CN114292876A - Recombinant adeno-associated virus of specific target astrocyte and application thereof - Google Patents
Recombinant adeno-associated virus of specific target astrocyte and application thereof Download PDFInfo
- Publication number
- CN114292876A CN114292876A CN202111486070.9A CN202111486070A CN114292876A CN 114292876 A CN114292876 A CN 114292876A CN 202111486070 A CN202111486070 A CN 202111486070A CN 114292876 A CN114292876 A CN 114292876A
- Authority
- CN
- China
- Prior art keywords
- associated virus
- recombinant adeno
- adeno
- plasmid
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a recombinant adeno-associated virus of a targeted astrocyte and application thereof, wherein the recombinant adeno-associated virus has a pAAV2/11 skeleton and is obtained by cotransfecting a packaging cell line by adeno-associated virus core plasmids, recombinant adeno-associated virus packaging plasmids and adenovirus element helper plasmids, the recombinant adeno-associated virus core plasmids comprise inverted terminal repetitive sequences ITR at two ends, a GfaABC1D promoter, an exogenous gene, a transcription regulating element WPRE and a transcription termination sequence SV40polyA, and the recombinant adeno-associated virus packaging plasmids comprise a Rep gene of type 2 adeno-associated virus and a Cap gene of type 11 adeno-associated virus. The invention realizes the specific targeting of astrocytes by taking pAAV2/11 as a gene transfer vector for the first time, provides better tools and technical support for neuroscience research, disease model establishment, gene therapy and the like, and has wide application value and market prospect.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a recombinant adeno-associated virus of a specific target astrocyte and application thereof.
Background
The brain network is composed of a variety of nerve cells, which mainly include two major classes of neurons and glial cells (neuroglia), each playing a different role in the brain. The number of glial cells is several tens of times greater than that of neurons, and can be generally classified into microglia, astrocytes, oligodendrocytes, and the like. With the development of neuroscience, different types of nerve cells are found to have different network structure connection and functions, and the variation of the nerve cells can cause different brain diseases and behavior disorders. There is increasing evidence that astrocytes are associated with various brain diseases (Nature.2014; 509(7499): 189-. Therefore, there is a need to develop a tool for specifically targeting astrocytes, which is used to analyze the structure and function of astrocytes and provide theoretical basis and technical support for the treatment of brain diseases.
Currently, researchers rely mainly on transgenic animals for the analysis of astrocytes. However, transgenic animals, such as mice, rats, dogs, pigs, monkeys, etc., have long breeding cycles, high feeding costs, and are not flexible to carry the target gene for neuronal cell manipulation and disease treatment. Therefore, it is of great importance to continue to develop methods capable of specifically targeting astrocytes.
Disclosure of Invention
In order to overcome the defects in the prior art, the invention aims to provide a recombinant adeno-associated virus specifically targeting astrocytes and application thereof.
The invention provides a recombinant adeno-associated virus core plasmid, which comprises a repetitive sequence ITR with two inverted ends, a GfaABC1D promoter, a foreign gene, a transcription regulatory element WPRE and a transcription termination sequence SV40 polyA.
Further, the exogenous gene includes a reporter gene;
preferably, the reporter gene is EGFP.
Further, the nucleotide sequence of the recombinant adeno-associated virus core plasmid is shown as SEQ ID NO: 3, respectively.
The second aspect of the invention provides a recombinant adeno-associated virus vector system, which comprises the adeno-associated virus core plasmid, recombinant adeno-associated virus packaging plasmid and adenovirus element helper plasmid.
Further, the recombinant adeno-associated virus packaging plasmid comprises a Rep gene of adeno-associated virus type 2 and a Cap gene of adeno-associated virus type 11;
preferably, the recombinant adeno-associated virus packaging plasmid takes pAAV-RC2/1 as a framework;
preferably, the adenovirus element Helper plasmid is pAd-Helper.
Further, the nucleotide sequence of the recombinant adeno-associated virus packaging plasmid is shown as SEQ ID NO: 4, respectively.
The third aspect of the invention provides a recombinant adeno-associated virus, which is obtained by cotransfecting a packaging cell line with the adeno-associated virus core plasmid, the recombinant adeno-associated virus packaging plasmid and the adenovirus element helper plasmid.
Further, the packaging cell line is selected from HEK-293 cells, HEK-293T cells or HEK-293FT cells;
preferably, the molecular number of the adeno-associated virus core plasmid, the recombinant adeno-associated virus packaging plasmid and the adenovirus element helper plasmid is 1:1: 1.
Further, the recombinant adeno-associated virus packaging plasmid comprises a Rep gene of adeno-associated virus type 2 and a Cap gene of adeno-associated virus type 11;
preferably, the recombinant adeno-associated virus packaging plasmid takes pAAV-RC2/1 as a framework;
preferably, the nucleotide sequence of the recombinant adeno-associated virus packaging plasmid is as shown in SEQ ID NO: 4 is shown in the specification;
preferably, the adenovirus element Helper plasmid is pAd-Helper.
The fourth aspect of the present invention provides the use of the recombinant adeno-associated virus core plasmid, the recombinant adeno-associated virus vector system or the recombinant adeno-associated virus in specific targeting of astrocytes.
The invention has the beneficial effects that;
the invention realizes the specific targeting of astrocytes by taking pAAV2/11 as a gene transfer vector for the first time, provides better tools and technical support for neuroscience research, disease model establishment, gene therapy and the like, and has wide application value and market prospect.
Drawings
FIG. 1 is a map of recombinant adeno-associated virus core plasmid expression vector.
FIG. 2 is a graph of the signals of recombinant adeno-associated virus infecting the dorsal hippocampal region. Wherein "DAPI" represents a signal to stain the nucleus, blue fluorescence; "GFAP" represents a signal after staining an astrocyte marker GFAP, and is red fluorescence; the EGFP represents a cell signal marked by rAAV2/11-GFaABC1D-EGFP-WPRE-SV40polyA, is green fluorescence and is marked together with red fluorescence.
Detailed Description
In order that the invention may be more clearly understood, it will now be further described with reference to the following examples and the accompanying drawings. The examples are for illustration only and do not limit the invention in any way. In the examples, each raw reagent material is commercially available, and the experimental method not specifying the specific conditions is a conventional method and a conventional condition well known in the art, or a condition recommended by an instrument manufacturer.
Example 1: construction of recombinant adeno-associated virus core plasmid
BglII and NheI (NewEngland Biolabs) restriction endonuclease was used to digest vector pZacc 2.1-GfaABC1D-rM 3D-mChery-SV 40polyA (purchased from Addgene, accession number: 92285), a gel recovery kit (Omega) was used to recover the GfaABC1D promoter fragment, T4 ligase (purchased from TaKaRa) was used to ligate the adeno-associated viral vector AV-hSyn-EGFP-WPRE-SV40polyA (Blindac Biotech, Inc.) which was also double digested with BglII and NheI, the ligation product was used to transform E.coli Stbl3 competent cells, which were placed in a 35 ℃ incubator overnight, a single clone was selected for colony PCR identification, and the primers were GfaABC1D-F (SEQ ID NO.1) and GfaABC1D-R (SEQ ID NO.2), and performing amplification culture and plasmid extraction on the positive colonies, performing double enzyme digestion verification and sequencing on the plasmids by BglII and NheI, and naming the correctly sequenced plasmid as pAAV-GFaABC1D-EGFP-WPRE-SV40 polyA. The map of the constructed recombinant adeno-associated virus core plasmid pAAV-GFaABC1D-EGFP-WPRE-SV40polyA expression vector is shown in figure 1, and the gene sequence is shown in SEQ ID NO. 3. All PCR-based primer synthesis and sequencing used in the present invention were performed by Biotechnology engineering (Shanghai) Inc.
Example 2: preparation of recombinant adeno-associated virus
Packaging the recombinant adeno-associated virus by using a recombinant adeno-associated virus packaging plasmid pAAV-RC2/11 expression vector, and mixing a recombinant adeno-associated virus core plasmid pAAV-GFaABC1D-EGFP-WPRE-SV40polyA, a pAAV-RC2/11 serotype AAV capsid plasmid and an adenovirus element Helper plasmid pAd-Helper according to the plasmid molecular number of 1:1:1 co-transfecting HEK-293T cells, collecting supernatant and cell sediment after transfecting for 72 hours, concentrating and purifying by iodixanol gradient centrifugation, and finally detecting the titer of recombinant adeno-associated virus by SYBRGreenqPCR (systematic amplified polymorphic nucleic acid) method to finally obtain rAAV2/11-GFaABC1D-EGFP-WPRE-SV40polyA virus with the titer of 6.0 multiplied by 1012VG/mL。
The recombinant adeno-associated virus packaging plasmid pAAV-RC2/11 has the nucleotide sequence shown in SEQ ID NO: 4.
Example 3: in vivo use of recombinant adeno-associated virus
Prepared rAAV2/11-GFaABC1D-EGFP-WPRE-SV40polyA (100 nL/single) virus is injected into the dorsal hippocampal region of 8-10 week-old C57BL/6 mice (purchased from Hunan Sleka Jingida laboratory animals Co., Ltd.) in a brain stereotactic manner, the brain is perfused and taken after 3 weeks, the mouse brain tissue is fixed by a PFA solution treated by DEPC for 4 hours and then dehydrated by a 30% sucrose-PBS solution treated by DEPC for 48 hours, and the dehydrated brain tissue is fully embedded by a tissue embedding medium and cut into brain slices with the thickness of 40 mu m by a freezing microtome. Brain slices containing dorsal hippocampal regions were immunohistochemically stained with GFAP antibody, after which they were mounted and imaged using a slide scanner microscope. In vivo detection results show that a green fluorescent signal marked by rAAV2/11-GFaABC1D-EGFP-WPRE-SV40polyA and a red signal of an astrocyte marker GFAP are labeled together, and the rAAV2/11-GFaABC1D-EGFP-WPRE-SV40polyA recombinant adeno-associated virus can specifically target astrocytes. FIG. 2 shows signals of rAAV2/11-GFaABC1D-EGFP-WPRE-SV40polyA recombinant adeno-associated virus infecting the dorsal hippocampus.
It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.
The nucleotide sequence of the invention is as follows:
SEQ ID NO:1
aacatatcctggtgtggagt
SEQ ID NO:2
gctagcctatagtgagtcgta
SEQ ID NO:3
cgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccagatttaattaaggccttaattaggctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttccttgtagttaatgattaacccgccatgctacttatctacgtagccatgctctaggaagatctaacatatcctggtgtggagtaggggacgctgctctgacagaggctcgggggcctgagctggctctgtgagctggggaggaggcagacagccaggccttgtctgcaagcagacctggcagcattgggctggccgccccccagggcctcctcttcatgcccagtgaatgactcaccttggcacagacacaatgttcggggtgggcacagtgcctgcttcccgccgcaccccagcccccctcaaatgccttccgagaagcccattgagcagggggcttgcattgcaccccagcctgacagcctggcatcttgggataaaagcagcacagccccctaggggctgcccttgctgtgtggcgccaccggcggtggagaacaaggctctattcagcctgtgcccaggaaaggggatcaggggatgcccaggcatggacagtgggtggcagggggggagaggagggctgtctgcttcccagaagtccaaggacacaaatgggtgaggggagagctctccccatagctgggctgcggcccaaccccaccccctcaggctatgccagggggtgttgccaggggcacccgggcatcgccagtctagcccactccttcataaagccctcgcatcccaggagcgagcagagccagagcaggttggagaggagacgcatcacctccgctgctcgcaagctttattgcggtagtttatcacagttaaattgctaacgcagtcagtgcttctgacacaacagtctcgaacttaagctgcagaagttggtcgtgaggcactgggcaggtaagtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcttgtcgagacagagaagactcttgcgtttctgataggcacctattggtcttactgacatccactttgcctttctctccacaggtgtccactcccagttcaattacagctcttaaggctagagtacttaatacgactcactataggctagcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaagtcgacaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctatgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcgcggccgcttcgagcagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggagatgtgggaggttttttaaagcaagtaaaacctctacaaatgtggtaaaatcgataaggatcttcctagagcatggctacgtagataagtagcatggcgggttaatcattaactacaaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagccttaattaacctaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaata
SEQ ID NO:4
gctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattgggtaccgggccccccctcgaggtcgacggtatcgggggagctcgcagggtctccattttgaagcgggaggtttgaacgcgcagccgccatgccggggttttacgagattgtgattaaggtccccagcgaccttgacgagcatctgcccggcatttctgacagctttgtgaactgggtggccgagaaggaatgggagttgccgccagattctgacatggatctgaatctgattgagcaggcacccctgaccgtggccgagaagctgcagcgcgactttctgacggaatggcgccgtgtgagtaaggccccggaggctcttttctttgtgcaatttgagaagggagagagctacttccacatgcacgtgctcgtggaaaccaccggggtgaaatccatggttttgggacgtttcctgagtcagattcgcgaaaaactgattcagagaatttaccgcgggatcgagccgactttgccaaactggttcgcggtcacaaagaccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagtatttaagcgcctgtttgaatctcacggagcgtaaacggttggtggcgcagcatctgacgcacgtgtcgcagacgcaggagcagaacaaagagaatcagaatcccaattctgatgcgccggtgatcagatcaaaaacttcagccaggtacatggagctggtcgggtggctcgtggacaaggggattacctcggagaagcagtggatccaggaggaccaggcctcatacatctccttcaatgcggcctccaactcgcggtcccaaatcaaggctgccttggacaatgcgggaaagattatgagcctgactaaaaccgcccccgactacctggtgggccagcagcccgtggaggacatttccagcaatcggatttataaaattttggaactaaacgggtacgatccccaatatgcggcttccgtctttctgggatgggccacgaaaaagttcggcaagaggaacaccatctggctgtttgggcctgcaactaccgggaagaccaacatcgcggaggccatagcccacactgtgcccttctacgggtgcgtaaactggaccaatgagaactttcccttcaacgactgtgtcgacaagatggtgatctggtgggaggaggggaagatgaccgccaaggtcgtggagtcggccaaagccattctcggaggaagcaaggtgcgcgtggaccagaaatgcaagtcctcggcccagatagacccgactcccgtgatcgtcacctccaacaccaacatgtgcgccgtgattgacgggaactcaacgaccttcgaacaccagcagccgttgcaagaccggatgttcaaatttgaactcacccgccgtctggatcatgactttgggaaggtcaccaagcaggaagtcaaagactttttccggtgggcaaaggatcacgtggttgaggtggagcatgaattctacgtcaaaaagggtggagccaagaaaagacccgcccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgcggaagcttcgatcaactacgcagacaggtaccaaaacaaatgttctcgtcacgtgggcatgaatctgatgctgtttccctgcagacaatgcgagagaatgaatcagaattcaaatatctgcttcactcacggacagaaagactgtttagagtgctttcccgtgtcagaatctcaacccgtttctgtcgtcaaaaaggcgtatcagaaactgtgctacattcatcatatcatgggaaaggtgccagacgcttgcactgcctgcgatctggtcaatgtggatttggatgactgcatctttgaacaataaatgatttaaatcaggtatggctgctgacggttatcttccagattggctcgaggacaacctctctgagggcattcgcgagtggtgggacctgaaacctggagccccgaagcccaaggccaaccagcagaagcaggacgacggccggggtctggtgcttcctggctacaagtacctcggacccttcaacggactcgacaagggggagcccgtcaacgcggcggacgcagcggccctcgagcacgacaaggcctacgaccagcagctcaaagcgggtgacaatccgtacctgcggtataaccacgccgacgccgagtttcaggagcgtctgcaagaagatacgtcttttgggggcaacctcgggcgagcagtcttccaggccaagaagagggtactcgaacctctgggcctggttgaagaaggtgctaaaacggctcctggaaagaagagaccgttagagtcaccacaagagcccgactcctcctcgggcatcggcaaaaaaggcaaacaaccagccagaaagaggctcaactttgaagaggacactggagccggagacggaccccctgaaggatcagataccagcgccatgtcttcagacattgaaatgcgtgcagcaccgggcggaaatgctgtcgatgcgggacaaggttccgatggagtgggtaatgcctcgggtgattggcattgcgattccacctggtctgagggcaaggtcacaacaacctcgaccagaacctgggtcttgcccacctacaacaaccacttgtacctgcgtctcggaacaacatcaagcagcaacacctacaacggattctccaccccctggggatattttgacttcaacagattccactgtcacttctcaccacgtgactggcaaagactcatcaacaacaactggggactacgaccaaaagccatgcgcgttaaaatcttcaatatccaagttaaggaggtcacaacgtcgaacggcgagactacggtcgctaataaccttaccagcacggttcagatatttgcggactcgtcgtatgagctcccgtacgtgatggacgctggacaagaggggagcctgcctcctttccccaatgacgtgttcatggtgcctcaatatggctactgtggcatcgtgactggcgagaatcagaaccaaacggacagaaacgctttctactgcctggagtattttccttcgcaaatgttgagaactggcaacaactttgaaatggcttacaactttgagaaggtgccgttccactcaatgtatgctcacagccagagcctggacagactgatgaatcccctcctggaccagtacctgtggcacttacagtcgactacctctggagagactctgaatcaaggcaatgcagcaaccacatttggaaaaatcaggagtggagactttgccttttacagaaagaactggctgcctgggccttgtgttaaacagcagagattctcaaaaactgccagtcaaaattacaagattcctgccagcgggggcaacgctctgttaaagtatgacacccactataccttaaacaaccgctggagcaacatcgcgcccggacctccaatggccacagccggaccttcggatggggacttcagtaacgcccagcttatattccctggaccatctgttaccggaaatacaacaacttcagccaacaatctgttgtttacatcagaagaagaaattgctgccaccaacccaagagacacggacatgtttggccagattgctgacaataatcagaatgctacaactgctcccataaccggcaacgtgactgctatgggagtgctgcctggcatggtgtggcaaaacagagacatttactaccaagggccaatttgggccaagatcccacacgcggacggacattttcatccttcaccgctgattggtgggtttggactgaaacacccgcctccccagatattcatcaagaacactcccgtacctgccaatcctgcgacaaccttcactgcagccagagtggactctttcatcacacaatacagcaccggccaggtcgctgttcagattgaatgggaaattgaaaaggaacgctccaaacgctggaatcctgaagtgcagtttacttcaaactatgggaaccagtcttctatgttgtgggctcctgatacaactgggaagtatacagagccgcgggttattggctctcgttatttgactaatcatttgtaattacgtgttaatcaataaaccggttgattcgtttcagttgaactttggtctcctgtccttcttatcttatcggttaccatggttatagcttacacattaactgcttggttgcgcttcgcgataaaagacttacgtcatcgggttacccctagggggatccactagttctagaggtcctgtattagaggtcacgtgagtgttttgcgacattttgcgacaccatgtggtcacgctgggtatttaagcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgcgcagccgccaagccgaattctgcagatatccatcacactggcggccgctcgactagagcggccgccaccgcggtggagctccagcttttgttccctttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcag
SEQUENCE LISTING
<110> Shenzhen advanced technology research institute of Chinese academy of sciences
<120> recombinant adeno-associated virus of specific target astrocyte and application thereof
<130> CP121011174C
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
aacatatcct ggtgtggagt 20
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence
<400> 2
gctagcctat agtgagtcgt a 21
<210> 3
<211> 5737
<212> DNA
<213> Artificial sequence
<400> 3
cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt 60
cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct cactcattag 120
gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat tgtgagcgga 180
taacaatttc acacaggaaa cagctatgac catgattacg ccagatttaa ttaaggcctt 240
aattaggctg cgcgctcgct cgctcactga ggccgcccgg gcaaagcccg ggcggcctca 300
gtgagcgagc gagcgcgcag agagggagtg gccaactcca tcactagggg ttccttgtag 360
ttaatgatta acccgccatg ctacttatct acgtagccat gctctaggaa gatctaacat 420
atcctggtgt ggagtagggg acgctgctct gacagaggct cgggggcctg agctggctct 480
gtgagctggg gaggaggcag acagccaggc cttgtctgca agcagacctg gcagcattgg 540
gctggccgcc ccccagggcc tcctcttcat gcccagtgaa tgactcacct tggcacagac 600
acaatgttcg gggtgggcac agtgcctgct tcccgccgca ccccagcccc cctcaaatgc 660
cttccgagaa gcccattgag cagggggctt gcattgcacc ccagcctgac agcctggcat 720
cttgggataa aagcagcaca gccccctagg ggctgccctt gctgtgtggc gccaccggcg 780
gtggagaaca aggctctatt cagcctgtgc ccaggaaagg ggatcagggg atgcccaggc 840
atggacagtg ggtggcaggg ggggagagga gggctgtctg cttcccagaa gtccaaggac 900
acaaatgggt gaggggagag ctctccccat agctgggctg cggcccaacc ccaccccctc 960
aggctatgcc agggggtgtt gccaggggca cccgggcatc gccagtctag cccactcctt 1020
cataaagccc tcgcatccca ggagcgagca gagccagagc aggttggaga ggagacgcat 1080
cacctccgct gctcgcaagc tttattgcgg tagtttatca cagttaaatt gctaacgcag 1140
tcagtgcttc tgacacaaca gtctcgaact taagctgcag aagttggtcg tgaggcactg 1200
ggcaggtaag tatcaaggtt acaagacagg tttaaggaga ccaatagaaa ctgggcttgt 1260
cgagacagag aagactcttg cgtttctgat aggcacctat tggtcttact gacatccact 1320
ttgcctttct ctccacaggt gtccactccc agttcaatta cagctcttaa ggctagagta 1380
cttaatacga ctcactatag gctagcgcca ccatggtgag caagggcgag gagctgttca 1440
ccggggtggt gcccatcctg gtcgagctgg acggcgacgt aaacggccac aagttcagcg 1500
tgtccggcga gggcgagggc gatgccacct acggcaagct gaccctgaag ttcatctgca 1560
ccaccggcaa gctgcccgtg ccctggccca ccctcgtgac caccctgacc tacggcgtgc 1620
agtgcttcag ccgctacccc gaccacatga agcagcacga cttcttcaag tccgccatgc 1680
ccgaaggcta cgtccaggag cgcaccatct tcttcaagga cgacggcaac tacaagaccc 1740
gcgccgaggt gaagttcgag ggcgacaccc tggtgaaccg catcgagctg aagggcatcg 1800
acttcaagga ggacggcaac atcctggggc acaagctgga gtacaactac aacagccaca 1860
acgtctatat catggccgac aagcagaaga acggcatcaa ggtgaacttc aagatccgcc 1920
acaacatcga ggacggcagc gtgcagctcg ccgaccacta ccagcagaac acccccatcg 1980
