CN114300040A - Method for accurately identifying plant protein interaction - Google Patents

Abstract

The invention relates to the technical field of molecular genetics, in particular to a method for accurately identifying plant protein interaction. The invention combines the co-expression regulation network analysis and the yeast double-hybridization technology, can obtain the candidate target genes which have obvious correlation expression level in the same tissue with the candidate genes at high flux, can also verify the interaction relation between the candidate genes and the candidate target genes by using the yeast double-hybridization technology, overcomes the false positive problem caused by the high-flux sequencing technology, and the time-consuming and fussy problem of the interaction process verified by repeatedly using the yeast double-hybridization technology, has high flux and strong accuracy, and provides a quick, efficient and reliable technical means for identifying the plant protein interaction mechanism.

Description

Method for accurately identifying plant protein interaction

Technical Field

The invention relates to the technical field of molecular genetics, in particular to a method for accurately identifying plant protein interaction.

Background

Protein-protein interaction refers to the process of forming a protein complex by two or more protein molecules through non-covalent bonds, and the interaction between proteins forms a main component of a cell biochemical reaction network and participates in important biological processes such as cell signal transduction. The existing methods for identifying protein interaction comprise the construction of a co-expression regulation network, yeast two-hybrid, bimolecular fluorescence complementation and the like.

The gene co-expression network analysis is to calculate the co-expression correlation among genes according to the dynamic change of the gene expression signal value and establish a gene transcription regulation and control model, so as to search all gene expression regulation and control network models and key genes of one or more species at different development stages or different tissues under different conditions or treatments. Weighted Gene co-expression Network Analysis (WGCNA) is a method for constructing a Gene co-expression regulatory Network based on Gene expression levels obtained by transcriptome Sequencing (RNA-seq), by classifying Gene co-expression data and efficiently discovering major genes. However, WGCNA can only cluster genes with similar expression patterns or similar functions into the same module by bioinformatics prediction, and cannot clarify the mutual regulation and control relationship between genes, which is very complicated if all genes in the module are verified one by one.

The yeast two-hybrid system is firstly proposed and successfully established in 1989 by Fields and the like according to the characteristics of eukaryotic transcription regulation, can accurately analyze the interaction relationship between known proteins, can directly screen gene fragments interacting with the known proteins from a cDNA library by a yeast two-hybrid technology, has different marker genes such as auxotrophy genes, resistance genes and the like in yeast, and has extremely low probability of obtaining false positive interaction proteins under the screening standard of yeast galactosidase (X-alpha-Gal). However, some proteins have low affinity regions of other proteins on the surface, so that the expression of the reporter gene is easy to activate, and the problems of long experimental period and the like exist. For the above reasons, the detection of the interaction between proteins by the yeast two-hybrid technology needs to be verified by combining other technical means.

Disclosure of Invention

In order to solve the above problems, the present invention provides a method for precisely identifying plant protein interactions. The method provided by the invention overcomes the problems of false positive caused by a high-throughput sequencing technology and complicated experimental process for verifying the interaction relationship by repeatedly utilizing a yeast double-hybrid system, and has high efficiency, accuracy and simplicity.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides a method for accurately identifying plant protein interaction, which comprises the following steps:

1) constructing a co-expression regulation network of all genes in a certain tissue of a plant, and screening target genes with the same expression mode as the candidate genes; the screening criteria include: the weight value between the candidate gene and the target gene is more than 0.30;

2) constructing an AD-cDNA library of a certain tissue of the plant which is the same as the tissue in the step 1), and screening a target gene interacting with the candidate gene by utilizing a yeast two-hybrid technology;

3) when the target gene selected in the step 1) is the same as the target gene selected in the step 2), the protein encoded by the candidate gene and the protein encoded by the same target gene are considered to have an interaction mode;

the step 1) and the step 2) are not limited in sequence.

Preferably, before constructing the co-expression regulatory network of all genes in a certain tissue of the plant in the step 1), the whole genome expression profile data of the certain tissue of the plant is obtained by using sequencing or a public database.

Preferably, the sequencing or data obtained using a common database is at least 15 replicate samples.

Preferably, the method for constructing a co-expression regulatory network of all genes in a certain tissue of a plant in step 1) comprises: and (4) weighted gene co-expression network analysis.

Preferably, the gene screening criteria for the co-expression regulatory network in step 1) include: the gene expression level is greater than 5 and the same gene is expressed in at least 80% of the individuals tested.

Preferably, the amount of RNA of the AD-cDNA library in step 2) is > 300. mu.g.

Preferably, the method for self-activation and toxicity detection of the candidate gene in the yeast two-hybrid technology in the step 2) comprises a co-transformation method.

Preferably, the method for screening a target gene interacting with a candidate gene in step 2) comprises: proteins in the AD-cDNA library bind to the bait protein.

Preferably, the screening criteria in step 2) include: the single colony containing the target gene is blue after the secondary screening is carried out by using the yeast adenine/histidine/leucine/tryptophan synthesis defective culture medium added with yeast galactosidase.

Preferably, the step 2) of re-screening to obtain blue single colonies further comprises obtaining a target gene having the same action mode as the candidate gene by using a high-throughput sequencing technology.

Has the advantages that:

the invention provides a method for accurately identifying plant protein interaction, which comprises the following steps:

1) constructing a co-expression regulation network of all genes in a certain tissue of a plant, and screening target genes with the same expression mode as the candidate genes; the screening criteria include: the weight value between the candidate gene and the target gene is more than 0.30;

2) constructing an AD-cDNA library of a certain tissue of the plant which is the same as the tissue in the step 1), and screening a target gene interacting with the candidate gene by utilizing a yeast two-hybrid technology;

3) when the target gene selected in the step 1) is the same as the target gene selected in the step 2), the protein encoded by the candidate gene and the protein encoded by the same target gene are considered to have an interaction mode;

the step 1) and the step 2) are not limited in sequence.

The invention combines the co-expression regulation network analysis and the yeast double-hybridization technology, can obtain the candidate target genes which have obvious correlation expression level in the same tissue with the candidate genes at high flux, can also verify the interaction relation between the candidate genes and the candidate target genes by using the yeast double-hybridization technology, overcomes the false positive problem caused by the high-flux sequencing technology, and the time-consuming and fussy problem of the interaction process verified by repeatedly using the yeast double-hybridization technology, has high flux and strong accuracy, and provides a quick, efficient and reliable technical means for identifying the plant protein interaction mechanism.

Drawings

FIG. 1 is a schematic flow chart of a method for precisely identifying a target gene PPK4 according to example 1 of the present invention;

fig. 2 shows the soft threshold parameter (power 20) when the fitted curve is selected for the first time to approach 0.9;

FIG. 3 shows a co-expression regulatory network of the PPK4 gene constructed in example 1 of the present invention;

FIG. 4 shows the results of screening of the target gene interacting with PPK4 by the yeast two-hybrid technique in example 1 of the present invention; wherein A is the result of primary screening of adenine/histidine/leucine/tryptophan synthesis defective culture medium of the used yeast; b is the result of secondary screening by using a QDO/X culture medium; c is a gel electrophoresis schematic diagram after PCR amplification is carried out on the screened combined bacterial liquid by random sampling, different lanes represent interaction genes which are successfully amplified, and a plurality of strips represent a plurality of interaction genes in the tube of PCR bacterial liquid;

FIG. 5 is a schematic diagram of the interaction between the protein encoded by the PPK4 target gene and the protein encoded by PPK4, which is re-verified by the yeast double-hybrid experiment in WGCNA and the yeast double-hybrid screening library method in example 1 of the present invention; the blue color of QDO/X indicates that the yeast colony where the PPK4 target gene interacted with PPK4 was a positive colony.

Detailed Description

The invention provides a method for accurately identifying plant protein interaction, which comprises the following steps:

1) constructing a co-expression regulation network of all genes in a certain tissue of a plant, and screening target genes with the same expression mode as the candidate genes; the screening criteria include: the weight value between the candidate gene and the target gene is more than 0.30;

2) constructing an AD-cDNA library of a certain tissue of the plant which is the same as the tissue in the step 1), and screening a target gene interacting with the candidate gene by utilizing a yeast two-hybrid technology;

3) when the target gene selected in the step 1) is the same as the target gene selected in the step 2), the protein encoded by the candidate gene and the protein encoded by the same target gene are considered to have an interaction mode;

the step 1) and the step 2) are not limited in sequence.

The present invention does not require any particular source of the carrier, the reagent and the medium unless otherwise specified, and may be any commercially available product known to those skilled in the art.

In the present invention, before constructing the co-expression regulatory network of all genes in a certain tissue of a plant, it is preferable to obtain the whole genome expression profile data of a certain tissue of a plant by using sequencing or a public database. The present invention is not limited to the type of plant, and in the examples, poplar is preferably used as an example for illustration, but the present invention is not to be construed as the full scope of the present invention. In the present invention, the certain tissue preferably includes vascular tissue; preferably, the sequencing comprises transcriptome sequencing; the depth of sequencing is preferably 30 ×; the sequencing or data obtained using a common database is at least 15 replicate samples. The sequencing method is not particularly required by the invention, and the sequencing method known to the skilled person can be adopted. The invention selects sequencing or uses more than or equal to 15 groups of repeated samples of data obtained by a public database to meet the requirement of constructing a co-expression regulation network and improve the accuracy.

In the present invention, the method for constructing a co-expression regulatory network of all genes in a certain tissue of a plant preferably comprises: WGCNA; the gene screening criteria for the co-expression regulatory network include: the gene expression level (Fragments Per Kilobase Million, FPKM) >5 and the same gene is expressed in at least 80% of the tested individuals.

After a co-expression regulation network of all genes in a certain tissue of a plant is constructed, hierarchical clustering analysis is preferably carried out based on weighting correlation, different expression modules are finally obtained, and target genes with strong interaction relation with the candidate genes can be screened out by setting a screening standard of weight value >0.30 between the candidate genes and the target genes. In the present invention, the generation of the co-expression regulatory network preferably comprises: firstly, calculating the distance between each pair of genes by using a Pearson correlation coefficient, then selecting a soft threshold parameter (power is 20) when a fitting curve is close to 0.9 for the first time, setting the minimum module parameter to be 30-100 genes, combining and cutting the genes to be 0.2-0.3, and finally classifying the genes to form a gene co-expression module; the minimum module parameter is 30-100 genes, more preferably 50 genes, and the combined cutting height is more preferably 0.25.

The invention constructs an AD-cDNA (activating Domain with cDNA) library of a certain tissue of the same plant, and screens a target gene interacting with a candidate gene by using a yeast two-hybrid technology. In the present invention, the AD-cDNA library preferably includes an AD-cDNA library having an activation domain; the plant tissues for constructing the AD-cDNA library are the same as those for constructing the co-expression regulatory network described above.

In the present invention, the method for constructing an AD-cDNA library of a tissue of the above plant preferably comprises: extracting RNA of the same tissue of the plant sample, separating mRNA, and constructing an AD-cDNA library; the results of the RNA extraction preferably include: 18S 28S 1.0-2.0, OD_260/2801.8 to 2.0, and the amount of RNA>300 μ g. The method for extracting RNA and constructing the AD-cDNA library does not need special requirements, and the method which is well known by the technical personnel in the field can be adopted.

In the present invention, the method for self-activation and toxicity detection of candidate genes in the yeast two-hybrid technology preferably comprises a co-transformation method; the co-transformation method comprises the following steps: respectively transferring a positive control vector (pGBKT7-53+ pGADT7-T), a negative control vector (pGBKT7-Lam + pGADT7-T), a bait vector (pGBKT7-X + pGADT7-T, wherein X represents a candidate gene) and a toxicity control vector (pGBKT7+ pGADT7-T) into yeast Y2H competent cells, culturing at 30 ℃ for 48h, selecting a yeast Leucine and Tryptophan synthesis defective culture Medium (Double Synthetic Medium with turbid lead/Tryptophan, DDO) which is monocloned in yeast Leucine and Tryptophan synthesis defective culture Medium, culturing at 30 ℃ to turbid, and taking 100 mu l of bacteria solution to perform gradient dilution 10^-2、10^-3、10^-4Then sequentially taking 2 mul of undiluted bacterial liquid and gradient diluted bacterial liquid, respectively dripping the undiluted bacterial liquid and the gradient diluted bacterial liquid on DDO and QDO solid culture media, and culturing for 2-4 days at 30 ℃; if only the strain transferred into the positive control vector exists inCan grow on QDO solid culture medium, so that the candidate gene has no self-activation and toxicity phenomenon. The DDO medium in the present invention and examples preferably represents a yeast leucine and tryptophan synthesis-deficient medium, the QDO medium preferably represents a yeast adenine/histidine/leucine/tryptophan synthesis-deficient medium, and the QDO/X medium preferably represents a yeast adenine/histidine/leucine/tryptophan synthesis-deficient medium to which yeast galactosidase is added. In the invention and the embodiment, the reagents for preparing the DDO culture medium and the QDO culture medium are preferably purchased from Beijing Bairuiji Biotechnology Co., Ltd, and the models are respectively: BN25162, BN25163, BN25174, BN25190, BN 25344. The preparation method of the DDO culture medium, the QDO culture medium and the QDO/X culture medium has no special requirement, and the preparation method known by the technical personnel in the field can be adopted.

In the present invention, the method for screening a target gene interacting with a candidate gene preferably comprises: binding proteins in the AD-cDNA library to a bait protein; the specific indication method preferably includes: 2-3 single colonies (single colonies transformed into pGBKT7-X, wherein X represents a candidate gene) are picked and placed in 50ml of yeast Tryptophan synthesis defective culture Medium (Synthetic drag Medium with chromosomal Tryptophan, SD-Trp) liquid culture Medium, and are cultured overnight at 30 ℃ for 16h at the rotation speed of 250rpm until OD₆₀₀More than 0.8, then centrifuging by a refrigerated centrifuge (1000g/10min), re-suspending the cell thallus by 5ml of SD-Trp liquid culture Medium, adding 1ml of library working solution and 5ml of bacterial solution into a 1L cell culture bottle, leaching out peptone glucose (Yeast extract peptide Dextrose with Adenine, YPDA) liquid culture Medium by 50ml of 2 times containing Adenine, flushing a 50ml centrifuge tube and transferring into the cell culture bottle, and combining in a 30 ℃ shaking table for 20-24 h, wherein the rotating speed is 30-50 rpm, and more preferably 35-40 rpm; and after 20h of combination, observing whether the bacterium solution has clover-shaped binders or not by a 40 Xconfocal microscope, if so, continuing to perform the subsequent steps, and if not, continuing to culture for 4 h.

After the protein combined with the bait protein is obtained by screening, the combined strain is preferably screened by using a QDO culture medium; the criteria for the screening preferably include: will be provided withThe combined bacterial solution was centrifuged (1000g/10min) by a refrigerated centrifuge, the cells were resuspended in 50ml of 0.5 XPYPDA-resistant liquid medium, centrifuged (1000g/10min) again, finally the cells were resuspended in 10ml of 0.5 XPYPDA-resistant liquid medium, 100. mu.l of the bacterial solution was diluted 10. mu.l in gradient^-2、10^-3、10^-4Taking 100 mul of each gradient, coating the gradient on SD-Trp, yeast Leucine synthesis defective culture Medium (SD-Leu) and DDO culture Medium, coating the rest bacteria liquid on QDO culture Medium, coating 200-500 mul of each culture Medium for primary screening, preferably 200-350 mul, more preferably 250 mul, and culturing at 30 ℃ for 4-5 days; QDO/X was rescreened and single colonies containing the target gene appeared blue.

After obtaining the blue single colony, preferably, the method also comprises the step of obtaining a target gene with the same action mode as the candidate gene by using a high-throughput sequencing technology; the specific preference includes: single blue colonies on QDO/X medium were picked to sterilized 50. mu.l deionized Water (Deminadjusted Water, ddH)₂O), adding 8-15 single bacterial colonies into each tube, more preferably adding 10-12 single bacterial colonies into each tube, and fully shaking and uniformly mixing to perform bacterial liquid PCR; purifying the PCR reaction solution by using a PCR product purification kit, uniformly mixing purified products in a vortex mode, and performing high-throughput second-generation sequencing on 100-200 mu l of mixed sample; comparing the sequencing result with a reference genome, performing gene annotation to obtain a target gene interacting with the candidate gene, preferably performing quality control analysis on an original file (raw data) by using Trimmomatic software, performing genome comparison by using kallisto software, and screening indexes est _ counts>10, more preferably the length ratio based thereon>0.5 of the gene. In the present invention, the reference genome preferably comprises the genome of the sequencing material.

In the present invention, the reaction system of PCR is 50. mu.L, preferably comprises 2 XPPhanta Max MasterMix 25. mu.L, bacterial suspension 2. mu.L, upstream primer AD-F1. mu.L, downstream primer AD-R1. mu.L and the balance ddH₂O; the reaction procedure of the PCR preferably includes: pre-denaturation at 98 ℃ for 5 min; denaturation at 98 ℃ for 30s, annealing at 51 ℃ for 30s, extension at 72 ℃ for 3min, and 30 cycles; extension at 72 ℃ for 5 min.

When the target gene screened by the co-expression control network coincides with the target gene screened by the yeast two-hybrid technology, the candidate gene and the target gene are considered to have an interaction mode, so that the interaction relation between the protein encoded by the candidate gene and the protein encoded by the target gene is accurately determined.

To further illustrate the present invention, the following detailed description of a method for precisely identifying plant protein interactions is provided in conjunction with the accompanying drawings and examples, which should not be construed as limiting the scope of the invention.

Example 1

A method for precisely identifying plant protein interaction (the flow chart is shown in figure 1) comprises the following steps:

selecting a material as poplar vascular tissue, and identifying a target gene of protein kinase Potri.003G049700 (Photogenetic protein kinase 4, PPK 4);

step S1, using 15 sets of poplar vascular tissue transcriptome sequencing in public database (NCBI) (Table 1) to obtain whole genome expression profile data.

Table 115 sets of poplar vascular tissue transcriptome sequencing data

Step S2, constructing a co-expression regulation and control network of poplar vascular tissues based on the expression profile data obtained in the step S1, and identifying a target gene with the same expression mode as that of PPK4, wherein the specific steps are as follows:

firstly, a coexpression regulation and control network of poplar xylem is constructed by utilizing WGCNA, and the gene screening standard for constructing the coexpression network is as follows: FPKM is more than 5, and the same gene is expressed in at least more than 80% of tested individuals; secondly, based on WGCNA analysis, firstly, the distance between each pair of genes is calculated by using the pearson correlation coefficient, then, a soft threshold parameter (power ═ 20) when a fitting curve is close to 0.9 for the first time is selected (fig. 2), the minimum module parameter is set to be 50 genes, the cutting height is combined to be 0.25, finally, 7 co-expression modules are obtained by cutting the clustering result, then, the target genes having the same action mode with the PPK4 are determined by screening weight value >0.30 (table 2), and finally, the co-expression regulation network map of the PPK4 is obtained by using Cytoscape software (fig. 3).

Table 2 Co-expression regulatory network identification and PPK4 with the same mode of action of target genes

Step S3, constructing an AD-cDNA library of the poplar, and obtaining a target gene interacted with PPK4 by using a yeast two-hybrid technology, wherein the method specifically comprises the following steps:

firstly, extracting poplar plant total RNA, wherein the RNA quality inspection requirement is 18S: 28S-1.0-2.0, OD 260/280-1.8-2.0, and the RNA quantity is more than 300 mu g, separating mRNA by using RNA, constructing an AD-cDNA library and obtaining a library working solution.

Secondly, pGBKT7-53+ pGADT7-T, pGBKT7-Lam + pGADT7-T, pGBKT7-PPK4+ pGADT7-T, pGBKT7+ pGADT7-T and pGBKT7-PPK4 (the vectors are all provided by Shanghai European easy biomedicine science and technology Limited) are respectively transferred into yeast Y2H competent cells; the specific transfer method comprises the following steps: 1) taking 50 mu l of ice-thawed Y2H competent cells, sequentially adding pre-cooled target plasmid, 2-5 mu g, 10 mu l of Carrier DNA (95-100 ℃, 5min, quick ice bath and one-time repetition) and 500 mu l of PEG/LiAC, sucking and beating for several times, and uniformly mixing; 2) carrying out water bath at 30 ℃ for 30min (turning for 6-8 times when 15min and uniformly mixing); 3) placing the tube in 42 ℃ water bath for 15min (turning for 6-8 times when 7.5 min); 4) centrifuging at 5000rpm for 40s, discarding the supernatant, resuspending the thallus in 400 μ l of sterilized water, centrifuging for 30s, and discarding the supernatant; 5) resuspending the thalli again in 100 mul of sterilized water in a super clean bench, respectively coating the thalli on a DDO culture medium, and culturing for 48-96 h at 30 ℃; after the single bacterium grows out, selecting the single bacterium to be cultured in a DDO liquid culture medium at 30 ℃ until the single bacterium is obviously turbid, and taking 100 mu l of bacterium liquid to perform gradient dilution 10^-2、10^-3、10^-4Multiplying, and then diluting undiluted and gradient diluted bacteriaSequentially taking 2 mul of the bacterial strain, respectively dotting the bacterial strain on DDO and QDO solid culture media, culturing the bacterial strain for 2 to 4 days at the temperature of 30 ℃, wherein all the bacterial strains grow obvious white round bacterial plaques on the DDO solid culture media, while only the bacterial strains transformed into pGBKT7-53+ pGADT7-T grow white bacterial plaques on the QDO solid culture media, the bacterial strains transformed into pGBKT7-Lam + pGADT7-T, the bacterial strains transformed into pGBKT7-PPK4+ pGADT7-T and the bacterial strains transformed into pGBKT7+ pGADT7-T only leave liquid traces, and the fact that the PPK4 has no self-activation and toxicity phenomena is shown.

Thirdly, activating pGBKT7-PPK4 bacterial colonies, selecting 2-3 single bacterial colonies, placing the single bacterial colonies in 50ml SD-Trp liquid culture medium, and carrying out overnight culture at the temperature of 30 ℃ for 16h at the rotating speed of 250rpm until OD is reached₆₀₀More than 0.8, then centrifuging by a refrigerated centrifuge (1000g/10min), re-suspending the cell thallus by 5ml of SD-Trp liquid culture medium, adding 1ml of library working solution obtained in the previous stage and 5ml of bacterial solution into a 1L cell culture bottle, flushing a 50ml centrifuge tube by 50ml of 2 XYPDA (Kana) liquid culture medium (BN 25325, Beijing Bairui Ji Biotech Co., Ltd.) and transferring the centrifuge tube into the cell culture bottle, and combining (mating) in a shaker at 30 ℃ for 20-24 h at the rotating speed of 37 rpm. After 20h of Mating, the cells were observed to have clover-shaped binders under a 40 Xconfocal microscope.

Then, the Mating bacterial liquid was centrifuged by a refrigerated centrifuge (1000g/10min), the cells were resuspended in 50ml of 0.5 XYPDA (Kana) liquid medium, centrifuged again (1000g/10min), and finally the cells were resuspended in 10ml of 0.5 XYPDA (Kana), 100. mu.l of the bacterial liquid was diluted in 10. mu.l gradient^-2、10^-3、10^-4And multiplying, coating 100 mu l of each gradient on SD-Trp, SD-Leu and DDO culture media, coating all the residual bacteria liquid on a QDO culture medium, coating 250 mu l of each culture medium, culturing for 4-5 days at 30 ℃ (A in figure 4), primarily screening circular colonies with the size of 1-2 mm on the QDO culture medium, picking all single colonies of the QDO culture medium on the QDO/X culture medium for secondary screening, and enabling the colonies to be blue (B in figure 4).

Finally, pick up the blue single colony on QDO/X medium to sterilized 50. mu.l ddH₂O PCR centrifuge tubes, 12 single colonies per tube, primers for pGADT7 vector (AD-F: TACCACTACAATGGATGATG, SEQ ID No. 1; AD-R: AGATGGTGCACGATGCACAG, SEQ ID No.2), followed by high fidelity enzyme 2XPhanta MaxMasterMix (Nyjinomoto-King Biotech Co., Ltd.) was subjected to PCR of bacterial suspension (reaction system of PCR: 2 XPhanta MaxMasterMix 25. mu.L, bacterial suspension 2. mu.L, upstream primer AD-F1. mu.L, downstream primer AD-R1. mu.L and ddH₂O21 mu L; the reaction procedure for PCR was: pre-denaturation at 98 ℃ for 5 min; denaturation at 98 ℃ for 30s, annealing at 51 ℃ for 30s, extension at 72 ℃ for 3min, and 30 cycles; extension is carried out for 5min at 72 ℃), random sampling is carried out for gel electrophoresis, PCR reaction liquid is purified by using a common DNA product purification kit DP204 of Tiangen Biochemical technology (Beijing) Co., Ltd.) according to the size of a strip to verify the reliability of screening results (C in figure 4), purified products are mixed evenly in a vortex mode, 150 mu l of mixed sample is taken for high-throughput secondary sequencing, and the rest sample is placed at-80 ℃. The sequencing result refers to the genomic comparison of populus trichocarpa, carries out gene annotation, uses Trimmomatic software to carry out quality control analysis on raw data, uses kallisto software to carry out genomic comparison, and screens indexes est _ counts>10 and length ratio>0.5, finally resulting in the target gene interacting with PPK4 (table 3).

TABLE 3 Yeast two-hybrid Screen for target genes that interact with PPK4

At step S4, when the target gene identified by the co-expression regulatory network and having the same expression pattern as PPK4 and the target gene selected by the yeast two-hybrid technology and interacting with PPK4 coincide, the coincident target gene is the target gene interacting with PPK4 (table 4), and it also indicates that the protein encoded by PPK4 has an interaction pattern with the protein encoded by potri.004g227700, potri.006g117700, potri.005g019800, potri.003g128000, or potri.008g041000, and at the same time, the yeast two-hybrid experiment is used to verify that PPK4 has indeed an interaction relationship with potri.004g227700, potri.006g117700, potri.005g019800, potri.003g128000, and potri.008g041000 (fig. 5).

TABLE 4 target genes for PPK4 interaction

In conclusion, the invention combines the co-expression regulation network analysis and the yeast two-hybrid technology, can obtain the candidate target gene with obvious correlation expression level in the same tissue with the candidate gene at high flux, can also verify the interaction relation between the candidate gene and the candidate target gene by using the yeast two-hybrid technology, overcomes the false positive problem caused by the high-flux sequencing technology, and solves the time-consuming and fussy problems of the interaction process by repeatedly using the yeast two-hybrid technology, has high flux and strong accuracy, and provides a rapid, efficient and reliable technical means for identifying the plant protein interaction mechanism.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> Beijing university of forestry

<120> method for accurately identifying plant protein interaction

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

taccactaca atggatgatg 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

agatggtgca cgatgcacag 20

Claims (10)

1. A method for accurately identifying plant protein interaction is characterized by comprising the following steps:

1) constructing a co-expression regulation network of all genes in a certain tissue of a plant, and screening target genes with the same expression mode as the candidate genes; the screening criteria include: the weight value between the candidate gene and the target gene is more than 0.30;

2) constructing an AD-cDNA library of a certain tissue of the plant which is the same as the tissue in the step 1), and screening a target gene interacting with the candidate gene by utilizing a yeast two-hybrid technology;

3) when the target gene selected in the step 1) is the same as the target gene selected in the step 2), the protein encoded by the candidate gene and the protein encoded by the same target gene are considered to have an interaction mode;

the step 1) and the step 2) are not limited in sequence.

2. The method of claim 1, wherein before constructing the co-expression regulatory network of all genes in a tissue of the plant in step 1), obtaining whole genome expression profile data of a tissue of the plant by sequencing or public database is included.

3. The method of claim 2, wherein the sequencing or data obtained using a common database is at least 15 replicate samples.

4. The method according to claim 1, wherein the step 1) of constructing a co-expression regulatory network of all genes in a tissue of a plant comprises: and (4) weighted gene co-expression network analysis.

5. The method of claim 1 or 4, wherein the gene screening criteria for co-expression regulatory networks in step 1) comprises: the gene expression level is greater than 5 and the same gene is expressed in at least 80% of the individuals tested.

6. The method of claim 1, wherein the amount of RNA in the AD-cDNA library of step 2) is >300 μ g.

7. The method of claim 1, wherein the self-activation and toxicity detection of the candidate gene in the yeast two-hybrid technology of step 2) comprises co-transformation.

8. The method of claim 1, wherein the step 2) of screening target genes interacting with candidate genes comprises: proteins in the AD-cDNA library bind to the bait protein.

9. The method of claim 1, wherein the screening criteria in step 2) comprises: the single colony containing the target gene is blue after the secondary screening is carried out by using the yeast adenine/histidine/leucine/tryptophan synthesis defective culture medium added with yeast galactosidase.

10. The method of claim 9, wherein the rescreening of step 2) to obtain blue-appearing monosomy further comprises obtaining a target gene having the same mode of action as the candidate gene using high throughput sequencing technology.

Images