CN114277149B - Kit for detecting polymorphism of CD16A gene and application and use method thereof - Google Patents

Abstract

The invention discloses a kit for detecting CD16A gene polymorphism, application and a using method thereof, wherein the kit comprises a first primer pair for amplifying a CD16A gene sequence, a second primer pair for detecting the rs396991 locus polymorphism of the CD16A gene and a fluorescent probe; a first primer pair for amplifying the CD16A gene sequence; a second primer pair for detecting the rs396991 locus polymorphism of the CD16A gene; the fluorescent probe comprises a probe for detecting the rs396991 locus polymorphism of the CD16A gene, and the probe comprises: a first probe 158F‑probe：5'‑FAM‑TTACTCCCAAAAAGCCCCCTG‑MGB‑3'; a second probe 158V-probe: 5'‑HEX‑TTACTCCCAACAAGCCCCCTG‑MGB‑3'. The invention has the advantages of simple operation, high accuracy, good specificity, low cost and the like.

Description

Kit for detecting polymorphism of CD16A gene and application and use method thereof

Technical Field

The invention relates to the field of breast cancer detection, in particular to a kit for detecting CD16A gene polymorphism, and application and a using method thereof.

Background

Breast cancer is the most common cancer for women worldwide, and is also a major killer threatening the health of women in China. According to the latest global cancer burden data issued by the international cancer research Institute (IARC) of the world health organization in the year 2020, up to 226 thousands of new cases of the global breast cancer are formally replaced for the first time (220 thousands) of lung cancer become the first global cancer, accounting for 11.7% of all new cancer patients.

Studies have shown that HER2 is present in 20-30% of primary breast invasive ductal carcinomas with amplification of the gene and overexpression of the protein. HER2 positive breast cancer has poor response to conventional chemotherapy and endocrine treatment, strong tumor infiltration, no disease survival end and poor prognosis. For this reason, a number of anti-cancer drugs blocking HER2 have been developed successively, of which the most commonly used drug currently approved by the FDA is trastuzumab, a recombinant DNA-derived humanized monoclonal antibody, selectively acting on the extracellular portion of HER2, suitable for the treatment of HER2 overexpressed breast cancer.

To obtain longer survival, her2+mbc treatment regimens are continually being explored to develop new therapeutic agents. In month 12 of 2020, the FDA approved Margetuximab (Ma Jituo ximab) for use in the treatment of adult patients with metastatic HER2 positive breast cancer who had previously received two or more anti-HER 2 antibodies. Margetuximab (Ma Jituo ximab) is a genetically engineered drug that enhances immune activity by engineering the Fc segment. The Fab fragment of Ma Jituo mab can bind specifically to HER2 and the modified Fc fragment can increase killing of tumor cells by enhancing antibody-mediated cell-dependent cellular cytotoxicity (ADCC) effect.

The fcγr receptor (fcγr) expressed by different immune cells has different functions, fcγriia (CD 32A) and fcγriia (CD 16A) belong to the activating receptor, fcγriib (CD 32B) belongs to the inhibitory receptor, and the gene polymorphism of fcγr affects the binding of fcγr to IgG antibody, and ultimately affects the clinical efficacy of HER2 monoclonal antibody. Retrospective studies showed that in her2+ breast cancer, different allele expression at amino acid 158 on CD16A receptor affects efficacy, and data suggests that MBC patients carrying CD16A-158F gene may be associated with lower objective remission rate and shorter Progression Free Survival (PFS) following trastuzumab treatment. In a related study of adjuvant therapy, it was shown that patients carrying the CD16A-158FF genotype received trastuzumab with a poor prognosis and a shorter disease-free survival (DFS), and that more data support is currently required for this conclusion.

Fc-segment modified Ma Jituo ximab may modulate immune responses. The Fc modification has increased affinity for CD16A, enhanced innate immunity, decreased affinity for CD32B, and enhanced acquired immunity. The above-described changes in affinity make Ma Jituo antibodies more advantageous than trastuzumab in inducing an immune response.

In literature studies Tahar van der Straaten et al describe a pyrosequencing method specific for rs396991 and not co-amplifying CD16B and show that this method is 100% identical to a commercially available TaqMan genotyping method for rs396991 from Life Technologies (C __ 25815666_10). However, they did not demonstrate the specificity of C __25815666_10, as the cloned and sequenced TaqMan products were 100% homologous to both CD16A and CD 16B.

Therefore, considering the problem of high homology between the genomes of CD16A and CD16B, it is necessary to develop a kit for specifically amplifying CD16A and analyzing the rs396991 locus polymorphism of the CD16A gene based on the Taqman genotyping method.

The information disclosed in this background section is only for enhancement of understanding of the general background of the invention and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person of ordinary skill in the art.

Disclosure of Invention

The invention aims to provide a kit for detecting CD16A gene polymorphism, and application and using methods thereof, which can provide a kit and a testing method for auxiliary judgment of the sensitivity of breast cancer patients to Ma Jituo ximab treatment, wherein the kit is simple to operate, high in accuracy, good in specificity and low in cost.

To achieve the above object, an embodiment of the present invention provides a kit for detecting a polymorphism of a CD16A gene, comprising a kit including a first primer pair for amplifying a CD16A gene sequence, a second primer pair for detecting a polymorphism at an rs396991 locus of the CD16A gene, and a fluorescent probe;

the first primer pair for amplifying the CD16A gene sequence has the forward primer nucleotide sequence of CD16A-F1:5'-TGGGGTGTCTGTGTCTTTCA-3' the reverse primer nucleotide sequence is CD16A-R1:5'-CTTTGATGTGACCTTAGGGAAACT-3', can be specifically combined with the upstream and downstream of the rs396991 locus of the CD16A gene and amplify a gene sequence containing the rs396991 locus;

the second primer pair for detecting the rs396991 locus polymorphism of the CD16A gene has a forward primer nucleotide sequence of CD16A-F2:5'-TGGGGTGTCTGTGTCTTTCA-3', the reverse primer nucleotide sequence of which is CD16A-R2:5'-TGCAAACCTACCCTGCAATC-3';

the fluorescent probe comprises a probe for detecting the rs396991 locus polymorphism of the CD16A gene, and the probe comprises:

first probe 158F-probe:5'-FAM-TTACTCCCAAAAAGCCCCCTG-MGB-3';

second probe 158V-probe:5'-HEX-TTACTCCCAACAAGCCCCCTG-MGB-3'.

Preferably, the kit further comprises 2-x PCR reaction solution, 2-x probe type PCR reaction solution, and nuclease-free sterile deionized water, FF type reference, FV type reference, and VV type reference.

Preferably, the sum of the concentrations of the first primer pair and the second primer pair is 10uM, and the concentration of the fluorescent probe is 5uM.

The application of the kit for detecting the CD16A gene polymorphism is that the kit for detecting the CD16A gene polymorphism is applied to detecting the drug treatment sensitivity of the breast cancer Ma Jituo ximab.

A method for using a kit for detecting polymorphism of a CD16A gene, comprising the following steps:

s1, extracting DNA to be detected of genome;

s2, adopting the kit for detecting the polymorphism of the CD16A gene to carry out PCR amplification on the genome DNA extracted in the S1, simultaneously carrying out amplification of a reference, and carrying out magnetic bead purification or agarose gel electrophoresis after amplification is finished to recover a 900-1000bp fragment size nucleic acid product;

s3, adopting the kit for detecting the CD16A gene polymorphism, and carrying out Tapman typing detection on the PCR purified product in the step b.

Preferably, the PCR amplification reaction conditions described in S2 are as follows:

preferably, the DNA to be tested in S1 is taken from a tumor tissue specimen or peripheral blood genomic DNA.

Compared with the prior art, the invention has the following beneficial effects: the method is based on the Taqman typing method for genotyping the polymorphic site rs396991 of the human CD16A gene, has the advantages of simplicity and convenience in operation, high accuracy, good specificity, low cost and the like, and the detection result can assist in judging the treatment sensitivity of a breast cancer patient to Ma Jituo ximab.

Drawings

FIG. 1 shows the DNA typing results of 9 known loci rs396991 of the CD16A gene, wherein the ordinate is the intensity of the fluorescent model of the 158V-type probe and the abscissa is the intensity of the fluorescent model of the 158F-type probe;

FIG. 2 shows the DNA typing results of 20 clinical samples at the rs396991 locus of the CD16A gene, wherein the ordinate is the fluorescence model intensity of the 158V type probe and the abscissa is the fluorescence model intensity of the 158F type probe.

Detailed Description

The following detailed description of embodiments of the invention is, therefore, to be taken in conjunction with the accompanying drawings, and it is to be understood that the scope of the invention is not limited to the specific embodiments.

Throughout the specification and claims, unless explicitly stated otherwise, the term "comprise" or variations thereof such as "comprises" or "comprising", etc. will be understood to include the stated element or component without excluding other elements or components.

Example 1:

the preparation of the specific PCR primer and the fluorescent probe for detecting the polymorphism of the CD16A gene comprises the following steps:

1. sequence acquisition: the source of the gene sequences used is NCBI (national center for Biotechnology information)

2. The design method comprises the following steps:

2.1 selecting a specific region according to the published CD16A, CD B gene sequence of NCBI database, wherein the region comprises rs396991 polymorphic site and is used for designing a proper primer and a probe, and screening the obtained sequence information as follows:

CAGGCTTTGAAGTCTTTGATGTGACCTTAGGGAAACTTATTTATTTATTTTTGCACCTCGGTTACTTCATCTGTAAAATGGAATATTACCTATCTCATGTTGTGAAGGTCTACTGTGATAGTCAAACCAGGTGCATGTAAAGAATTGTTTAGCACAGAGTCTAGCACACTGAAAGGTGCCCAATAAATGTCAGCTTATTTTTGTTACGGAAGAAGAAATTGGGGTTCAGAGAGACTAAGTGGCTCACCTCTGGTCAGATGGTTAATTAGCTGCAGGGCCAGAACCCAGGTTCTGGGCTCTTTCTGTGAGGGGATGAGGGGCTCCTGCCAGTTTGGATCGTGGCTAAAAGGCTTGGATAAGAAGGAGGCCAGCACGATAGGAACATATGACACCGTGGGTGTGATTAGCGTAAGGAAAGACAGAGGTATTTATTGGGGAGGAGATGTGGCTTCTGCTCCTGCCATCATGCTGCAGAGTGAATGACACCTCCTAGCTACCCCAAAAGAATGGACTGAAACAGAGCTGCAAACCTACCCTGCAATCAGGGACTTTTGGGGACCTCCTGGTGATCACCAGGAGGGAACCACATATGAAGAAGTGCGTGTAAGAATCAGGAATCTCCTCCCAACTCAACTTCCCAGTGTGATTGCAGGTTCCACACACAGGCGTCCCTGGGCATTCCAGGGTGGCACATGTCTCACCTTGAGTGATGGTGATGTTCACAGTCTCTGAAGACACATTTTTACTCCCAAAAA

here, there are 5A bases, the middle one being the rs396991 site.

GCCCCCTGCAGAAGTAGGAGCCGCTGTCTTTGAGTGTGGCTTTTGGAATGTAGAAGTCAGAATTATGATGAAAATACTTCCTGCCTTTGCCATTCTGTAAATATGTGACCTTATGCAGAGCAGTGTTCTTCCAGCTGTGACACCTCAGGTGAATAGGGTCTTCCTCCTTGAACACCCACCGAGGGGCCTGGAGCAACAGCCAGCCTGAAAGACACAGACACCCCAGGCCCGGGAGGCCTCAGCTCT(>hg38_dna range＝chr1:161544000-161545000 5'pad＝0 3'pad＝0strand＝+)

2.2 primers and primer design using Primerexpress 3.0:

taqman probe design principle:

priority of probe position

The first base at the 5' end of the probe cannot be G

Tm value of gene expression probe: 68-70 ≡c; genotyping probe Tm value: 65-67 ≡C

TaqMan probe length of 13-30bp, taqMan-MGB probe length of 13-25bp

Avoid too many repeats of the same base, in particular G's of 4 or more in succession

A probe having more C than G is more effective, and if C is less than G, the complementary strand is selected

The polymorphic site should be located as centrally as possible in the probe and may be.+ -. 3 bases

Primer design principle:

the primer is as close to the probe as possible, but not overlapping with the probe

The primer length is 9-40bp, optimally 20bp, and the GC content is kept between 30-80%

Avoid too many repeats of the same base, in particular G's of 4 or more in succession

The Tm value of the primer is 58-60 ≡C, and the Tm of the upstream primer and the downstream primer does not exceed 2 ≡C

G and C are added up to not more than 2 out of 5 bases at the 3' -end of the primer

The 3' -end of the primer is not base A, and more than 3 identical bases are avoided

Avoid 4 or more consecutive pairs of primers themselves or with primers

Avoid the primer itself forming a circular hairpin structure

The amplified fragment has a length of between 50 and 150bp

Primerexpress 3.0 designed primer and probe sequence information is shown in Table 1:

TABLE 1 specific PCR primers and probe sequence listing

3. The sequence obtained was subjected to synthesis by U.S. Integrated DNATechnologies (abbreviated as IDT).

Example 2

Experimental method accuracy verification

1. Materials: genomic DNA of 9 known CD16A gene rs396991 locus genotypes;

2. the method comprises the following steps: a kit for detecting the polymorphism of the CD16A gene is used for detecting the rs396991 genotype of the polymorphism site of the CD16A gene in the sample, and a specific PCR primer and a fluorescent probe for detecting the polymorphism of the CD16A gene in the kit are prepared in the embodiment 1.

A. Preparing a CD16A amplification reaction solution according to Table 2, mixing by vortex, and centrifuging instantly;

TABLE 2 preparation of CD16A amplification reaction solution

Amplification reaction Components	Volume (mu L)
		DNA to be tested	x
2 PCR amplification reaction solution	12.5
		CD16A-F1(10μM)	0.75
CD16A-R1(10μM)	0.75
		Nuclease-free sterile deionized water	(11-x)
total	25

B. The amplification reaction solution was placed in a Bio-Rad T100 gradient PCR apparatus, and the amplification reaction conditions were run as shown in Table 3:

TABLE 3 CD16A amplification reaction conditions

C. And purifying the amplified product by a magnetic bead method, and recovering the 900-1000bp nucleic acid product.

D. Preparing rs396991SNP detection reaction liquid according to table 4, mixing uniformly by vortex, and centrifuging instantly;

table 4rs 399991 SNP detection reaction liquid configuration table

E. And (3) placing rs396991SNP detection reaction liquid in an ABI7500 fluorescent quantitative PCR instrument, running reaction conditions, and carrying out Taqman typing detection.

F. Analysis of results: as shown in the experimental result in FIG. 1, the fluorescence intensity of T1/T2/T3 FAM is far greater than that of VIC, which is proved to be FF type; the fluorescence intensity of T4/T5/T6 FAM is equivalent to that of VIC, and is proved to be FV type; the fluorescence intensity of T7/T8/T9 VIC is far greater than that of FAM, which is shown as a VV type; the test results are shown in Table 5.

Table 5 9 examples of DNA typing results of the rs396991 locus of the known CD16A gene

3. Analysis of experimental results: the experimental result shows that the kit provided by the invention accurately detects the rs396991 locus genotype of the corresponding sample CD16A gene, which indicates that the detection method is successfully established.

Example 3

Clinical sample detection

1. Materials: 20 cases of breast cancer paraffin-embedded tissue samples

2. The method comprises the following steps: 20 samples of breast cancer paraffin embedded tissue were tested using the above kit, which was done on a Bio-Rad gradient PCR instrument and an ABI7500 fluorescent quantitative PCR instrument.

A. The paraffin section samples were subjected to nucleic acid extraction using QIAamp DNA FFPE Tissue Kit (QIAGEN, germany, cat No. 56404), the extraction steps were performed according to the product specifications, to obtain 50ul of DNA solution, and detection was performed directly or temporary storage at-20 ℃; and simultaneously detecting quality control products.

B. The detection steps and analysis of the results were carried out according to example 2, the detection results are shown in FIG. 2, and the detailed results are shown in Table 6.

TABLE 6 DNA typing results at rs396991 locus of CD16A Gene in 20 clinical samples

3. Analysis of experimental results: according to the prepared kit for detecting CD16A gene polymorphism, 20 breast cancer clinical specimens are subjected to detection typing. Wherein S1S 7S 19 are quality control products of FF, FV and VV respectively, and experimental results show that the parting is correct; of the 20 clinical samples tested, 6 cases of FF type, 9 cases of FV type and 5 cases of VV type, as shown in FIG. 2, the distribution in the group is concentrated, and the difference between the groups is obvious. Further illustrates that the kit can simply, rapidly and accurately realize the detection of the rs396991 locus polymorphism of the CD16A gene.

The foregoing descriptions of specific exemplary embodiments of the present invention are presented for purposes of illustration and description. It is not intended to limit the invention to the precise form disclosed, and obviously many modifications and variations are possible in light of the above teaching. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application to thereby enable one skilled in the art to make and utilize the invention in various exemplary embodiments and with various modifications as are suited to the particular use contemplated. It is intended that the scope of the invention be defined by the claims and their equivalents.

Claims (7)

1. The kit for detecting the polymorphism of the CD16A gene comprises a kit, and is characterized by comprising a first primer pair for amplifying a sequence of the CD16A gene, a second primer pair for detecting the polymorphism of the rs396991 locus of the CD16A gene and a fluorescent probe;

the first primer pair for amplifying the CD16A gene sequence has the forward primer nucleotide sequence of CD16A-F1:5'-TGGGGTGTCTGTGTCTTTCA-3' the reverse primer nucleotide sequence is CD16A-R1:5'-CTTTGATGTGACCTTAGGGAAACT-3', can be specifically combined with the upstream and downstream of the rs396991 locus of the CD16A gene and amplify a gene sequence containing the rs396991 locus;

the second primer pair for detecting the rs396991 locus polymorphism of the CD16A gene has a forward primer nucleotide sequence of CD16A-F2:5'-TGGGGTGTCTGTGTCTTTCA-3', the reverse primer nucleotide sequence of which is CD16A-R2:5'-TGCAAACCTACCCTGCAATC-3';

the fluorescent probe comprises a probe for detecting the rs396991 locus polymorphism of the CD16A gene, and the probe comprises:

first probe 158F-probe:5'-FAM-TTACTCCCAAAAAGCCCCCTG-MGB-3';

second probe 158V-probe:5'-HEX-TTACTCCCAACAAGCCCCCTG-MGB-3'.

2. The kit for detecting polymorphism of CD16A gene according to claim 1, wherein the kit further comprises 2X PCR reaction solution, 2X probe PCR reaction solution and nuclease-free sterile deionized water, FF type reference, FV type reference, and VV type reference.

3. The kit for detecting a polymorphism of the CD16A gene according to claim 1, wherein the sum of the concentrations of the first primer pair and the second primer pair is 10uM, and the concentration of the fluorescent probe is 5uM.

4. Use of a kit for detecting CD16A gene polymorphism as claimed in any one of claims 1-3 for preparing a reagent for detecting sensitivity of breast cancer Ma Jituo ximab drug treatment.

5. A kit according to any one of claims 1 to 3, wherein the method of use of the kit comprises the steps of:

s1, extracting DNA to be detected of genome;

s2, adopting the kit for detecting the polymorphism of the CD16A gene to carry out PCR amplification on the genome DNA extracted in the S1, simultaneously carrying out amplification of a reference, and carrying out magnetic bead purification or agarose gel electrophoresis after amplification is finished to recover a 900-1000bp fragment size nucleic acid product;

s3, adopting the kit for detecting the CD16A gene polymorphism, and carrying out Tapman typing detection on the PCR purified product in the step b.

6. The kit of claim 5, wherein the PCR amplification reaction conditions in S2 are as follows:

。

7. the kit according to claim 5, wherein the DNA to be tested in S1 is obtained from a tumor tissue specimen or peripheral blood genomic DNA.