gcgacggccc cgtgctgctg cccgacaacc actacctgag cacccagtcc gccctgagca 2040
aagaccccaa cgagaagcgc gatcacatgg tcctgctgga gttcgtgacc gccgccggga 2100
tcactctcgg catggacgag ctgtacaagt aagtcgacaa tcaacctctg gattacaaaa 2160
tttgtgaaag attgactggt attcttaact atgttgctcc ttttacgcta tgtggatacg 2220
ctgctttaat gcctttgtat catgctattg cttcccgtat ggctttcatt ttctcctcct 2280
tgtataaatc ctggttgctg tctctttatg aggagttgtg gcccgttgtc aggcaacgtg 2340
gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg ttggggcatt gccaccacct 2400
gtcagctcct ttccgggact ttcgctttcc ccctccctat tgccacggcg gaactcatcg 2460
ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt gggcactgac aattccgtgg 2520
tgttgtcggg gaaatcatcg tcctttcctt ggctgctcgc ctatgttgcc acctggattc 2580
tgcgcgggac gtccttctgc tacgtccctt cggccctcaa tccagcggac cttccttccc 2640
gcggcctgct gccggctctg cggcctcttc cgcgtcttcg ccttcgccct cagacgagtc 2700
ggatctccct ttgggccgcc tccccgcgcg gccgcttcga gcagacatga taagatacat 2760
tgatgagttt ggacaaacca caactagaat gcagtgaaaa aaatgcttta tttgtgaaat 2820
ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag ttaacaacaa 2880
caattgcatt cattttatgt ttcaggttca gggggagatg tgggaggttt tttaaagcaa 2940
gtaaaacctc tacaaatgtg gtaaaatcga taaggatctt cctagagcat ggctacgtag 3000
ataagtagca tggcgggtta atcattaact acaaggaacc cctagtgatg gagttggcca 3060
ctccctctct gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc 3120
cgggctttgc ccgggcggcc tcagtgagcg agcgagcgcg cagccttaat taacctaatt 3180
cactggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc 3240
gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc 3300
gcccttccca acagttgcgc agcctgaatg gcgaatggga cgcgccctgt agcggcgcat 3360
taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc tacacttgcc agcgccctag 3420
cgcccgctcc tttcgctttc ttcccttcct ttctcgccac gttcgccggc tttccccgtc 3480
aagctctaaa tcgggggctc cctttagggt tccgatttag tgctttacgg cacctcgacc 3540
ccaaaaaact tgattagggt gatggttcac gtagtgggcc atcgccctga tagacggttt 3600
ttcgcccttt gacgttggag tccacgttct ttaatagtgg actcttgttc caaactggaa 3660
caacactcaa ccctatctcg gtctattctt ttgatttata agggattttg ccgatttcgg 3720
cctattggtt aaaaaatgag ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat 3780
taacgcttac aatttaggtg gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt 3840
atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct gataaatgct 3900
tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg cccttattcc 3960
cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa 4020
agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc tcaacagcgg 4080
taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca cttttaaagt 4140
tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac tcggtcgccg 4200
catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa agcatcttac 4260
ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg ataacactgc 4320
ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt ttttgcacaa 4380
catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg aagccatacc 4440
aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc gcaaactatt 4500
aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga tggaggcgga 4560
taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta ttgctgataa 4620
atctggagcc ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc cagatggtaa 4680
gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg atgaacgaaa 4740
tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt cagaccaagt 4800
ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa ggatctaggt 4860
gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt cgttccactg 4920
agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt 4980
aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca 5040
agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac 5100
tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac 5160
atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct 5220
taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg 5280
gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga gatacctaca 5340
gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt 5400
aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta 5460
tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc 5520
gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc 5580
cttttgctgg ccttttgctc acatgttctt tcctgcgtta tcccctgatt ctgtggataa 5640
ccgtattacc gcctttgagt gagctgatac cgctcgccgc agccgaacga ccgagcgcag 5700
cgagtcagtg agcgaggaag cggaagagcg cccaata 5737
<210> 4
<211> 7400
<212> DNA
<213> Artificial sequence
<400> 4
gctgcgcaac tgttgggaag ggcgatcggt gcgggcctct tcgctattac gccagctggc 60
gaaaggggga tgtgctgcaa ggcgattaag ttgggtaacg ccagggtttt cccagtcacg 120
acgttgtaaa acgacggcca gtgagcgcgc gtaatacgac tcactatagg gcgaattggg 180
taccgggccc cccctcgagg tcgacggtat cgggggagct cgcagggtct ccattttgaa 240
gcgggaggtt tgaacgcgca gccgccatgc cggggtttta cgagattgtg attaaggtcc 300
ccagcgacct tgacgagcat ctgcccggca tttctgacag ctttgtgaac tgggtggccg 360
agaaggaatg ggagttgccg ccagattctg acatggatct gaatctgatt gagcaggcac 420
ccctgaccgt ggccgagaag ctgcagcgcg actttctgac ggaatggcgc cgtgtgagta 480
aggccccgga ggctcttttc tttgtgcaat ttgagaaggg agagagctac ttccacatgc 540
acgtgctcgt ggaaaccacc ggggtgaaat ccatggtttt gggacgtttc ctgagtcaga 600
ttcgcgaaaa actgattcag agaatttacc gcgggatcga gccgactttg ccaaactggt 660
tcgcggtcac aaagaccaga aatggcgccg gaggcgggaa caaggtggtg gatgagtgct 720
acatccccaa ttacttgctc cccaaaaccc agcctgagct ccagtgggcg tggactaata 780
tggaacagta tttaagcgcc tgtttgaatc tcacggagcg taaacggttg gtggcgcagc 840
atctgacgca cgtgtcgcag acgcaggagc agaacaaaga gaatcagaat cccaattctg 900
atgcgccggt gatcagatca aaaacttcag ccaggtacat ggagctggtc gggtggctcg 960
tggacaaggg gattacctcg gagaagcagt ggatccagga ggaccaggcc tcatacatct 1020
ccttcaatgc ggcctccaac tcgcggtccc aaatcaaggc tgccttggac aatgcgggaa 1080
agattatgag cctgactaaa accgcccccg actacctggt gggccagcag cccgtggagg 1140
acatttccag caatcggatt tataaaattt tggaactaaa cgggtacgat ccccaatatg 1200
cggcttccgt ctttctggga tgggccacga aaaagttcgg caagaggaac accatctggc 1260
tgtttgggcc tgcaactacc gggaagacca acatcgcgga ggccatagcc cacactgtgc 1320
ccttctacgg gtgcgtaaac tggaccaatg agaactttcc cttcaacgac tgtgtcgaca 1380
agatggtgat ctggtgggag gaggggaaga tgaccgccaa ggtcgtggag tcggccaaag 1440
ccattctcgg aggaagcaag gtgcgcgtgg accagaaatg caagtcctcg gcccagatag 1500
acccgactcc cgtgatcgtc acctccaaca ccaacatgtg cgccgtgatt gacgggaact 1560
caacgacctt cgaacaccag cagccgttgc aagaccggat gttcaaattt gaactcaccc 1620
gccgtctgga tcatgacttt gggaaggtca ccaagcagga agtcaaagac tttttccggt 1680
gggcaaagga tcacgtggtt gaggtggagc atgaattcta cgtcaaaaag ggtggagcca 1740
agaaaagacc cgcccccagt gacgcagata taagtgagcc caaacgggtg cgcgagtcag 1800
ttgcgcagcc atcgacgtca gacgcggaag cttcgatcaa ctacgcagac aggtaccaaa 1860
acaaatgttc tcgtcacgtg ggcatgaatc tgatgctgtt tccctgcaga caatgcgaga 1920
gaatgaatca gaattcaaat atctgcttca ctcacggaca gaaagactgt ttagagtgct 1980
ttcccgtgtc agaatctcaa cccgtttctg tcgtcaaaaa ggcgtatcag aaactgtgct 2040
acattcatca tatcatggga aaggtgccag acgcttgcac tgcctgcgat ctggtcaatg 2100
tggatttgga tgactgcatc tttgaacaat aaatgattta aatcaggtat ggctgctgac 2160
ggttatcttc cagattggct cgaggacaac ctctctgagg gcattcgcga gtggtgggac 2220
ctgaaacctg gagccccgaa gcccaaggcc aaccagcaga agcaggacga cggccggggt 2280
ctggtgcttc ctggctacaa gtacctcgga cccttcaacg gactcgacaa gggggagccc 2340
gtcaacgcgg cggacgcagc ggccctcgag cacgacaagg cctacgacca gcagctcaaa 2400
gcgggtgaca atccgtacct gcggtataac cacgccgacg ccgagtttca ggagcgtctg 2460
caagaagata cgtcttttgg gggcaacctc gggcgagcag tcttccaggc caagaagagg 2520
gtactcgaac ctctgggcct ggttgaagaa ggtgctaaaa cggctcctgg aaagaagaga 2580
ccgttagagt caccacaaga gcccgactcc tcctcgggca tcggcaaaaa aggcaaacaa 2640
ccagccagaa agaggctcaa ctttgaagag gacactggag ccggagacgg accccctgaa 2700
ggatcagata ccagcgccat gtcttcagac attgaaatgc gtgcagcacc gggcggaaat 2760
gctgtcgatg cgggacaagg ttccgatgga gtgggtaatg cctcgggtga ttggcattgc 2820
gattccacct ggtctgaggg caaggtcaca acaacctcga ccagaacctg ggtcttgccc 2880
acctacaaca accacttgta cctgcgtctc ggaacaacat caagcagcaa cacctacaac 2940
ggattctcca ccccctgggg atattttgac ttcaacagat tccactgtca cttctcacca 3000
cgtgactggc aaagactcat caacaacaac tggggactac gaccaaaagc catgcgcgtt 3060
aaaatcttca atatccaagt taaggaggtc acaacgtcga acggcgagac tacggtcgct 3120
aataacctta ccagcacggt tcagatattt gcggactcgt cgtatgagct cccgtacgtg 3180
atggacgctg gacaagaggg gagcctgcct cctttcccca atgacgtgtt catggtgcct 3240
caatatggct actgtggcat cgtgactggc gagaatcaga accaaacgga cagaaacgct 3300
ttctactgcc tggagtattt tccttcgcaa atgttgagaa ctggcaacaa ctttgaaatg 3360
gcttacaact ttgagaaggt gccgttccac tcaatgtatg ctcacagcca gagcctggac 3420
agactgatga atcccctcct ggaccagtac ctgtggcact tacagtcgac tacctctgga 3480
gagactctga atcaaggcaa tgcagcaacc acatttggaa aaatcaggag tggagacttt 3540
gccttttaca gaaagaactg gctgcctggg ccttgtgtta aacagcagag attctcaaaa 3600
actgccagtc aaaattacaa gattcctgcc agcgggggca acgctctgtt aaagtatgac 3660
acccactata ccttaaacaa ccgctggagc aacatcgcgc ccggacctcc aatggccaca 3720
gccggacctt cggatgggga cttcagtaac gcccagctta tattccctgg accatctgtt 3780
accggaaata caacaacttc agccaacaat ctgttgttta catcagaaga agaaattgct 3840
gccaccaacc caagagacac ggacatgttt ggccagattg ctgacaataa tcagaatgct 3900
acaactgctc ccataaccgg caacgtgact gctatgggag tgctgcctgg catggtgtgg 3960
caaaacagag acatttacta ccaagggcca atttgggcca agatcccaca cgcggacgga 4020
cattttcatc cttcaccgct gattggtggg tttggactga aacacccgcc tccccagata 4080
ttcatcaaga acactcccgt acctgccaat cctgcgacaa ccttcactgc agccagagtg 4140
gactctttca tcacacaata cagcaccggc caggtcgctg ttcagattga atgggaaatt 4200
gaaaaggaac gctccaaacg ctggaatcct gaagtgcagt ttacttcaaa ctatgggaac 4260
cagtcttcta tgttgtgggc tcctgataca actgggaagt atacagagcc gcgggttatt 4320
ggctctcgtt atttgactaa tcatttgtaa ttacgtgtta atcaataaac cggttgattc 4380
gtttcagttg aactttggtc tcctgtcctt cttatcttat cggttaccat ggttatagct 4440
tacacattaa ctgcttggtt gcgcttcgcg ataaaagact tacgtcatcg ggttacccct 4500
agggggatcc actagttcta gaggtcctgt attagaggtc acgtgagtgt tttgcgacat 4560
tttgcgacac catgtggtca cgctgggtat ttaagcccga gtgagcacgc agggtctcca 4620
ttttgaagcg ggaggtttga acgcgcagcc gccaagccga attctgcaga tatccatcac 4680
actggcggcc gctcgactag agcggccgcc accgcggtgg agctccagct tttgttccct 4740
ttagtgaggg ttaattgcgc gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa 4800
ttgttatccg ctcacaattc cacacaacat acgagccgga agcataaagt gtaaagcctg 4860
gggtgcctaa tgagtgagct aactcacatt aattgcgttg cgctcactgc ccgctttcca 4920
gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg 4980
tttgcgtatt gggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg 5040
gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg 5100
ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa 5160
ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 5220
acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 5280
tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 5340
ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 5400
ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 5460
ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 5520
actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 5580
gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 5640
tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 5700
caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 5760
atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 5820
acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa 5880
ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta 5940
ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt 6000
tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag 6060
tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag caataaacca 6120
gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc 6180
tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt 6240
tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag 6300
ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt 6360
tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat 6420
ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt 6480
gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc 6540
ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat 6600
cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag 6660
ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt 6720
ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg 6780
gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta 6840
ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc 6900
gcgcacattt ccccgaaaag tgccacctaa attgtaagcg ttaatatttt gttaaaattc 6960
gcgttaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat cggcaaaatc 7020
ccttataaat caaaagaata gaccgagata gggttgagtg ttgttccagt ttggaacaag 7080
agtccactat taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt ctatcagggc 7140
gatggcccac tacgtgaacc atcaccctaa tcaagttttt tggggtcgag gtgccgtaaa 7200
gcactaaatc ggaaccctaa agggagcccc cgatttagag cttgacgggg aaagccggcg 7260
aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc gctggcaagt 7320
gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc gctacagggc 7380
gcgtcccatt cgccattcag 7400
Claims (10)
1. The recombinant adeno-associated virus core plasmid is characterized by comprising a repetitive sequence ITR at the two ends in opposite directions, a GfaABC1D promoter, a foreign gene, a transcription regulatory element WPRE and a transcription termination sequence SV40 polyA.
2. The recombinant adeno-associated virus core plasmid of claim 1 wherein the foreign gene comprises a reporter gene;
preferably, the reporter gene is EGFP.
3. The recombinant adeno-associated virus core plasmid according to claim 1 wherein the nucleotide sequence of the recombinant adeno-associated virus core plasmid is as set forth in SEQ ID NO: 3, respectively.
4. A recombinant adeno-associated virus vector system, comprising the adeno-associated virus core plasmid, the recombinant adeno-associated virus packaging plasmid, and the adenovirus element helper plasmid of claim 1.
5. The recombinant adeno-associated virus vector system according to claim 4 wherein the recombinant adeno-associated virus packaging plasmid comprises the Rep gene of adeno-associated virus type 2 and the Cap gene of adeno-associated virus type 11;
preferably, the recombinant adeno-associated virus packaging plasmid takes pAAV-RC2/1 as a framework;
preferably, the adenovirus element Helper plasmid is pAd-Helper.
6. The recombinant adeno-associated virus packaging plasmid of claim 5 wherein the nucleotide sequence of the recombinant adeno-associated virus packaging plasmid is as set forth in SEQ ID NO: 4, respectively.
7. A recombinant adeno-associated virus obtained by cotransfecting the packaging cell line with the adeno-associated virus core plasmid, the recombinant adeno-associated virus packaging plasmid and the adenovirus element helper plasmid of claim 1.
8. The recombinant adeno-associated virus according to claim 7 wherein the packaging cell line is selected from a HEK-293 cell, a HEK-293T cell or a HEK-293FT cell;
preferably, the molecular number of the adeno-associated virus core plasmid, the recombinant adeno-associated virus packaging plasmid and the adenovirus element helper plasmid of claim 1 is 1:1: 1.
9. The recombinant adeno-associated virus according to claim 7 wherein the recombinant adeno-associated virus packaging plasmid comprises a Rep gene of adeno-associated virus type 2 and a Cap gene of adeno-associated virus type 11;
preferably, the recombinant adeno-associated virus packaging plasmid takes pAAV-RC2/1 as a framework;
preferably, the nucleotide sequence of the recombinant adeno-associated virus packaging plasmid is as shown in SEQ ID NO: 4 is shown in the specification;
preferably, the adenovirus element Helper plasmid is pAd-Helper.
10. Use of the recombinant adeno-associated virus core plasmid according to any one of claims 1 to 3, the recombinant adeno-associated virus vector system according to any one of claims 4 to 6, or the recombinant adeno-associated virus according to any one of claims 7 to 9 for specifically targeting astrocytes.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202111486070.9A CN114292876A (en) | 2021-12-07 | 2021-12-07 | Recombinant adeno-associated virus of specific target astrocyte and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202111486070.9A CN114292876A (en) | 2021-12-07 | 2021-12-07 | Recombinant adeno-associated virus of specific target astrocyte and application thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN114292876A true CN114292876A (en) | 2022-04-08 |
Family
ID=80965258
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202111486070.9A Pending CN114292876A (en) | 2021-12-07 | 2021-12-07 | Recombinant adeno-associated virus of specific target astrocyte and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN114292876A (en) |
-
2021
- 2021-12-07 CN CN202111486070.9A patent/CN114292876A/en active Pending
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU714616B2 (en) | Recombinant vesiculoviruses and their uses | |
CN109312360B (en) | Transposon-based transfection system for primary cells | |
WO1996034625A9 (en) | Recombinant vesiculoviruses and their uses | |
CN109706185B (en) | Method for realizing gene knockout based on base editing system mutation initiation codon and application | |
CN110656123A (en) | Method for screening sgRNA high-efficiency action target based on CRISPR-Cas13d system and application | |
CN108410787A (en) | A kind of recombined bacillus subtilis of synthesis new tetroses of lactoyl-N- and its construction method and application | |
CN107043783A (en) | A kind of carrier and its application for carrying out live body positioning to mammalian cell gene group based on CRISPRCas9 systems | |
CN114702597B (en) | Construction and application of engineering bacteria for expressing plant antibacterial peptide Ct-AMP1 | |
CN114196705A (en) | Recombinant adeno-associated virus packaging plasmid, recombinant adeno-associated virus and application thereof | |
CN110938651A (en) | Targeting vector, method for constructing BAC clone by targeting and integrating exogenous gene to mouse F4/80 exon 22 site and application | |
CN113943720A (en) | Apolygus lucorum GRK gene, dsRNA thereof, synthetic method and application thereof | |
KR102009273B1 (en) | Recombinant foot-and-mouth disease virus expressing protective antigen of type O-TAW97 | |
CN114292876A (en) | Recombinant adeno-associated virus of specific target astrocyte and application thereof | |
CN114853901B (en) | Construction and application of engineering bacteria for expressing antibacterial peptide AFP1 fusion protein | |
CN114410559B (en) | Heavy metal-passivated geobacillus engineering strain and construction method thereof | |
KR100721140B1 (en) | Shuttle vectors for Leuconostoc and E. coli | |
US6689936B1 (en) | Method for evaluating a compound for its effect on skin | |
CN101899465A (en) | Recombinant J subgroup avian leucosis virus infective cloned plasmids and preparation method and application thereof | |
KR101535070B1 (en) | Recomnication expression vector of vascular growth factor and the vascular growth factor expressing stem cell line thereof | |
CN114736308A (en) | Preparation and application of coccidian antigen peptide/IL 5 fusion protein gene engineering bacteria | |
CN107287201A (en) | A kind of strong wide spectrum promoters and its application | |
KR101891602B1 (en) | Recombinant foot-and-mouth disease virus expressing protective antigen of type O, SEA and ME-SA topotype | |
CN109852589A (en) | A kind of clone of cymbidium mosaic virus strain and its transcription vector building | |
CN114181939B (en) | Recombinant coccidium vector expressing NA4 protein and fluorescent tag and detection method thereof | |
CN112481285A (en) | Synthesis method of target gene fragment |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication |