of vaccines and drugs, SFTS is listed by the world health organization as one of ten major infectious diseases that are urgently under investigation; the pathogen SFTSV also becomes a representative highly pathogenic bunyavirus in recent years, and one of representative virulent new viruses. Therefore, the research and the application of related antiviral drugs not only have urgent clinical requirements, but also have great significance for preventing the outbreak of public health events.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a novel application of pyrrolidine dithioformic acid ammonium salt. The embodiment of the invention provides a new application of pyrrolidine dithioammonium formate, which has stronger antiviral activity on bunyavirus, can obviously reduce protein expression, RNA replication, proliferation titer and progeny virus genome copy number of the bunyavirus with fever-associated thrombocytopenia syndrome, has good effects of inhibiting infection and replication proliferation of the bunyavirus with fever-associated thrombocytopenia syndrome, can be used for preparing a medicine for resisting the bunyavirus, the leukosis virus, the bang-mavirus or the bunyavirus with fever-associated thrombocytopenia syndrome, and can be further used for treating the fever-associated thrombocytopenia syndrome and relevant clinical symptoms thereof.

The invention is realized by the following steps:

in a first aspect, the present invention provides an application of an ammonium pyrrolidine dithiocarbamate in preparation of a drug for resisting bunyavirus, wherein the structural formula of the ammonium pyrrolidine dithiocarbamate is as follows:

in an alternative embodiment, the bunyavirus comprises a vims albugineus.

In an alternative embodiment, the bunyavirus comprises a bandavirus.

In alternative embodiments, the bunyavirus comprises a fever with thrombocytopenia syndrome virus.

In alternative embodiments, the medicament comprises a medicament that reduces protein expression of a fever with thrombocytopenia syndrome virus.

In alternative embodiments, the medicament comprises a medicament that reduces RNA replication of the fever with thrombocytopenia syndrome virus.

In alternative embodiments, the medicament comprises a medicament that reduces the proliferative titer of the fever with thrombocytopenia syndrome virus.

In alternative embodiments, the medicament comprises a medicament that reduces the copy number of the progeny viral genome of the fever with thrombocytopenia syndrome virus.

In alternative embodiments, the medicament comprises a medicament that inhibits infection and replication proliferation of the fever with thrombocytopenia syndrome virus.

In a second aspect, the present invention provides an application of pyrrolidine dithioammonium formate in preparing a medicament for treating fever with thrombocytopenia syndrome, wherein the structural formula of the pyrrolidine dithioammonium formate is:

the invention has the following beneficial effects: the embodiment of the invention provides a new application of pyrrolidine dithioammonium formate, which has stronger antiviral activity on bunyavirus, can obviously reduce protein expression, RNA replication, titer and progeny virus genome copy number of fever-associated thrombocytopenia syndrome virus, has good effects of inhibiting infection, replication and proliferation of the fever-associated thrombocytopenia syndrome virus, can be further used for preparing a medicament for resisting the bunyavirus, the leukosis virus, the Banda virus or the fever-associated thrombocytopenia syndrome virus, and can be further used for treating the fever-associated thrombocytopenia syndrome and relevant clinical symptoms thereof.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a graph showing the results of measuring the cytotoxicity of Pyrrolidinedithiocarbamate (PDTC) according to Experimental example 1 of the present invention;

FIG. 2 is a graph showing the results of PDTC inhibition of Nucleocapsid Protein (NP) expression of SFTSV according to Experimental example 2 of the present invention;

FIG. 3 is a graph showing the relative quantitative analysis of the gray scale of the immunoblot bands of PDTC for inhibiting NP expression of SFTSV, provided in Experimental example 2 of the present invention;

FIG. 4 is a graph showing the results of PDTC inhibition of intracellular SFTSV RNA replication provided in Experimental example 3 of the present invention;

FIG. 5 is a graph showing the results of inhibition of SFTSV proliferation titer by PDTC, provided in Experimental example 4 of the present invention;

FIG. 6 is a graph showing the results of PDTC inhibition of proliferating copies of SFTSV progeny as provided in Experimental example 5 of the present invention;

FIG. 7 is a graph showing the inhibition of SFTSV virus proliferation by PDTC, provided in Experimental example 5 of the present invention;

FIGS. 8 and 9 are graphs showing the results that SOCS3 provided in Experimental example 6 of the present invention is a key host factor for efficient replication of SFTSV in supporting viral replication;

FIG. 10 is a graph showing the results of PDTC inhibition of transcription expression of SOCS3, provided in Experimental example 7 of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The embodiment of the invention provides a new application of pyrrolidine dithioformic acid ammonium salt, which comprises the following specific steps:

the structural formula of the Pyrrolidine Dithiocarbamate (PDTC) is shown as follows:

PDTC is an antioxidant and inflammatory injury inhibitor that can permeate cell membranes, and is known to have anti-inflammatory, antioxidant, and free radical scavenger functions. In addition, PDTC exhibits some anti-inflammatory, antioxidant activity in different cell types, including fibroblasts, endothelial cells, monocytes and B lymphocytes. In recent years, the role of PDTC in alleviating tumor cachexia has also been receiving attention. It has been reported that PDTC can inhibit the increase of IL-6 level in serum and tumor tissuesAnd the effect of inhibiting NF-kB at the tumor site is added to relieve the development of cancer cachexia of C26 tumor-bearing mice. In addition, PDTC can reduce phosphorylation of STAT3 and the like in muscle cells and relieve cachexia of Lewis Lung Cancer (LLC) tumor-bearing mice. At present, the compound PDTC is widely applied to the research of an anti-tumor mechanism. However, whether the compound PDTC can inhibit bunyavirus replication is not reported at present.

The inventor finds that the compound PDTC can inhibit the large-sized virus in bunyavirus ocular leukosis virus and fever with thrombocytopenia syndrome virus. Specifically, the compound PDTC has stronger antiviral activity on bunyavirus, can remarkably reduce protein expression, RNA replication, titer proliferation and progeny virus genome copy number of the fever with thrombocytopenia syndrome virus at a cellular level, has good effects of inhibiting infection and replication proliferation of the fever with thrombocytopenia syndrome bunyavirus, can be used for preparing medicines for resisting the bunyavirus, the leukosis virus, the bang virus or the fever with thrombocytopenia syndrome virus, and can be further used for treating the fever with thrombocytopenia syndrome and relevant clinical symptoms thereof.

The features and properties of the present invention are described in further detail below with reference to examples.

Experimental example 1

Cytotoxicity assay of target Compound PDTC

The method comprises the following steps:

in HEK293 cells, PDTC was examined for cytotoxicity. Inoculation 5X 10⁴Cells/well to 96 well cell culture plates at 37 ℃ with 5% CO₂Culturing in an incubator for 24 h. PDTC was dissolved in dimethyl sulfoxide (DMSO) as a stock solution, diluted with cell culture medium DMEM to different working PDTC concentrations of 0. mu.M (DMSO only as a control), 40. mu.M, 80. mu.M, 160. mu.M, 320. mu.M, 640. mu.M, 1280. mu.M, 2560. mu.M, 5120. mu.M and 10240. mu.M, and used to incubate cells in triplicate wells. After 24h, the activity of the cells is detected by using a CCK-8 kit, and the toxicity of PDTC to the cells is analyzed by an OD450 nm value.

The test results are shown in fig. 1. As can be seen from FIG. 1, the cells are very sensitive to PDTCHigh tolerance, cell viability can be kept above 80% of a control group at 1584.89 mu M concentration, cell viability is close to 80% of the control group at 2560 mu M concentration, and CC of PDTC for HEK239 cells₅₀6633.0 μ M.

Experimental example 2

Detection of influence of target compound PDTC on SFTSV virus protein expression

The method comprises the following steps:

in HEK293 cells, the effect of PDTC on SFTSV virus protein expression was examined. Specifically, inoculation was 4X 10⁵Cells/well to 24-well cell culture plates at 37 ℃ with 5% CO₂The culture was carried out overnight in an incubator. HEK293 cells were infected with SFTSV having an MOI of 0.1, incubated at 37 ℃ for 2 hours, the supernatant was discarded, the cells were rinsed 3 times with PBS, and fresh medium containing PDTC (final concentrations of 160. mu.M, 320. mu.M, 640. mu.M and 1280. mu.M, respectively) or DMSO was added to continue the culture at 37 ℃. Each experimental group was set with three duplicate wells. After 24 hours, collecting cell culture medium supernatant for virus titer detection, rinsing the cells for 3 times by PBS, adding 80 mu l of RIPA cell lysate into each hole to fully lyse the cells and extract total cell protein, adding 20 mu l of 5 xSDS PAGE sample buffer solution, fully mixing uniformly, boiling for 5min to denature the protein, and detecting the expression levels of virus Nucleocapsid Protein (NP) and intracellular reference protein beta-actin by Western blot immunoblotting.

As shown in fig. 2, the expression of the viral NP in the PDTC-treated group was significantly suppressed compared to the control group, and a dose-dependent trend was shown, i.e., the higher the PDTC concentration, the lower the expression level of the viral protein. The result shows that PDTC has strong and effective inhibition effect on the NP expression of SFTSV virus.

The Western blot results of PDTC inhibiting SFTSV NP expression were subjected to gray scale value statistics (three replicates), and the results are shown in fig. 3 (Mean ± SD), further confirming the inhibitory effect of PDTC on SFTSV viral protein expression.

Experimental example 3

Effect of target Compound PDTC on intracellular SFTSV RNA replication

The method comprises the following steps:

detection of PDTC treatment on intracellular SFTSV in HEK293 cellsThe effect of viral RNA replication. Specifically, inoculation was 4X 10⁵Cells/well to 24-well cell culture plates at 37 ℃ with 5% CO₂The culture was carried out overnight in an incubator. HEK293 cells were infected with SFTSV having an MOI of 0.1, incubated at 37 ℃ for 2 hours, the supernatant was discarded after incubation, the cells were rinsed 3 times with PBS, and fresh medium containing PDTC (final concentrations of 0. mu.M, 160. mu.M, 320. mu.M, 640. mu.M, and 1280. mu.M, respectively) was added and the culture was continued at 37 ℃. Each experimental group was set with three duplicate wells. After 24 hours, the cells are collected, and the replication level of the reference gene and the virus S genome segment (S segment or S segment for short) in the cells is detected by a real-time fluorescent quantitative PCR (qRT-PCR) method. Specific primers for the internal reference gene GAPDH and viral S RNA are as follows,

GAPDH-F：ACCACAGTCCATGCCATCAC；

GAPDH-R：TCCACCACCCTGTTGCTGTA；

SFTSV-S-qF：CTGGGCAATGGAAACCGGAAG；

SFTSV-S-qR：CAATGAGGAAGAAGTGAACAAGT。

according to 2^-△△CTMethods calculate the level of viral S RNA replication.

The results are shown in fig. 4 (Mean ± SD), and compared with the control group, the PDTC treated group showed a significant decrease in the level of viral S genomic RNA in cells, and showed a dose-dependent trend, i.e., the higher the PDTC concentration, the lower the level of viral RNA replication. This result demonstrates that PDTC inhibits replication of SFTSV viral RNA in cells.

Experimental example 4

Detection of influence of target compound PDTC on SFTSV virus titer

The method comprises the following steps:

and (3) detecting the influence of PDTC on the multiplication titer of the SFTSV virus. I.e. using TCID₅₀Method infectious virion titers were determined in the cell culture supernatants collected in experimental example 2. Specifically, inoculation was 5X 10³Vero cells/well to 96-well cell culture plates at 37 ℃ with 5% CO₂The culture was carried out overnight in an incubator. The cell culture supernatant of Experimental example 2 was collected, centrifuged at 5000g and 4 ℃ for 2min to remove cell debris, and diluted with 2% FBS-containing medium at 10-fold gradient (10:)^-1、10^-2、10^-3、10^-4、10^-5、10^-6、10^-7And 10^-8). Adding 100 μ l of cell supernatant diluent with different concentration gradients into Vero cells in each well, setting 7 multiple wells in each concentration gradient, 37 deg.C, 5% CO₂The culture was carried out for 7 days. After discarding the cell culture medium, the cells were fixed with 4% paraformaldehyde in PBS at room temperature for 20min, and permeabilized with 0.25% Triton X-100 in PBS at room temperature for 10 min. After three PBS washes, 5% Bovine Serum Albumin (BSA) was blocked for 1h at 37 ℃ and incubated overnight with the primary antibody against SFTSV-NP at 4 ℃. After three times of PBS washing, the virus is incubated for 2h at 37 ℃ by using an AF488 fluorescein coupled secondary antibody, fluorescence is observed under a fluorescence microscope and counted, and the virus titer TCID after different concentrations of PDTC treatment is determined₅₀。

The results are shown in fig. 5 (Mean ± SD), 160 μ M PDTC showed significant inhibitory effect on SFTSV proliferation titer (4-fold inhibition, P <0.05), 320 μ M PDTC showed 50-fold inhibition on SFTSV proliferation titer (P <0.001), 640 μ M PDTC showed 300-fold inhibition on SFTSV proliferation titer (P <0.001), and 1280 μ M PDTC showed 2000-fold inhibition on SFTSV proliferation titer (P < 0.001). This result indicates that PDTC has a strong inhibitory activity on the proliferation titer of SFTSV infectable virions.

Experimental example 5

Detection of Effect of PDTC of target Compound on SFTSV progeny proliferation (progeny viral genomic RNA copy number)

The method comprises the following steps:

in HEK293 cells, the effect of PDTC on SFTSV progeny viral proliferation (genomic RNA copy number) was examined. Specifically, inoculation was 5X 10⁵Cells/well to 24-well cell culture plates at 37 ℃ with 5% CO₂After 24h incubation in an incubator, cells were infected with SFTSV (MOI ═ 0.1), incubated at 37 ℃ for 2h, virus fluid was removed and rinsed three times with fresh medium, treated with PDTC at 0 μ M, 20 μ M, 40 μ M, 80 μ M, 160 μ M,320 μ M, 640 μ M,1280 μ M and 2560 μ M for 24h, each set of three duplicate wells. Collecting cell culture medium supernatant, and analyzing the inhibition effect of PDTC on SFTSV filial virus proliferation from the aspect of the copy number of the genome RNA of the produced filial virus by using a qRT-PCR (quantitative reverse transcription-polymerase chain reaction) and standard curve method. S RN for SFTSVThe qRT-PCR standard curve method specific primers and probes of A are as follows:

SFTSV-S-F：GGGTCCCTGAAGGAGTTGTAAA；

SFTSV-S-R：TGCCTTCACCAAGACTATCAATGT；

SFTSV-S-probe：TexasRed-TTCTGTCTTGCTGGCTCCGCGC-BHQ。

the load of progeny virus released from SFTSV infected cells was tested in conjunction with a standard curve method. The full length of SFTSV S fragment is obtained by PCR method, the RNA of the corresponding S fragment is obtained by in vitro transcription, and the RNA is diluted by multiple ratio (10)^1-8copies/ml) to establish a standard curve for detection, and to detect and calculate the virus load.

The results are shown in FIG. 6 (Mean. + -. SD). As can be seen from fig. 6, PDTC can significantly inhibit the viral load (progeny viral genomic RNA copy number) of SFTSV progeny, and the antiviral effect exhibits significant dose dependence. Further fitting the inhibition rate of PDTC to SFTSV and calculating EC₅₀(as shown in FIG. 7), PDTC suppresses EC in SFTSV₅₀37.40 μ M, selection index SI ═ CC₅₀/EC₅₀＝177.35。

Experimental example 6

Effect of host factor SOCS3 on SFTSV replication

(1) SOCS3 expression supports SFTSV replication.

Obtaining a target fragment: according to the sequence of SOCS3 gene with the gene sequence number of NM-003955.5 in NCBI, primers for amplifying the full-length sequence of the coding region of SOCS3 are designed, the two ends of the primers are respectively provided with enzyme cutting sites (Nhe I and Hind III), and the sequences of the primers are respectively as follows:

and (3) forward direction F: GCTAGCATGGTCACCCACAGCAAGTT, respectively;

reverse R: AAGCTTTTAAAGCGGGGCATCGTACTGG are provided.

Amplifying a target fragment by using human cell cDNA as a template and high fidelity enzyme (KOD, TOYOBO), performing gel running identification to obtain a 690bp band, and performing gel cutting recovery (Omega gel recovery kit) to obtain the target fragment.

A linearized vector: pcDNA3.1-HA was purchased from Addgene, and the vector was double digested with Nhe I and Hind III restriction enzymes, and after digestion, gel-running was identified, and linearized vector fragments were obtained by gel-cutting recovery (Omega gel recovery kit).

Cloning and constructing: the target fragment and the vector fragment were mixed at a molar ratio of 5:1, and 1. mu.l of T4 ligase and 1. mu.l of 10 XT 4 ligase buffer were added to make a total volume of 10. mu.l. After mixing uniformly, placing at 16 ℃ for connection for 2 hours; taking 2 mul of the ligation product and electrically transferring the ligation product into escherichia coli DH5 alpha competence; adding 500 μ l SOC solution, placing in a shaking table at 37 deg.C at 150rpm/min, and recovering for 1 hr; uniformly coating the SOC solution containing the transformed competent bacteria on a plate containing ampicillin resistance; incubated at 37 ℃. After 16 hours, a single colony was picked for culture and plasmid extraction (Omega plasmid extraction cassette), and the correct clone was identified by digestion and sequencing and named pcDNA3.1-SOCS 3-HA.

Detection of the effect of overexpression of SOCS3 on viral replication: inoculation 5X 10⁵HEK293 cells/well to 24-well cell culture plates at 37 ℃ with 5% CO₂After overnight incubation in the incubator, pcDNA3.1-HA (Vector, empty plasmid control) and pcDNA3.1-SOCS3-HA were transfected with lipo3000(Invitrogen), respectively, until the cell confluence was 70%. 24 hours after transfection, cells were infected with SFTSV (MOI ═ 0.1), incubated at 37 ℃ for 2 hours, and then rinsed three times with fresh medium. After 36 hours, cells are collected, and the replication levels of the reference gene and the virus S fragment in the cells are detected by a real-time fluorescent quantitative PCR (qRT-PCR) method (2)^-△△CTMethod), primer information is shown in experimental example 3.

The results are shown in FIG. 8 (Mean. + -. SD). The RNA replication of the virus was significantly enhanced in SOCS3 overexpressing cells compared to the control group, suggesting that SOCS3 can support efficient replication of SFTSV.

(2) The absence of SOCS3 severely affects SFTSV replication.

Construction of SOCS 3-deficient cell line: the SOCS 3-deficient cell line is constructed based on CRISPR-Cas9 gene editing technology, the used guide-RNA sequence is knocked out,

SOCS3KOgRNA：CACCGCAGCAGGTTCGCCTCGCCGC。

the knockout step is as follows: the above guide-RNA sequence was first cloned into pSpCas9(BB) plasmid; the HEK293 cells were transfected with lipo3000 for the correct plasmid by sequencing; 48 hours after transfection, cells were pressure-screened with puromycin (Sigma, Germany) at a final concentration of 3. mu.g/ml; after screening for 2-3 days, cells are subjected to extreme dilution screening for monoclonals; cell lines of SOCS3-KO were obtained by sequencing and gene expression verification.

Detection of the effect of defect in SOCS3 on viral replication: respectively inoculating 5X 10⁵HEK293 control cells and SOCS3-KO cells/well into 24-well cell culture plates at 37 ℃ with 5% CO₂The cells were cultured overnight in an incubator, infected with SFTSV (MOI ═ 0.1), incubated at 37 ℃ for 2h, and then rinsed three times with fresh medium. Cells were harvested at 12, 24 and 36 hours post-infection and virus S fragment levels in cells were detected by real-time fluorescent quantitative PCR (2)^-△△CTMethods, reference gene GAPDH and primers specific for the viral S fragment are as described in example 3).

The results of the test are shown in FIG. 9. Viral RNA replication was significantly greatly impaired in SOCS 3-deficient cells compared to wild-type cells, suggesting that SOCS3 is a key host factor required for efficient replication of SFTSV.

Experimental example 7

PDTC inhibition of transcriptional expression of SOCS3 in SFTSV-infected cells

The method comprises the following steps: inoculation 5X 10⁵HEK293 cells/well to 24-well cell culture plates at 37 ℃ with 5% CO₂The cells were incubated overnight in an incubator and when the cells were-80% confluent, infected with SFTSV (MOI ═ 5), incubated at 37 ℃ for 2h, rinsed three times with fresh medium, and incubated with 160 μ M and 320 μ M PDTC (or control), respectively, in triplicate per set. Cells were harvested at 6, 12 and 24 hours post-infection and the effect of PDTC on SOCS3 expression in SFTSV-infected cells was examined by real-time fluorescent quantitative PCR. Primers for the reference gene GAPDH were as described above, and qRT-PCR specific primers for the target gene SOCS3 were as follows,

SOCS3-F：GGAGTCCCCCCAGAAGAGCCTATT；

SOCS3-R：TTGACGGTCTTCCGACAGAGATGCT。

according to 2^-△△CTThe method calculates the transcriptional expression level of SOCS 3.

The results of the detection are shown in FIG. 10 (Mean. + -. SD). PDTC can significantly inhibit transcriptional expression of SOCS3 in SFTSV-infected cells, and this inhibitory ability presents a dose-dependent trend. It is suggested that PDTC can inhibit transcriptional expression of SOCS3 in SFTSV infected cells so as to inhibit replication and proliferation of viruses, and the PDTC is probably an important mechanism for inhibiting replication and proliferation of SFTSV of bunyavirus.

It should be noted that the sequences of the primers or probes provided in the embodiments of the present invention are known and only used in the experiments in the experimental examples, which do not affect the disclosure of the technical solutions and the display of the technical effects of the present invention, and the embodiments of the present invention do not describe in detail.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. The application of the pyrrolidine dithioammonium formate in preparing the anti-bunyavirus medicine is characterized in that the structural formula of the pyrrolidine dithioammonium formate is as follows:

2. the use of claim 1, wherein the bunyavirus comprises a leukofilovirus.

3. The use of claim 1, wherein the bunyavirus comprises a banyavirus.

4. The use of claim 1, wherein the bunyavirus comprises a fever with thrombocytopenia syndrome virus.

5. The use of claim 1, wherein the medicament comprises a medicament for reducing the protein expression of the fever with thrombocytopenia syndrome virus.

6. The use of claim 1, wherein the medicament comprises a medicament for reducing RNA replication of the fever with thrombocytopenia syndrome virus.

7. The use of claim 1, wherein the medicament comprises a medicament for reducing the proliferative titer of the febrile thrombocytopenia syndrome virus.

8. The use of claim 1, wherein the medicament comprises a medicament for reducing the copy number of the progeny viral genome of the febrile thrombocytopenia syndrome virus.

9. The use according to any one of claims 1 to 8, wherein the medicament comprises a medicament for inhibiting infection and replication proliferation of the fever with thrombocytopenia syndrome virus.

10. The application of the pyrrolidine dithioammonium formate in preparing the medicine for treating fever with thrombocytopenia syndrome is characterized in that the structural formula of the pyrrolidine dithioammonium formate is as follows: