CN114292842A - Amplification primer and detection method for realizing specific qualitative PCR detection of transgenic corn 2A-7 transformation event - Google Patents
Amplification primer and detection method for realizing specific qualitative PCR detection of transgenic corn 2A-7 transformation event Download PDFInfo
- Publication number
- CN114292842A CN114292842A CN202111632695.1A CN202111632695A CN114292842A CN 114292842 A CN114292842 A CN 114292842A CN 202111632695 A CN202111632695 A CN 202111632695A CN 114292842 A CN114292842 A CN 114292842A
- Authority
- CN
- China
- Prior art keywords
- pcr
- detection
- transgenic corn
- transgenic
- qualitative
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an amplification primer for realizing specific and qualitative PCR detection of a transgenic corn 2A-7 transformation event, which comprises two specific sequence amplification primers of a transgenic corn 2A-7 transformant: 2A-7F: CGTGGACGGCCTTCATAG, respectively; 2A-7R: TGATTAGAGTCCCGCAATTATAC are provided. The invention also provides a specific qualitative PCR detection method of the transgenic corn 2A-7 transformation event, which comprises the following steps: (1) preparing a DNA template; (2) preparing a PCR reaction system; (3) carrying out PCR reaction to obtain a PCR amplification product; (4) and carrying out qualitative detection on the PCR amplification product by using agarose gel electrophoresis. The invention realizes the qualitative PCR detection with high specificity, high amplification efficiency and high sensitivity aiming at the transgenic corn 2A-7, the lower limit of the detection is 0.1 percent, and the reproducibility of different instruments and different detection personnel contrast methods is good, thus completely meeting the detection requirements of the transgenic corn 2A-7.
Description
Technical Field
The invention relates to the technical field of PCR detection, in particular to an amplification primer and a detection method for realizing specific qualitative PCR detection of a transgenic corn 2A-7 transformation event.
Background
According to the report of the international agricultural biotechnology application service organization (ISAAA), 1.904 hundred million hectares of transgenic crops are planted in 29 countries worldwide in 2019, and the method makes great contribution to global food safety, sustainability and climate change alleviation. The top five transgenic crop-growing countries around the world are the united states, brazil, argentina, canada and india, respectively, and the major growing transgenic crops are soybean, corn, cotton and oilseed rape.
Currently, with the continuous increase of the planting area of transgenic crops and the continuous improvement of the attention of global public on the safety of transgenic plants and products thereof, more than 50 countries and regions in the world including China have issued and implemented a transgenic organism identification management system, and establishing a specific, sensitive and standardized detection method for transgenic crop transformants is an important technical support for ensuring the smooth implementation of the identification management system.
The transgenic corn 2A-7 is a new transgenic corn variety independently developed by Chinese agriculture university, the variety transfers coleopteran pest resistant genes mCry1Ab and mCry2Ab into a corn inbred line hybridization combination HiII with high efficient transformation efficiency by an agrobacterium infection method, screening is carried out by using a screening marker gene bar, and then the screened inbred line is introduced into Zheng 58 to obtain the transgenic corn 2A-7 by backcross, and the modified mCry1Ab and mCry2Ab insect resistant genes have combined action to effectively inhibit the generation of resistant population. The transformant enters a productivity test and has important industrial application prospect in China.
At present, the detection method of the transgenic corn 2A-7 mainly adopts a qualitative PCR detection method based on nucleic acid and a quantitative PCR detection method (such as a primer group and a detection method which are designed by the applicant and used for the specific PCR accurate quantitative detection of the transgenic corn 2A-7 strain, and the publication number is CN112980930A), wherein the qualitative PCR detection is widely applied to each detection mechanism due to the advantages of simple operation, high efficiency, low cost and the like.
However, the existing qualitative PCR detection method aiming at the transgenic corn 2A-7 can not really meet the detection requirement, such as the following publications: the main reasons for the "corn event 2A-7 and the identification method thereof" disclosed in CN112280743A are: (1) the designed primer has the condition of amplification on other crops or other crop mixtures, so that the detection result is easy to be inaccurate; (2) the optimal amplification efficiency of the PCR method cannot be achieved without optimization of the reaction system and the reaction conditions.
Therefore, designing a qualitative PCR detection method with high specificity, high amplification efficiency and high sensitivity so as to satisfy the qualitative PCR detection of the transgenic corn 2A-7 becomes one of the main problems to be solved urgently by the technical personnel in the field.
Disclosure of Invention
The invention aims to provide an amplification primer and a detection method for realizing specific qualitative PCR detection of a transgenic corn 2A-7 transformation event, so that the qualitative PCR detection of the transgenic corn 2A-7 is met.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
the primers for realizing the specific qualitative PCR detection of the transgenic corn 2A-7 transformation event comprise two specific sequence amplification primers of a transgenic corn 2A-7 transformant:
2A-7F：CGTGGACGGCCTTCATAG
2A-7R：TGATTAGAGTCCCGCAATTATAC；
wherein, the position of the amplification primer is the RB end flank of the transgenic corn 2A-7 transformant, and the length of the target fragment is 166 bp.
Based on the amplification primers, the invention provides a specific qualitative PCR detection method of a transgenic corn 2A-7 transformation event, which comprises the following steps:
(1) preparing a DNA template;
(2) the PCR reaction was configured as follows:
| reagent | Final concentration | Volume of |
| ddH2O | — | |
| 10 |
1× | 2.5μL |
| 25mmol/L magnesium chloride solution | 1.5mmol/L | 1.5μL |
| dNTPs mixed solution (2.5 mmol/L each) | 0.2mmol/L | 2.0μL |
| 10μmol/L 2A-7F | 0.4μmol/L | 1.0μL |
| 10μmol/L 2A-7R | 0.4μmol/L | 1.0μL |
| Taq DNA polymerase | 0.025U/μL | — |
| 25mg/L DNA template | 2.0mg/L | 2.0μL |
| Total volume | 25.0μL |
In the table, "-" indicates that the volume was not determined, and if magnesium chloride was contained in the PCR buffer, the volume was determined based on the concentration of Taq enzyme without adding magnesium chloride solution, and ddH was adjusted accordingly2The volume of O is adjusted to make the total volume of the reaction system reach 25.0 mu L;
(3) carrying out PCR reaction according to the configured PCR reaction system to obtain a PCR amplification product:
(4) and (3) carrying out qualitative detection on the PCR amplification product by using agarose gel electrophoresis, wherein the lower detection limit is 0.1%.
Specifically, in the step (1), the preparation process of preparing the DNA template comprises: 100% of the 2A-7 standard sample DNA was diluted to 25 ng/. mu.L.
Specifically, the step (3) includes the steps of:
(3a) denaturing the PCR reaction system at 94 deg.c for 5 min;
(3b) continuing to denature for 30s at 94 ℃;
(3c) annealing at 58 deg.C for 30 s;
(3d) extension at 72 ℃ for 30 s;
(3e) circulating the steps (3b) to (3d)35 times;
(3f) and (3) extending for 7min at the temperature of 72 ℃ to obtain a PCR amplification product.
Specifically, the step (4) includes the steps of:
(4a) weighing 3g of agarose, adding 150ml of TAE buffer solution and 30 mu L of Biotium gel Red nucleic acid dye, and preparing 2% agarose gel;
(4b) and respectively loading 5 mu L of PCR amplification product and Marker, performing electrophoresis for 70min under the condition of 90V voltage, taking out the gel, and putting the gel into a BIO-RAD gel imaging system for image acquisition to finish the detection of the PCR amplification product.
Compared with the prior art, the invention has the following beneficial effects:
according to the invention, through analyzing the maize genome sequence, the vector sequence and the target fragment of the insertion site, 1 pair of amplification primers (2A-7F and 2A-7R) with good amplification efficiency, high specificity and good sensitivity is designed, and a PCR detection method is established, so that qualitative PCR detection with high specificity, high amplification efficiency and high sensitivity for transgenic maize 2A-7 is realized.
Moreover, on the basis of the designed amplification primer, the invention optimizes the reaction system and reaction conditions of key factors in the PCR detection method. The optimized detection method is tested and verified to have the lower limit of detection (LOD) of 0.1 percent, and the reproducibility of comparison methods of different instruments and different detection personnel is good, thereby completely reaching the international advanced level.
Therefore, the amplification primer and the PCR detection method designed by the invention can completely meet the detection requirements of the transgenic corn 2A-7, and lay a good foundation for subsequent related researches.
Drawings
FIG. 1 is a schematic diagram showing the PCR amplification result of the primers of the present invention.
FIG. 2 is a schematic diagram showing the PCR amplification results of the primers of the present invention in the DNA templates of the positive control sample, the negative control sample, the blank control sample and the specificity test sample.
