CN108998545B - Application of cynoglossus semilaevis exosome piR-mmu-31018127 - Google Patents
Application of cynoglossus semilaevis exosome piR-mmu-31018127 Download PDFInfo
- Publication number
- CN108998545B CN108998545B CN201811020132.5A CN201811020132A CN108998545B CN 108998545 B CN108998545 B CN 108998545B CN 201811020132 A CN201811020132 A CN 201811020132A CN 108998545 B CN108998545 B CN 108998545B
- Authority
- CN
- China
- Prior art keywords
- pirna
- mmu
- pir
- cynoglossus semilaevis
- male fish
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 241001014350 Cynoglossus semilaevis Species 0.000 title claims abstract description 33
- 210000001808 exosome Anatomy 0.000 title claims abstract description 31
- 108091007412 Piwi-interacting RNA Proteins 0.000 claims abstract description 48
- 241000251468 Actinopterygii Species 0.000 claims abstract description 39
- 239000004055 small Interfering RNA Substances 0.000 claims abstract description 39
- 210000000582 semen Anatomy 0.000 claims abstract description 19
- 238000000034 method Methods 0.000 claims abstract description 10
- 238000004458 analytical method Methods 0.000 claims abstract description 8
- 239000000090 biomarker Substances 0.000 claims abstract description 7
- 230000000694 effects Effects 0.000 claims abstract description 5
- 238000012163 sequencing technique Methods 0.000 claims description 9
- 238000012216 screening Methods 0.000 claims description 8
- 238000010201 enrichment analysis Methods 0.000 claims description 6
- 108091032955 Bacterial small RNA Proteins 0.000 claims description 5
- 238000010200 validation analysis Methods 0.000 claims description 5
- 108091032973 (ribonucleotides)n+m Proteins 0.000 claims description 4
- 210000000349 chromosome Anatomy 0.000 claims description 4
- 239000002299 complementary DNA Substances 0.000 claims description 4
- 108700011259 MicroRNAs Proteins 0.000 claims description 3
- 239000000091 biomarker candidate Substances 0.000 claims description 3
- 238000010195 expression analysis Methods 0.000 claims description 3
- 230000037361 pathway Effects 0.000 claims description 3
- 108090000623 proteins and genes Proteins 0.000 claims description 3
- 238000004445 quantitative analysis Methods 0.000 claims description 3
- 230000003252 repetitive effect Effects 0.000 claims description 3
- 241000894007 species Species 0.000 claims description 3
- 210000005259 peripheral blood Anatomy 0.000 claims description 2
- 239000011886 peripheral blood Substances 0.000 claims description 2
- 238000007619 statistical method Methods 0.000 claims description 2
- 230000020509 sex determination Effects 0.000 claims 1
- 238000001514 detection method Methods 0.000 abstract description 11
- 238000011529 RT qPCR Methods 0.000 abstract description 6
- 239000003550 marker Substances 0.000 abstract description 6
- 230000002068 genetic effect Effects 0.000 abstract description 5
- 238000012795 verification Methods 0.000 abstract description 3
- 238000012167 Small RNA sequencing Methods 0.000 abstract 1
- 239000000523 sample Substances 0.000 description 10
- 108020004414 DNA Proteins 0.000 description 6
- 238000010839 reverse transcription Methods 0.000 description 6
- 241001465754 Metazoa Species 0.000 description 5
- 239000003153 chemical reaction reagent Substances 0.000 description 5
- 238000003753 real-time PCR Methods 0.000 description 5
- 238000001914 filtration Methods 0.000 description 3
- 108091070501 miRNA Proteins 0.000 description 3
- 239000002679 microRNA Substances 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 108020004566 Transfer RNA Proteins 0.000 description 2
- 230000005540 biological transmission Effects 0.000 description 2
- 210000004027 cell Anatomy 0.000 description 2
- 238000006243 chemical reaction Methods 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 239000012528 membrane Substances 0.000 description 2
- 229920000936 Agarose Polymers 0.000 description 1
- 241000269335 Ambystoma laterale x Ambystoma jeffersonianum Species 0.000 description 1
- 241000255581 Drosophila <fruit fly, genus> Species 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102100034343 Integrase Human genes 0.000 description 1
- 108091092878 Microsatellite Proteins 0.000 description 1
- 102000041193 Piwi family Human genes 0.000 description 1
- 108091061182 Piwi family Proteins 0.000 description 1
- 238000002123 RNA extraction Methods 0.000 description 1
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 239000012560 cell impurity Substances 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000000706 filtrate Substances 0.000 description 1
- 210000004602 germ cell Anatomy 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 238000002955 isolation Methods 0.000 description 1
- 239000006166 lysate Substances 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 239000003147 molecular marker Substances 0.000 description 1
- 108091027963 non-coding RNA Proteins 0.000 description 1
- 102000042567 non-coding RNA Human genes 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 210000001672 ovary Anatomy 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 238000010791 quenching Methods 0.000 description 1
- 230000000171 quenching effect Effects 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 210000004994 reproductive system Anatomy 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 230000001568 sexual effect Effects 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an application of cynoglossus semilaevis piR-mmu-31018127, wherein a sex tag piR-mmu-31018127 is derived from a fish seminal plasma exosome, tag piRNAs which are obviously and differentially expressed in two types of fish are screened as candidates through small RNA sequencing analysis, and a piRNA biomarker which has an indicating effect on the two types of fish is finally determined through real-time quantitative PCR verification, wherein the tag piRNAs are piR-mmu-31018127, the sequence is GCATGTGGTTCAGTGGTAGAATTCTCGCCG, and a detection kit is developed and prepared on the basis of the marker. The method has the advantages of no wound, high efficiency and reliable identification result, and is used for judging the genetic sex of the cynoglossus semilaevis by quantitative detection for the first time.
Description
Technical Field
The invention belongs to the technical field of fish biology, and particularly relates to application of a cynoglossus semilaevis gender label piR-mmu-31018127 as a gender label.
Background
The Cynoglossus semilaevis (Cynoglossus semilaevis) is restricted by certain degree in industrial development due to the great difference of the growth speed and body type of female and male fish, high proportion of male fish in cultivation and low economic value. Studies have found that a significant proportion of male fish are pseudomale, i.e. genetically female, but phenotypically male. The pseudo-male fish is used as a male parent, and the offspring can inherit the characteristics of the father to become the pseudo-male fish, so that the problem of high male fish ratio is caused. Therefore, the identification of the pseudo-male fish has important significance for the breeding industry of the cynoglossus semilaevis. The traditional female specific microsatellite molecular marker method needs agarose electrophoresis band identification and has certain error; the accuracy of chromosome identification is limited by the effect of the control chip, and both methods are qualitative judgments. The invention develops the cynoglossus semilaevis seminal plasma exosome piRNAs marker, quantitatively inspects the expression quantity of piRNA by applying a quantitative PCR method to realize the identification of male cynoglossus semilaevis and pseudo-male fish, and has the advantages of high accuracy and stable and reliable result.
PiRNA (Piwi-interacting RNA) which is mainly present in the reproductive system of animals is a type of non-coding RNA of about 26-32nt (nucleotides) in length. piRNA plays an important role in animal development and reproductive regulation, and in drosophila ovary germ cells, the piRNA is greatly amplified in the cells through Ping-Pong circulation (Ping-Pong cycle) through the coordination and processing of PIWI family proteins, and a specific action mechanism of the piRNA is yet to be discovered. The research of the source of exosome piRNAs as biomarkers in marine animals is hardly reported, and the invention develops the plasma exosome piRNAs marker of the cynoglossus semilaevis, solves the problem of identification of the genetic sex of the male cynoglossus semilaevis and the pseudo-male fish, and has innovation.
Disclosure of Invention
The invention aims to solve the technical problem of providing application of piR-mmu-31018127 of cynoglossus semilaevis, wherein piR-mmu-31018127 is derived from plasma exosome piRNA of cynoglossus semilaevis, and the application is used as a sex label to solve the problem of distinguishing the genetic sex of male cynoglossus semilaevis and pseudo-male fish. The research of the source of exosome piRNA as a biomarker in marine animals is hardly reported, and the invention develops a method for extracting and primarily applying exosome from the source of seminal plasma represented by cynoglossus semilaevis, and solves the problem of identification of the genetic sex of the male cynoglossus semilaevis and the pseudo-male fish.
The technical problem to be solved by the invention is realized by adopting the following technical scheme:
an application of a cynoglossus semilaevis sex label piR-mmu-31018127 is disclosed, wherein the sex label piR-mmu-31018127 is derived from plasma exosome piRNA of cynoglossus semilaevis, and the sequence is GCATGTGGTTCAGTGGTAGAATTCTCGCCG.
The invention also provides a screening method of the seminal plasma exosome piR-mmu-31018127, which comprises the following specific steps:
1) after the seminal plasma exosomes are separated and identified, sequencing analysis is carried out on the seminal plasma exosome smallrnas, Small RNAs are various, clean reads are sequentially compared with an Rfam database, a cDNA sequence, a species repetitive sequence library and a piRBase database, so that the smallrnas in a sequencing result are classified and annotated; comparing the annotated sequence with a piRBase database, and carrying out statistics on known piRNA; carrying out new piRNA prediction, piRNA differential expression analysis, pathway enrichment analysis and function enrichment analysis of differential expression piRNA target genes by using the unannotated sequences, finally carrying out correlation matching with male fish and pseudo-male fish samples, and screening out one or more piRNAs which have indication effects on the male fish and the pseudo-male fish samples and serve as candidate biomarkers;
2) two validation samples were taken: quantitatively detecting the differential expression condition of candidate piRNA by using a MicroRNA quantitative analysis kit for the total RNA of the sperms of the male fish and the pseudo-male fish identified by the peripheral blood chromosome, and screening the piRNA with the most label indication function as the final label piRNA; according to the statistical analysis principle, the P value less than 0.05 is a significant difference; the piRNA biomarker piR-mmu-31018127 with sequence GCATGTGGTTCAGTGGTAGAATTCTCGCCG was screened for differential expression in males and pseudomales.
The invention provides a detection kit for male cynoglossus semilaevis and pseudo-male fish, which is characterized in that: the kit comprises piR-mmu-31018127 quantitative detection primers, wherein the primer sequences are F: TACGCATGTGGTTCAGTGGT and R: TCGTATCCAGTGCAGGGTC; the reverse transcription primer is piR-mmu-31018127-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCGAGA, respectively; and other PCR reverse transcription reagents and qRT-PCR fluorescent quantitative reagents, wherein the internal reference piR is U6. The primer of U6 is U6-F: CTCGCTTCGGCAGCACATATACT, respectively; U6-R: ACGCTTCACGAATTTGCGTGTC are provided.
Furthermore, the 5 'end of the primer probe sequence is marked with a fluorescent group, and the 3' end is marked with a quenching group, so that the detection is carried out by a method suitable for Taqman probe-based qRT-PCR.
Compared with the prior art, the invention has the beneficial effects
The invention innovatively applies the semen exosome piRNA to carry out the sex identification of the cynoglossus semilaevis, develops a detection kit, belongs to the first time in aquatic animals, has the advantages of no wound and high efficiency, has reliable identification result, and is used for distinguishing the genetic sex of the cynoglossus semilaevis by quantitative detection for the first time.
Drawings
FIG. 1 shows qRT-PCR expression of the marker piRNA of the present invention after being verified by 20 verification samples;
FIG. 2 mean values of qRT-PCR expression in two groups of samples after validation of 20 validation samples according to the present invention.
Detailed Description
The present invention will be described in further detail with reference to specific embodiments, which are illustrative only and not intended to be limiting, and the scope of the present invention is not limited thereby.
Example 1
A screening method of cynoglossus semilaevis semen-derived exosome piR-mmu-31018127 as a biomarker.
1. Semen sample collection
Collecting 0.5ml of sperm of male fish of sexual maturity of cynoglossus semilaevis in a centrifuge tube for exosome separation and identification.
2. Exosome extraction
(1) Transferring 0.5ml semen sample to 1.5ml EP tube, placing at 4 deg.C, centrifuging at 1200g for 15min to remove sperm cells, centrifuging at 4 deg.C at 15000g for 20min to remove small cell impurities and debris, diluting with PBS 1 times, pre-filtering with 0.45um filter membrane, and filtering the filtrate with 0.22um filter membrane.
(2) The filtered sample was used to extract exosomes using Total Exosome Isolation Kit.
(3) The lysates were collected and transferred completely to a rnase-free 2ml tube.
3. Identification of exosomes: and (4) observing by using a Hitachi H600IV transmission electron microscope, and analyzing and identifying by using the transmission electron microscope, wherein the rest sample is used for RNA extraction and sequencing analysis.
4. PiRNA sequencing analysis of exosomes
And (3) extracting RNA of the seminal plasma exosomes by a TRizol method, and sequencing and analyzing the smallRNA of the seminal plasma exosomes. Small RNAs are various in types, including miRNA, tRNA (tirRNA, tRNAs), rRNA, piRNA, snorRNA and the like, a Small RNA library is constructed after quality inspection, sequencing is carried out based on an illumina platform, data filtering analysis is carried out after sequencing is completed, and clean reads are sequentially compared and annotated with an Rfam database, a cDNA sequence, a species repetitive sequence library and a piRBase database. The filtered sequences were aligned with the piRBase database and statistics of known pirnas were performed. And performing new piRNA prediction, piRNA differential expression analysis, pathway enrichment analysis and function enrichment analysis of the target gene of the differentially expressed piRNA by using the unannotated sequence, and finally performing correlation matching with two samples, namely a male fish sample and a pseudo-male fish sample, and screening out one or more piRNAs which have indication effects on the two samples of the male fish and the pseudo-male fish as candidate biomarkers.
5. Real-time fluorescent quantitative PCR analysis verification
Extracting the total RNA of exosomes from the seminal plasma of the male fish and the pseudo-male fish, quantitatively detecting the expression condition of the piRNA in two samples to be detected by utilizing a MicroRNA quantitative analysis kit, and selecting 2 from U6 which has stable and high expression in two groups of samples by internal reference-ΔΔCtAnd performing calculation analysis. The piRNA biomarker piR-mmu-31018127 with sequence GCATGTGGTTCAGTGGTAGAATTCTCGCCG was screened for differential expression in males and pseudomales.
Example 2
Kit for identifying male fish and pseudo-male fish by cynoglossus semilaevis semen exosome miRNA marker
The identification kit based on the semen exosome piRNA marker piR-mmu-31018127 comprises piR-mmu-31018127 quantitative detection primers, F: TACGCATGTGGTTCAGTGGT and R: TCGTATCCAGTGCAGGGTC, wherein the reverse transcription primers are piR-mmu-31018127-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCGAGA, and other PCR reverse transcription reagents and PCR fluorescent quantitative reagents, wherein the internal reference piR is U6, and the primers are U6-F: CTCGCTTCGGCAGCACATATACT, respectively; U6-R: ACGCTTCACGAATTTGCGTGTC, respectively; the primers comprise reverse transcription primers, quantitative PCR forward primers and reverse primers, and furthermore the kit comprises other conventional reagents for quantitative PCR reactions: reverse transcriptase, Taq enzyme, dNTP, buffer, Mgcl2DEPC water and control. The reaction system applied by the kit is a 10ul system, namely 0.5ul 10 x miRNA primer probe, 5ul 2 x Master mix,2.5ul ddH2O, 2ul cDNA template. The real-time fluorescent quantitative PCR detection of Q6 of Thermo fisher is used, and the reaction program is as follows: 2min at 95 ℃; the temperature is 95 ℃ for 10s, the temperature is 59 ℃ for 60s, and the circulation is carried out for 40 times. The samples were tested in 3 replicates. The expression conditions of the labeled piRNAs of the cynoglossus semilaevis pseudo-male fish and the cynoglossus semilaevis male fish confirmed by the chromosome, namely piR-mmu-31018127, are detected by using the screened piR-mmu-31018127 quantitative detection primer and the reverse transcription primer, and the results are shown in Table 1, figure 1 and figure 2. The expression difference of the label in two groups of samples is very obvious (p is less than 0.01), and the detection accuracy rate of the label piRNA is verified to be more than 90%.
TABLE 1-20 validation sample qRT-PCR expression data results
For those skilled in the art, the conception and the technical point of the present invention may be changed, and the corresponding changes should be covered by the claims of the present invention.
Sequence listing
<110> Tianjin Bohai sea aquatic product research institute
<120> application of cynoglossus semilaevis exosome piR-mmu-31018127
<160> 6
<170> SIPOSequenceListing 1.0
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ctcgcttcgg cagcacatat act 23
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
acgcttcacg aatttgcgtg tc 22
<210> 3
<211> 30
<212> DNA
<213> Cynoglossus semilaevis Gunther (Cynoglossus semilaevis Gunther)
<400> 3
gcatgtggtt cagtggtaga attctcgccg 30
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tcgtatccag tgcagggtc 19
<210> 6
<211> 51
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 6
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacggcgag a 51
Claims (2)
1. An application of a cynoglossus semilaevis sex label piR-mmu-31018127 in sex identification is disclosed, wherein the sex label piR-mmu-31018127 is derived from cynoglossus semilaevis seminal plasma exosome piRNA, and the sequence is GCATGTGGTTCAGTGGTAGAATTCTCGCCG.
2. The application of cynoglossus semilaevis sex label piR-mmu-31018127 in sex determination according to claim 1, wherein the screening method of seminal plasma exosome piRNA comprises the following steps:
1) after the seminal plasma exosomes are separated and identified, sequencing analysis is carried out on the seminal plasma exosome smallrnas, Small RNAs are various, clean reads are sequentially compared with an Rfam database, a cDNA sequence, a species repetitive sequence library and a piRBase database, so that the smallrnas in a sequencing result are classified and annotated; comparing the annotated sequence with a piRBase database, and carrying out statistics on known piRNA; carrying out new piRNA prediction, piRNA differential expression analysis, pathway enrichment analysis and function enrichment analysis of differential expression piRNA target genes by using the unannotated sequences, finally carrying out correlation matching with male fish and pseudo-male fish samples, and screening out one or more piRNAs which have indication effects on the male fish and the pseudo-male fish samples and serve as candidate biomarkers;
2) two random sets of validation samples were extracted: quantitatively detecting the differential expression condition of candidate piRNA by using a MicroRNA quantitative analysis kit for the total RNA of the sperms of the male fish and the pseudo-male fish identified by the peripheral blood chromosome, and screening the piRNA with the most label indication function as the final label piRNA; according to the statistical analysis principle, the P value less than 0.05 is a significant difference; the piRNA biomarker piR-mmu-31018127 with sequence GCATGTGGTTCAGTGGTAGAATTCTCGCCG was screened for differential expression in males and pseudomales.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811020132.5A CN108998545B (en) | 2018-09-03 | 2018-09-03 | Application of cynoglossus semilaevis exosome piR-mmu-31018127 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811020132.5A CN108998545B (en) | 2018-09-03 | 2018-09-03 | Application of cynoglossus semilaevis exosome piR-mmu-31018127 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108998545A CN108998545A (en) | 2018-12-14 |
| CN108998545B true CN108998545B (en) | 2021-04-27 |
Family
ID=64590302
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811020132.5A Expired - Fee Related CN108998545B (en) | 2018-09-03 | 2018-09-03 | Application of cynoglossus semilaevis exosome piR-mmu-31018127 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108998545B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113539367B (en) * | 2021-01-22 | 2023-11-03 | 南京集思慧远生物科技有限公司 | Mammalian piRNA data analysis method based on second-generation high-throughput sequencing |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105483218A (en) * | 2015-12-11 | 2016-04-13 | 南京大学 | Seminal plasma piRNA markers or their combination for detecting and/or predicting male reproductive dysfunction and application thereof |
-
2018
- 2018-09-03 CN CN201811020132.5A patent/CN108998545B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105483218A (en) * | 2015-12-11 | 2016-04-13 | 南京大学 | Seminal plasma piRNA markers or their combination for detecting and/or predicting male reproductive dysfunction and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Detailed information of piRNA piR-mmu-31018127;佚名;《piRBase》;20140930;参见方框标注处 * |
| Identification and application of piwi-interacting RNAs from seminal plasma exosomes in Cynoglossus semilaevis;Bo Zhang;《BMC Genomics》;20200415;第21卷(第302期);第1-11页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108998545A (en) | 2018-12-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105506111B (en) | Method for detecting CNV (CNV) marker of MAPK10 gene of Nanyang cattle and application of CNV marker | |
| CN111471775B (en) | Specific DNA fragment SSM2 for sturgeon gender identification and application | |
| CN116287173B (en) | Application of sex tags, primers and kit of high-body Seriola exosome microRNAs | |
| CN109055520B (en) | Cynoglossus semilaevis exosome differential expression label and kit | |
| CN109136388B (en) | MicroRNA label of cynoglossus semilaevis differential expression and application | |
| CN115161320B (en) | miRNA for detecting sex of high-body Seriola, kit and application | |
| CN111471756A (en) | Specific DNA fragment SSM1 for sturgeon gender identification and application | |
| CN108998545B (en) | Application of cynoglossus semilaevis exosome piR-mmu-31018127 | |
| CN109112194B (en) | Application of cynoglossus semilaevis sex label piR-mmu-72274 | |
| CN113789394A (en) | Molecular marker C13 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN111154852B (en) | Specific DNA fragment for sex identification of spiny eels and application thereof | |
| KR101767644B1 (en) | Composition and method for prediction of pigs litter size using gene expression profile | |
| CN109082463B (en) | Cynoglossus semilaevis exosome microRNA for indicating sex and kit | |
| CN109055521B (en) | Application of cynoglossus semilaevis gender difference indication label microRNA | |
| CN109971863B (en) | Application of cynoglossus semilaevis sex tag piR-mmu-29271668 | |
| CN108998510B (en) | Application of cynoglossus semilaevis sex label piR-xtr-979116 | |
| CN113801945B (en) | Molecular marker C768 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN110564863B (en) | Gosling sex identification method | |
| CN113174441B (en) | Duck residual feed intake related lncRNA and application thereof | |
| CN112725427B (en) | Primer, fluorescent probe and kit for identifying gender of sturgeon based on fluorescent PCR | |
| CN111876497B (en) | Method for identifying or assisting in identifying quality of animal semen | |
| CN112011624B (en) | Application of miR-155 as marker in identification or auxiliary identification of animal semen quality | |
| CN110616270A (en) | COI gene sequence-based molecular identification method of beta and beta | |
| CN116515979B (en) | Application of sex tags, primers and kit for high-body Seriola serum exosome piRNAs | |
| CN115992209B (en) | High-body Seriola piRNAs sex tag, kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210427 |