FIG. 3 is a diagram showing the results of PCR amplification of the primers of the present invention in samples of six concentrations.
FIG. 4 is a schematic diagram showing the PCR amplification results under the conditions of six primer concentration gradients and five annealing temperatures by using the detection method of the present invention.
FIG. 5 is a schematic diagram showing the PCR amplification results of the detection method of the present invention in seven concentrations of the transgenic maize 2A-7DNA template.
FIG. 6 is a diagram showing the results of the detection limit test in the detection method of the present invention.
FIG. 7 is a schematic diagram showing the results of the reproducibility test of the detection method of the present invention.
Detailed Description
The invention provides an amplification primer and a detection method for realizing specific and qualitative PCR detection of a transgenic corn 2A-7 transformation event, which can well meet the detection requirement of the transgenic corn 2A-7. According to the invention, 1 pair of amplification primers (2A-7F and 2A-7R) are designed according to flanking sequences at two ends of LB and RB of a transgenic corn 2A-7 transformant and a corn genome sequence, so that a specific qualitative PCR detection method of the transgenic corn 2A-7 strain is established, the annealing temperature and the reaction system of the detection method are optimized, the optimal annealing temperature and the reaction system are adopted for carrying out sensitivity test of the method, and the lowest content value is repeatedly detected by PCR for 60 times, so that the detection lower limit of the detection method is determined.
The invention is further illustrated by the following description and examples, including but not limited to the following examples, taken in conjunction with the accompanying drawings.
Examples
Extraction and purification of genome DNA in corn seeds or leaves
According to plant genomic DNA purification kit (
Tiangen Biochemical technology (Beijing) Ltd.) Specification for DNA isolation and purification.
Second, DNA template preparation
1. Preparation of positive control sample: the standard sample DNA was diluted to 25 ng/. mu.L for use at 100% concentration.
2. Negative control sample preparation: the DNA of the non-transgenic corn, rice, soybean, rape and cotton mixed sample is diluted to 25 ng/mu L for standby.
3. Blank control sample preparation: pure water was used as a blank sample.
4. Preparation of specificity test sample DNA template: the transformant mixture of five grain crops (rice, wheat, corn, soybean and potato) contains 1% of each transformant. 13 transgenic soybean mixes: GTS40-3-2, MON89788, A5547-127, A2704-12, 356043, 305423, CV127, MON87701, MON87708, MON87769, MON87705, FG72, DAS81419-2, each 1%. 18 transgenic maize mixes: bt11, Bt176, MON810, MON863, GA21, NK603, T25, TC1507, MON89034, MON88017, 59122, MIR604, 3272, MON87460, DAS40278-9, 4114, MON87427, 5307, each 1%. 8 transgenic rice mixed samples: TT51-1, KF-6, KMD-1, M12, KF-8, KF-2, G6H1 and T1C-19, the contents of each are 1%. 7 transgenic cotton mixes: MON1445, MON531, MON15985, LLCOTTON25, MON88913, GHB614, COT102, each 1%. 10 transgenic rape mixes: MS1, MS8, RF1, RF2, RF3, T45, Oxy235, Topas19/2, MON88302, 73496. The above sample DNA was diluted to 25 ng/. mu.L for use.
5. Preparation of a sensitivity test sample DNA template: preparing 2A-7DNA with the percentage content of 10%, 5%, 2%, 1%, 0.5%, 0.1% and 0.05% respectively for later use.
Third, PCR amplification and detection
1. PCR reaction system
The PCR reaction system was configured as in Table 1:
TABLE 1
| Reagent | Final concentration | Volume of |
| ddH2O | — | |
| 10 |
1× | 2.5μL |
| 25mmol/L magnesium chloride solution | 1.5mmol/L | 1.5μL |
| dNTPs mixed solution (2.5 mmol/L each) | 0.2mmol/L | 2.0μL |
| 10μmol/L 2A-7F | 0.4μmol/L | 1.0μL |
| 10μmol/L 2A-7R | 0.4μmol/L | 1.0μL |
| Taq DNA polymerase | 0.025U/μL | — |
| 25mg/L DNA template | 2.0mg/L | 2.0μL |
| Total volume | 25.0μL |
In the table, "-" indicates that the volume was not determined, and if magnesium chloride was contained in the PCR buffer, the volume was determined based on the concentration of Taq enzyme without adding magnesium chloride solution, and ddH was adjusted accordingly2The volume of O is adjusted to make the total volume of the reaction system reach 25.0 mu L;
2. PCR reaction procedure
Denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 30s, for 35 cycles; extension at 72 ℃ for 7 min.
3. Agarose electrophoresis of PCR amplification products
Weighing 3g of agarose, adding 150ml of TAE buffer solution and 30 mu L of Biotium GelRed nucleic acid dye, preparing 2% agarose gel, respectively loading 5 mu L of PCR amplification products and Marker, performing electrophoresis for 70min under the condition of 90V voltage, taking out the gel, and putting the gel into a BIO-RAD gel imaging system for image acquisition to finish the detection of the PCR amplification products.
Fourthly, verifying the primers 2A-7F and 2A-7R:
1. FIG. 1 shows PCR amplification using maize 2A-7 genomic DNA as a template, in which primers 2A-7F and 2A-7R are orthogonally combined (hereinafter referred to as "combined primers") at numbers 3' -16. It can be seen that the combined primer has the characteristics of clear amplified bands, good specificity and good reproducibility.
2. FIG. 2 shows the specificity of the composite primers, specifically: the DNA of a specific test sample is extracted for PCR amplification, and the specificity test is carried out on the primer combination, so that the combined primer can obtain expected amplification only in the transgenic insect-resistant corn 2A-7, and the specificity is very high.
3. FIG. 3 shows the ability of the composite primers to amplify low-content samples (sensitivity test), specifically: samples with 6 concentrations are set for PCR amplification, and the DNA templates of the transgenic corn 2A-7 are respectively 10%, 2%, 1%, 0.5%, 0.1% and 0%. Test results show that the amplification bands of the combined primers are bright in 1% or more of the DNA template, and are clearly distinguished in 0.5% and 0.1% of the DNA template.
The verification proves that the PCR detection advantage of the combined primer in the transgenic insect-resistant corn 2A-7 is defined.
Fifth, verification aiming at PCR reaction system and detection method
1. FIG. 4 shows the relationship between the amplification and annealing temperatures of the composite primers in the PCR reaction system, specifically: setting 6 primer concentration gradients of 0.1 mu mol/L, 0.2 mu mol/L, 0.4 mu mol/L, 0.6 mu mol/L, 0.8 mu mol/L and 1.0 mu mol/L, and carrying out orthogonal combined amplification at a total of five annealing temperatures of 52 ℃, 54 ℃, 56 ℃, 58 ℃ and 60 ℃. The results show that better specific amplification is obtained at all annealing temperatures above 0.4. mu. mol/L of primer concentration, with 58 ℃ being the optimal annealing temperature.
2. Fig. 5 shows the sensitivity of the detection method, specifically: samples with 7 concentrations are set, and the DNA templates of the transgenic corn 2A-7 are respectively 10%, 5%, 2%, 1%, 0.5%, 0.1%, 0.05% and 0. The test result shows that the DNA template is typical of template amplification bands of 0.1 percent and more, and can be clearly identified. Although the amplification of the DNA template is obviously reduced by 0.05 percent and cannot be clearly identified, the sensitivity of the combined primer can meet the requirement of the existing qualitative detection.
3. Fig. 6 shows the detection limit condition of the detection method, specifically: a sample of 0.1% transgenic maize 2A-7 was set up and subjected to 60 amplifications. The test result shows that the expected amplified fragment can be obtained by 60 times of amplification. Therefore, the detection limit of the detection method of the invention can reach 0.1%.
4. Fig. 7 shows the reproducibility of the detection method of the present invention, specifically: two different operators test 30 samples with different mass fractions by using two PCR instruments of different brands in two different time periods, wherein the samples comprise 10 negative samples, 10 detection limit samples and 10 samples with the mass fraction of 1%. The test result is consistent with the expectation, which shows that the detection method has good reproducibility.
According to the verification condition, the combined primer designed by the invention and the established PCR detection method can completely meet the qualitative PCR detection of the transgenic corn 2A-7. Therefore, compared with the prior art, the invention has outstanding substantive features and remarkable progress.
The above-mentioned embodiment is only one of the preferred embodiments of the present invention, and should not be used to limit the scope of the present invention, and all the technical problems solved by the present invention should be consistent with the present invention, if they are not substantially modified or retouched in the spirit and concept of the present invention.
Sequence listing
<110> institute of agricultural quality standards and testing technology of agricultural academy of sciences of Sichuan province
<120> amplification primer and detection method for realizing specific qualitative PCR detection of transgenic corn 2A-7 transformation event
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Claims (5)
1. The amplification primers for realizing the specific qualitative PCR detection of the transgenic corn 2A-7 transformation event are characterized by comprising two specific sequence amplification primers of a transgenic corn 2A-7 transformant:
2A-7F：CGTGGACGGCCTTCATAG
2A-7R：TGATTAGAGTCCCGCAATTATAC；
wherein, the position of the amplification primer is the RB end flank of the transgenic corn 2A-7 transformant, and the length of the target fragment is 166 bp.
2. A specific qualitative PCR detection method for transgenic corn 2A-7 transformation events is characterized by comprising the following steps:
(1) preparing a DNA template;
(2) the PCR reaction was configured as follows:
In the table, "-" indicates that the volume was not determined, and if magnesium chloride was contained in the PCR buffer, the volume was determined based on the concentration of Taq enzyme without adding magnesium chloride solution, and ddH was adjusted accordingly2The volume of O is adjusted to make the total volume of the reaction system reach 25.0 mu L;
(3) carrying out PCR reaction according to the configured PCR reaction system to obtain a PCR amplification product:
(4) and (3) carrying out qualitative detection on the PCR amplification product by using agarose gel electrophoresis, wherein the lower detection limit is 0.1%.
3. The method for specific qualitative PCR detection of transgenic maize 2A-7 transformation event according to claim 2, wherein in the step (1), the preparation process of preparing DNA template comprises: 100% of the 2A-7 standard sample DNA was diluted to 25 ng/. mu.L.
4. The method for specific qualitative PCR detection of transgenic maize 2A-7 transformation event according to claim 2 or 3, wherein said step (3) comprises the steps of:
(3a) denaturing the PCR reaction system at 94 deg.c for 5 min;
(3b) continuing to denature for 30s at 94 ℃;
(3c) annealing at 58 deg.C for 30 s;
(3d) extension at 72 ℃ for 30 s;
(3e) circulating the steps (3b) to (3d)35 times;
(3f) and (3) extending for 7min at the temperature of 72 ℃ to obtain a PCR amplification product.
5. The method for specific qualitative PCR detection of transgenic corn 2A-7 transformation event according to claim 4, wherein the step (4) comprises the steps of:
(4a) weighing 3g of agarose, adding 150ml of TAE buffer solution and 30 mu L of Biotium gel Red nucleic acid dye, and preparing 2% agarose gel;
(4b) and respectively loading 5 mu L of PCR amplification product and Marker, performing electrophoresis for 70min under the condition of 90V voltage, taking out the gel, and putting the gel into a BIO-RAD gel imaging system for image acquisition to finish the detection of the PCR amplification product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111632695.1A CN114292842A (en) | 2021-12-29 | 2021-12-29 | Amplification primer and detection method for realizing specific qualitative PCR detection of transgenic corn 2A-7 transformation event |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111632695.1A CN114292842A (en) | 2021-12-29 | 2021-12-29 | Amplification primer and detection method for realizing specific qualitative PCR detection of transgenic corn 2A-7 transformation event |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114292842A true CN114292842A (en) | 2022-04-08 |
Family
ID=80972122
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111632695.1A Pending CN114292842A (en) | 2021-12-29 | 2021-12-29 | Amplification primer and detection method for realizing specific qualitative PCR detection of transgenic corn 2A-7 transformation event |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114292842A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104195256A (en) * | 2014-09-10 | 2014-12-10 | 吉林省农业科学院 | Qualitative PCR (Polymerase Chain Reaction) detection primer, qualitative PCR detection method and qualitative PCR detection kit for transgenic maize |
| CN105177172A (en) * | 2015-10-30 | 2015-12-23 | 中国农业科学院生物技术研究所 | Transgenic maize T4-1-1 strain specific detection method and reagent kit |
| CN106434975A (en) * | 2016-11-18 | 2017-02-22 | 四川省农业科学院分析测试中心 | Primer group and probe for building specific quantitative PCR (polymerase chain reaction) precise detection by transgenic maize MON88017 and method thereof |
| CN109182585A (en) * | 2018-10-19 | 2019-01-11 | 浙江省农业科学院 | A kind of primer, probe and kit and method detecting transgenic corns TC1507 |
| CN112280743A (en) * | 2020-11-04 | 2021-01-29 | 中国农业大学 | Corn event 2A-7 and methods for identifying same |
| CN112980930A (en) * | 2021-04-30 | 2021-06-18 | 四川省农业科学院分析测试中心 | Primer group for specific PCR (polymerase chain reaction) accurate quantitative detection of transgenic corn 2A-7 strain and detection method |
-
2021
- 2021-12-29 CN CN202111632695.1A patent/CN114292842A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104195256A (en) * | 2014-09-10 | 2014-12-10 | 吉林省农业科学院 | Qualitative PCR (Polymerase Chain Reaction) detection primer, qualitative PCR detection method and qualitative PCR detection kit for transgenic maize |
| CN105177172A (en) * | 2015-10-30 | 2015-12-23 | 中国农业科学院生物技术研究所 | Transgenic maize T4-1-1 strain specific detection method and reagent kit |
| CN106434975A (en) * | 2016-11-18 | 2017-02-22 | 四川省农业科学院分析测试中心 | Primer group and probe for building specific quantitative PCR (polymerase chain reaction) precise detection by transgenic maize MON88017 and method thereof |
| CN109182585A (en) * | 2018-10-19 | 2019-01-11 | 浙江省农业科学院 | A kind of primer, probe and kit and method detecting transgenic corns TC1507 |
| CN112280743A (en) * | 2020-11-04 | 2021-01-29 | 中国农业大学 | Corn event 2A-7 and methods for identifying same |
| CN112980930A (en) * | 2021-04-30 | 2021-06-18 | 四川省农业科学院分析测试中心 | Primer group for specific PCR (polymerase chain reaction) accurate quantitative detection of transgenic corn 2A-7 strain and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111733281B (en) | Molecular marker for identifying peroxidase activity of wheat grains and application thereof | |
| WO2021121209A1 (en) | Rice brown-planthopper-resistant gene bph37, and protein, vector, host cell, molecular marker, method and use thereof | |
| CN111394506A (en) | Wheat molecular marker and application thereof in identification of wheat grain weight character | |
| Nadal et al. | Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening̶assay for simultaneous detection of five genetically modified cotton events and species | |
| CN113186198A (en) | Brown planthopper resistant gene Bph41 and encoding protein and application thereof | |
| CN116790797A (en) | KASP primer group related to wheat grain weight and application thereof | |
| CN114292842A (en) | Amplification primer and detection method for realizing specific qualitative PCR detection of transgenic corn 2A-7 transformation event | |
| CN109468404B (en) | Method for identifying rice aroma phenotype and primer pair used by same | |
| Wang et al. | An efficient soybean transformation protocol for use with elite lines | |
| CN112662802B (en) | Wheat root length molecular marker and application thereof | |
| CN109055592A (en) | A kind of anti-ring spot virus papaya YK16-0-1 of transgenosis and its efficient qualitative, quantitative identification method of spin-off | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN112094932B (en) | Qualitative PCR detection method and kit for transgenic insect-resistant corn GAB-3 transformant | |
| CN111944882B (en) | Quantitative PCR detection method and kit for transgenic insect-resistant corn GAB-3 transformant | |
| CN114250318B (en) | Specific real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer and detection method for transgenic corn BBL2-2 transformant | |
| US9243287B2 (en) | Endpoint TaqMan methods for determining zygosity of cotton comprising Cry1Ac event 3006-210-23 | |
| CN110982932B (en) | Molecular marker closely linked with major QTL of wheat plant height and application thereof | |
| CN114672581B (en) | Molecular marker of rice heterologous cytoplasmic fertility restoration QTL qRf5.1 and application thereof | |
| CN115927736B (en) | SNP locus related to wheat spike number per spike and application thereof | |
| CN106636445A (en) | Real-time fluorescence qualitative PCR detection method of soybean SHZD32-1 with herbicide tolerance and derivative varieties thereof | |
| CN108060258B (en) | Primer group, kit and method for pure heterozygous identification of cotton MON15985 transformant | |
| CN109880925A (en) | A kind of detection method of the dual anti-12-6 specificity of transformant PCR of transgenic corns | |
| Chaithra et al. | Development of sex-linked PCR markers for gender identification in papaya | |
| ZHU et al. | High-throughput Specific Detection Methods for Transgenic Maize Based on the KASP Platform | |
| Ondreičková et al. | Impact of genetically modified stacked maize NK603× MON810 on the genetic diversity of rhizobacterial communities |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |