CN114277113B - Method and system for detecting oligonucleotide synthesis quality - Google Patents
Method and system for detecting oligonucleotide synthesis quality Download PDFInfo
- Publication number
- CN114277113B CN114277113B CN202111407032.XA CN202111407032A CN114277113B CN 114277113 B CN114277113 B CN 114277113B CN 202111407032 A CN202111407032 A CN 202111407032A CN 114277113 B CN114277113 B CN 114277113B
- Authority
- CN
- China
- Prior art keywords
- sequence
- oligonucleotide
- artificial sequence
- sequencing
- synthesis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of genes, and particularly relates to a method for detecting the synthesis quality of oligonucleotides, which comprises the following steps: 1) Synthesizing an oligonucleotide, leaving uncoupled the 5' hydroxyl group free from blocking during synthesis, said oligonucleotide sequence comprising a test sequence; 2) Sequencing the oligonucleotide sequences synthesized in step 1) to obtain sequencing data; 3) Analyzing and calculating gene mutation information of the sequencing data obtained in the step 2) to obtain the proportion of different sequences in the oligonucleotide sequences in the whole sequences and the proportion of correct, missing, mutated and inserted bases at different positions. The method of the present invention can accurately detect the correctness of the base sequence of an oligonucletide, the efficiency of each step of synthesis, and the type and position of each wrong base.
Description
Technical Field
The invention belongs to the technical field of genes, and particularly relates to a method for detecting the synthesis quality of oligonucleotide.
Background
Oligonucleotides are usually composed of several tens of nucleotides, and are a kind of single-stranded nucleic acid molecules with short sequences. The oligonucleotide can be used as a primer, a gene probe, a synthetic gene basic segment, a gene therapy related drug and the like, and is widely applied to modern molecular biology research. A common method for the synthesis of oligonucleotides is solid phase phosphoramidite chemical synthesis, which is still currently employed by most commercial DNA synthesis companies. The synthesis method is a cyclic process of extending a nucleotide chain from the 3 'terminus to the 5' terminus, and the nucleotide chain will extend from the first protected nucleotide molecule immobilized on the surface. The immobilized carrier is mainly glass microsphere (CPG) or polystyrene microsphere (PS) with controllable aperture, reagent is pumped and flows through the surface of the material, and nucleotide monomer added step by step is induced to be added onto the oligonucleotide chain, so that the oligonucleotide chain is continuously prolonged. Each round of addition of a nucleotide monomer to the nucleotide chain is carried out in four steps: (1) deprotection: removing the Dimethoxytrityl (DMT) group from the 5 'terminal end of the elongated nucleotide chain with trichloroacetic acid (TCA) or dichloroacetic acid (DCA) and generating a 5' reactive hydroxyl group; (2) coupling: the deoxynucleoside phosphoramidite molecule, when acted upon by a suitable activating agent (e.g., tetrazole), produces a reactive monomer molecule which reacts with the 5' hydroxyl group produced in the previous step; (3) capping: in order to reduce the products containing missing bases, the uncoupled 5' hydroxyl group will be blocked, a blocking reagent often used is an acylating reagent; (4) oxidizing: the phosphodiester bond between the linked nucleotide molecules is unstable and is easily hydrolyzed by acid or alkali, and therefore, it is necessary to oxidize the phosphodiester bond to a more stable phosphotriester. The four-step reaction is repeated to add deoxynucleotide monomer molecules to the nucleotide chain. After the entire synthesis process is complete, the oligonucleotide will be cleaved from the solid phase.
However, as the length of the oligonucleotide increases, the yield of full-length oligonucleotide generally decreases. Also, random depurination of synthetic oligomers affects the yield of full-length oligonucleotides, especially during the acid deprotection step of the synthesis cycle, adenine is susceptible to depurination and eventually contributes to the cleavage of the oligonucleotide backbone, thereby reducing the yield of full-length oligonucleotides. Further reduction in the quality of oligonucleotide synthesis is due to the introduction of random mutations, mainly of the single base deletion type, during synthesis. Such errors result primarily from incomplete removal of DMT protecting groups or from inefficient integration of coupling and capping steps during the synthesis cycle. Complete removal of synthesis errors is unlikely because the efficiency of any chemical reaction cannot reach 100%. Oligonucleotides synthesized by chemistry are a mixed system that contains correct sequence products, wrong sequence impurities, and short sequence impurities. Therefore, it is necessary to detect the synthesis quality of oligonucleotides and to continuously adjust the synthesis apparatus, synthesis reagents and synthesis methods according to the feedback of the detection result, thereby improving the synthesis quality of oligonucleotides.
In the prior art, the quality detection of oligonucleotides mainly comprises methods such as liquid phase, mass spectrum, gel electrophoresis, capillary electrophoresis and the like. These methods detect the difference in the number of oligonucleotide bases, and therefore cannot detect the correctness of the base sequence of an oligonucleotide and distinguish an oligonucleotide having a correct sequence from an oligonucleotide having an incorrect sequence. Secondly, in the process of detecting the synthesis efficiency, the method can only detect the purity of the final product, and under the condition of assuming that the synthesis efficiency of each step is the same, the synthesis efficiency of each step is reversely deduced to obtain the average value of the synthesis efficiency of each step, so the method has poor accuracy and cannot reflect the reaction efficiency of each step in the real synthesis process.
Therefore, there is a need in the art for a method for detecting the quality of an oligonucleotide, which can accurately detect the proportion of the correct sequence of an oligonucleotide sample to reflect the purity of the sample, and analyze the incorrect sequence to obtain the type and position of the incorrect base. Thereby optimizing the synthesis instrument, the synthesis reagent and the synthesis method according to the detection result.
Disclosure of Invention
As described above, the conventional quality detection method of oligonucleotide is not complete and accurate enough to detect oligonucleotide, and only can detect the difference of the number of oligonucleotide bases to obtain the purity of the final product. Therefore, there is a need in the art for a method for detecting the quality of an oligonucleotide that can accurately detect the accuracy of the base sequence of an oligonucleotide, the efficiency of each step of synthesis, and the type and position of each wrong base.
In view of this, in a first aspect, the present invention provides a method for detecting the quality of oligonucleotide synthesis, the method comprising the steps of:
1) Synthesizing an oligonucleotide, leaving uncoupled the 5' hydroxyl group free from blocking during synthesis, said oligonucleotide sequence comprising a test sequence; (ii) a
2) Sequencing the oligonucleotide sequences synthesized in step 1) to obtain sequencing data;
3) Analyzing and calculating gene mutation information of the sequencing data obtained in the step 2) to obtain the proportion of different sequences in the oligonucleotide sequences in the whole sequences and the proportion of correct, missing, mutated and inserted bases at different positions.
In some embodiments, the oligonucleotide sequences in step 1) further comprise primer sequences at both ends.
In some embodiments, the sequence to be tested is 10nt to 300nt in length. In a preferred embodiment, the length of the intermediate test sequence is 20nt to 100nt.
In some embodiments, the method of synthesis of step 1) is phosphoramidite chemical synthesis.
In some embodiments, the gene mutation information analysis of step 3) is a single nucleotide polymorphism analysis.
In some embodiments, step 2) is performed on an illumina sequencing platform.
In some embodiments, the primer sequences are as follows:
the 5' end is a sequence GCTGCAGGTTATCGCACCTG; and
the 3' end is the sequence GAGTTTGTGTGCGAGTTGC.
In some embodiments, step 2) comprises the steps of:
a) And (3) PCR amplification: performing PCR amplification by using the oligonucleotide sequence in the step 1) as a template and using a sequence complementary to the primer sequence in the step 1) as a primer;
b) Generation of the library: carrying out end repair and adenylic acid (A) addition on the sequence obtained in the step a), then connecting the sequence with a linker sequence, and carrying out PCR amplification in the construction process to obtain a PCR-free library;
c) And (3) machine sequencing: sequencing the sequence obtained in step b).
In some embodiments, the PCR amplification temperature in step a) is 45 ℃ to 65 ℃, preferably 60 ℃; the number of amplification cycles is 2 to 30 cycles, preferably 2 cycles.
In some embodiments, the specific calculation of the purity of the oligonucleotide is as follows:
in some embodiments, the specific calculation formula for the single base mutation rate of the oligonucleotide is as follows:
in a second aspect, the present invention provides a system for detecting the quality of oligonucleotide synthesis, the system comprising:
1) Oligonucleotide synthesis unit: synthesizing an oligonucleotide that leaves uncoupled the 5' hydroxyl group without blocking during synthesis, said oligonucleotide sequence comprising a test sequence;
2) A sequencing data acquisition unit: sequencing the oligonucleotide sequences synthesized by the oligonucleotide synthesis units to obtain sequencing data;
3) An analysis unit: and analyzing and calculating gene mutation information of the sequencing data obtained by the sequencing data acquisition unit to obtain the proportion of different sequences in the oligonucleotide sequences to all sequences and the proportion of correct, missing, mutated and inserted bases at different positions.
In some embodiments, the oligonucleotide sequences synthesized in the oligonucleotide synthesis units further comprise primer sequences at both ends.
In some embodiments, the sequence to be tested is 10nt to 300nt in length. In a preferred embodiment, the length of the intermediate test sequence is 20nt to 100nt.
In some embodiments, the sequencing data acquisition unit comprises:
a) A PCR amplification unit: taking the oligonucleotide sequence synthesized by the oligonucleotide synthesis unit as a template, and taking a sequence complementary to the primer sequence in the oligonucleotide synthesis unit as a primer for PCR amplification;
b) A library construction unit: performing end repair and adenylic acid (A) addition on a sequence obtained from the PCR amplification unit, connecting with a linker sequence, and performing no PCR amplification in the construction process to obtain a PCR-free library;
c) A sequencing unit: the sequences obtained from the library building blocks were sequenced.
In a specific embodiment, the sequencing unit is an illumina sequencer.
The invention has the beneficial effects that:
1) Provides a detection method which can realize high-throughput, high-precision and high-efficiency detection of oligonucleotide quality;
2) The proportion of the correct sequence of the oligonucleotide sample can be accurately detected to obtain the purity of the sample to be detected;
3) The error type and the synthesis efficiency of each base position can be accurately obtained;
4) The synthesis efficiency of each step in oligonucleotide synthesis can be accurately obtained; and
5) And optimizing a synthesis instrument, a synthesis reagent and a synthesis method according to the detection result.
Detailed Description
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the present invention will be clearly and completely described below with reference to the embodiments of the present invention. It is to be understood that the described embodiments are merely a subset of the present invention and not all embodiments. All other embodiments that can be derived by one of ordinary skill in the art from the embodiments disclosed herein are within the scope of the present invention.
As described above, the conventional method for detecting the quality of an oligonucleotide is not sufficient for detecting the oligonucleotide comprehensively and accurately. Therefore, the present invention aims to provide a method for detecting the quality of an oligonucleotide, which can accurately detect the accuracy of the base sequence of an oligonucleotide, the efficiency of each step of synthesis, and the type and position of each wrong base.
Accordingly, in a first aspect, the present invention provides a method for detecting the quality of oligonucleotide synthesis, said method comprising the steps of:
1) Synthesizing an oligonucleotide, leaving uncoupled the 5' hydroxyl group free from blocking during synthesis, said oligonucleotide sequence comprising a test sequence;
2) Sequencing the oligonucleotide sequences synthesized in step 1) to obtain sequencing data;
3) Analyzing and calculating gene mutation information of the sequencing data obtained in the step 2) to obtain the proportion of different sequences in the oligonucleotide sequences in the whole sequences and the proportion of correct, missing, mutated and inserted bases at different positions.
In the present invention, the "oligonucleotide" refers to a linear polynucleotide fragment in which nucleotide residues are linked by phosphodiester bonds, and includes DNA and RNA. In the art, "oligonucleotide" generally refers to shorter nucleotide fragments, and the number of nucleotide residues is not strictly defined. The oligonucleotide of the present invention comprises a sequence to be tested having a length of 10nt to 300nt in some preferred embodiments, the sequence length of the oligonucleotide is 20nt to 100nt.
As described in the background above, oligonucleotide synthesis typically involves several steps of deprotection, coupling, capping and oxidation. In the synthesis of oligonucleotide, some oligonucleotide does not participate in the reaction due to the problem of reaction efficiency, and the corresponding base is not coupled, so that the oligonucleotide directly enters the next reaction. Thus, the capping step is to block the uncoupled 5 'hydroxyl group, preventing the uncoupled 5' hydroxyl group from elongating in subsequent reactions, reducing the product containing the missing base. The oligonucleotide quality detection method of the present invention is based on a second generation sequencing technique, whereby each synthesized oligonucleotide sequence is sequenced (including correct and incorrect sequences) by adding specific primers at both ends of the sequence. Thus, in the oligonucleotide synthesis step of the present invention, the uncoupled 5' hydroxyl group is not blocked to ensure that all sequences can continue to the next cycle of reaction until the reaction is complete. In one embodiment, the synthetic method may be a phosphoramidite chemical synthesis method commonly used in the art.
For the next sequencing, the oligonucleotide sequence further comprises primer sequences at two ends, and the primer sequences can be directly synthesized at two ends of the sequence to be detected of the oligonucleotide in the oligonucleotide synthesis step, or can be directly connected to two ends of the sequence to be detected after the oligonucleotide synthesis is completed and before the sequencing. The primer sequence (sequencing primer) is a primer binding sequence designed or selected for paired-end sequencing based on a secondary sequencing platform. In one embodiment, when the sequence sequencing of step 2) is performed on the illumina platform, the primer sequences are as follows:
the 5' end is a sequence GCTGCAGGTTATCGCACCTG; and
the 3' end is the sequence GAGTTGTGCGCGGAGTTGC.
In step 2), first, PCR amplification is performed using the oligonucleotide synthesized in step 1) as a template and a sequence complementary to the primer sequence described in step 1) as a primer. This step is to amplify the single stranded oligonucleotides into double strands for library construction. In this step, the PCR amplification temperature may be 45 ℃ to 65 ℃ and the number of amplification cycles may be 2 to 30 cycles. The inventors have found in experiments that when the number of cycles is too large, data distortion is caused, because the correct sequence and the incorrect sequence have different binding capacities with the PCR primers, so that the amplification efficiency of the correct primer is higher than that of the incorrect primer, and as the number of cycles is increased, the incorrect sequence is filtered out, so that the correct sequence is enriched. Thus, in a preferred embodiment, the PCR amplification temperature may be 60 ℃ and the number of amplification cycles may be 2 cycles.
The PCR amplified sequence can then be end repaired and a-tailed and ligated at both ends with sequencing adaptor sequences. The sequencing linker sequences are two oligonucleotide sequences complementary to the sequencer chip. In some embodiments, the sequencing adapter sequence is a sequence complementary to a flow cell (flow cell) surface primer of illumina, commonly referred to as a P5 or P7 binding moiety. In this construction, unlike conventional second generation sequencing libraries, no further PCR amplification is performed to obtain a PCR-free library, because no further amplification is performed, so that each read result in the sequencing result corresponds to a primer sequence.
The prepared library is subjected to on-machine sequencing to obtain sequencing data and to data processing and analysis, which in one embodiment may be single nucleotide polymorphism analysis. Thereby obtaining the number of correct sequences in the oligonucleotide sequence and the type and rate of errors at each base position.
It will be appreciated that sequencing data for the synthetic oligonucleotide sequence may be obtained by the method of step 2) above, or may be obtained directly by sending the oligonucleotide sequence to a commercial sequencing company.
The sequence result generated by the second generation sequencing platform is called reading (read), each reading result in the second generation sequencing result can reflect an oligonucleotide sequence, the sequence is the same as the correct reading through comparing with the target sequence, the sequence is different from the correct reading, and all the difference base counts are collected to be the number of the wrong bases. In addition, since the uncoupled 5' hydroxyl group remains un-blocked during synthesis, the uncoupled oligonucleotide proceeds directly to the next round of reaction, and thus in the second generation sequencing results, the oligonucleotide is an abasic error at this position. The deletion ratio of the base in the second generation sequencing result is the reaction failure rate, so that the synthesis efficiency of each step can be obtained.
In some embodiments, the specific calculation of the purity of the oligonucleotide is as follows:
in some embodiments, the specific formula for calculating the single base mutation rate of the oligonucleotide is as follows:
in a second aspect, the present invention provides a system for detecting the quality of oligonucleotide synthesis, the system comprising:
1) Oligonucleotide synthesis unit: synthesizing an oligonucleotide that leaves uncoupled the 5' hydroxyl group without blocking during synthesis, said oligonucleotide sequence comprising a test sequence;
2) A sequencing data acquisition unit: sequencing the oligonucleotide sequences synthesized by the oligonucleotide synthesis units to obtain sequencing data;
3) An analysis unit: and analyzing and calculating gene mutation information of the sequencing data obtained by the sequencing data acquisition unit to obtain the proportion of different sequences in the oligonucleotide sequences in all sequences and the proportion of correct, missing, mutated and inserted bases in different positions.
It will be appreciated that the specific features described herein above with respect to the method of detecting the quality of oligonucleotide synthesis may similarly be applied to similar extensions in the system for detecting the quality of oligonucleotide synthesis constructed in the present invention. For the sake of simplicity, it is not described in detail.
The present invention will be described in more detail with reference to examples. The test methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples were purchased from a conventional reagent store unless otherwise specified. It should be noted that the summary above and the detailed description below are merely intended to specifically illustrate the present invention and are not intended to limit the invention in any way.
Examples
1. Synthesis of oligonucleotides
Oligoribonucleotide synthesis was carried out according to the synthetic procedure shown in Table 1 using a 192 synthesizer, 200nmol synthesis column.
TABLE 1 Synthesis procedure
| Step (ii) of | Reagent | Volume (μ L) | Time(s) |
| 1 | Trichloroacetic acid (TCA) | 200 | 30 |
| 2 | Trichloroacetic acid (TCA) | 180 | 30 |
| 3 | Acetonitrile (ACN) | 240 | 15 |
| 4 | Acetonitrile (ACN) | 240 | 15 |
| 5 | 5-Ethylthiotetrazole (ACT) | 55 | 10 |
| 6 | Nucleotide monomers | 30 | 120 |
| 7 | 5-ethylthiotetrazole (ACT) | 55 | 10 |
| 8 | Nucleotide monomers | 30 | 120 |
| 9 | Iodine solution | 80 | 30 |
| 10 | Acetonitrile (ACN) | 200 | 15 |
| 11 | Acetonitrile (ACN) | 200 | 15 |
After synthesis, the synthesis plate was taken out, 500. Mu.L of diethylamine was added to each synthesis column, and after standing for 5 minutes, reduced pressure suction filtration was performed to remove diethylamine. 1mL of acetonitrile solution was added to each synthetic column and the mixture was drained under reduced pressure. The plate was placed in a gas phase ammonolysis apparatus, 300mL of ammonia was added, and the reaction was carried out at 95 ℃ for 1 hour. After the reaction, the reaction mixture was eluted with sterile water, and the eluate was collected to measure the content (OD value) of the oligonucleotide in the system, followed by diluting the oligonucleotide with sterile water to 1 ng/. Mu.L as an oligonucleotide sequencing sample.
The synthesized oligonucleotides are shown in Table 2, and a total of 34 sequences were used for sequencing, with a sequence length of 60nt to 140nt, a fixed primer sequence GCTGCAGGTTATCGCACCTG at the 5 'end, a fixed primer sequence GAGTTTGTGCGCGCGAGTTTGC at the 3' end, and a random sequence length of 20nt to 100nt in the middle.
TABLE 2 synthetic oligonucleotide sequences
2. Library Generation and sequencing
Using the synthesized oligonucleotide sample as a template, and using a sequence complementary to the primer sequence in the synthesis step as a primer, performing PCR amplification with the reaction system as shown in table 3, the PCR procedure as shown in table 4 and the specific amplification primer sequences as follows:
5' CGACGTCCAATAGCGTGGAC-; and
5’-CTCAAACACGCGCTCAAACG-3’。
TABLE 3 PCR reaction System
| Composition (I) | Content (c) of |
| Oligonucleotide sample (1 ng/. Mu.L) | 2μL |
| Primer (10. Mu.M) | 0.75. Mu.L each |
| MgSO 4 (25mM) | 3μL |
| dNTPs(2mM) | 5μL |
| 10*KOD-Plus-Neo Buffer | 5μL |
| KOD-Plus-Neo | 1μL |
| Sterile water | 32.5μL |
TABLE 4 PCR reaction procedure
After the oligonucleotide sequence amplified by PCR is subjected to end repair and A tail addition, sequencing linkers (P5 and P7) are respectively connected to two ends of the fragment and purified, and PCR amplification is not carried out in the middle to prepare a PCR-free library. And sequencing by using an Illumina platform according to the effective concentration of the library and the data output requirement.
3. Processing and analyzing data information
3.1 data quality control
The raw sequencing data obtained by sequencing contains low-quality reading with a connector. In order to ensure the quality of information analysis, the raw reading (raw read) needs to be finely filtered and processed to obtain a clean reading (clean read), and subsequent analysis is performed based on the clean reading. The specific steps of data processing are as follows:
(1) Removing the reading pairs with the joints;
(2) When the proportion of N (N represents that base information cannot be determined) in the single-ended sequencing reads is more than 10%, the pair of reads needs to be removed;
(3) When the number of low-mass (below 20) bases contained in a single-ended sequencing read exceeds 40% of the proportion of the length of the read, the pair of reads needs to be discarded.
3.2 data splicing
For samples needing to be split, splitting according to the barcode to obtain original data of each sample, removing the barcode and primers, and splicing R1 sequence data and R2 sequence data through FLASH software to obtain Tags. And for a sample which does not need to be split, splicing the sequence data of the R1 and the R2 directly through FLASH software to obtain the Tags.
3.3 short sequence SNP variation detection
And (3) comparing the Tags to a reference sequence by using blast software, and then realizing multi-sequence comparison by using mafft software to obtain a final statistical result.
Each read result in the second generation sequencing result can reflect an oligonucleotide sequence, because of the efficiency of the oligonucleotide synthesis reaction, part of the oligonucleotide does not participate in the reaction, corresponding base is not coupled, and the oligonucleotide directly enters the next reaction, and in the second generation sequencing result, the oligonucleotide has a base lack error at the position. The deletion ratio of the bases in the second-generation sequencing result is the reaction failure rate, so that the synthesis efficiency of each step can be obtained. Thus the type of error, error rate and efficiency of synthesis at each base position can be obtained by sequence alignment, and Table 5 shows the specific distribution of oligonucleotide errors in synthetic sequence 6 in Table 2.
TABLE 5 specific distribution of oligonucleotide errors
Because each read result in the second generation sequencing result can reflect an oligonucleotide sequence, the correctness of each oligonucleotide sequence can be reflected, and after data processing, the ratio of the correct read to the total read is the purity of the oligonucleotide, and the specific calculation formula is as follows:
meanwhile, the number of wrong bases can be obtained according to a second generation sequencing result, so that the single base mutation rate is obtained through calculation, and the specific calculation formula of the single base mutation rate of the oligonucleotide is as follows:
TABLE 6 results of calculation of Synthesis efficiency
As is clear from the data in Table 6, the purity of the oligonucleotide synthesis sample (synthetic sequence 6) was 74.63%, and the single-base mutation rate was 0.86%.
Sequence listing
<110> Beijing Ongkogaku Biotechnology Co., ltd
<120> method and system for detecting quality of oligonucleotide synthesis
<160> 72
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gctgcaggtt atcgcacctg 20
<210> 2
<211> 20
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gagtttgtgc gcgagtttgc 20
<210> 3
<211> 20
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cgacgtccaa tagcgtggac 20
<210> 4
<211> 20
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ctcaaacacg cgctcaaacg 20
<210> 5
<211> 20
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ttcggtccac tgtttcggtc 20
<210> 6
<211> 20
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cgaacacgac tgtcgaacac 20
<210> 7
<211> 25
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ttcggtccac tgtttcggtc acgtt 25
<210> 8
<211> 25
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
cgaacacgac tgtcgaacac acgtt 25
<210> 9
<211> 30
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
taactcggac ggttaactcg taactcggac 30
<210> 10
<211> 30
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
aagtctacgg ccaaccgttg aaggatgaac 30
<210> 11
<211> 35
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
cgacactcta agtcgacact cgacactcta agtcg 35
<210> 12
<211> 35
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
acctggagta tgtacctgga acctggagta tgtac 35
<210> 13
<211> 40
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ttcggtccac tgtttcggtc ttcggtccac tgtttcggtc 40
<210> 14
<211> 40
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
cgaacacgac tgtcgaacac cgaacacgac tgtcgaacac 40
<210> 15
<211> 45
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
ttcggtccac tgtttcggtc ttcggtccac tgtttcggtc acgtt 45
<210> 16
<211> 45
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
cgaacacgac tgtcgaacac cgaacacgac tgtcgaacac acgtt 45
<210> 17
<211> 50
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
gagtgttatg cgtgagtgtt gagtgttatg cgtgagtgtt acgtacgtac 50
<210> 18
<211> 50
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gcagtcggta agtgagtgtt gcagtcggta agtgagtgtt acgtacgtac 50
<210> 19
<211> 55
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
gagtgttatg cgtgagtgtt gagtgttatg cgtgagtgtt acgtacgtac acgtt 55
<210> 20
<211> 55
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
gcagtcggta agtgagtgtt gcagtcggta agtgagtgtt acgtacgtac acgtt 55
<210> 21
<211> 60
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
ttcggtccac tgtttcggtc acggtagaac agtacggtag cgtaacgtac gagtgttatg 60
<210> 22
<211> 60
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
cgaacacgac tgtcgaacac cggtcaagat tgtcggtcaa cgtaacgtac gcagtcggta 60
<210> 23
<211> 65
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
ttcggtccac tgtttcggtc acgttgagtg ttatgcgtga gtgttgagtg ttatgcgtga 60
gtgtt 65
<210> 24
<211> 65
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
cgaacacgac tgtcgaacac acgttgcagt cggtaagtga gtgttgcagt cggtaagtga 60
gtgtt 65
<210> 25
<211> 70
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
taactcggac ggttaactcg taactcggac cacggatgac tgtttccgag acaaggtcag 60
cgtacaaggt 70
<210> 26
<211> 70
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
aggcgactac tgtaggcgac gcatagcgta cctgtaacgc tgtcctgtaa gtgcctcaga 60
agtgtgcctc 70
<210> 27
<211> 75
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
cgacactcta agtcgacact cgacactcta agtcgttccg aggtaagttt ccgagttccg 60
aggtaagttt ccgag 75
<210> 28
<211> 75
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
acctggagta tgtacctgga acctggagta tgtaccacgg atgactgttt ccgagcacgg 60
atgactgttt ccgag 75
<210> 29
<211> 80
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
ttcggtccac tgtttcggtc ttcggtccac tgtttcggtc cctgtaacgc tgtcctgtaa 60
cctgtaacgc tgtcctgtaa 80
<210> 30
<211> 80
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
cgaacacgac tgtcgaacac cgaacacgac tgtcgaacac cagagtagtt cgtcagagta 60
cagagtagtt cgtcagagta 80
<210> 31
<211> 85
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
ttcggtccac tgtttcggtc ttcggtccac tgtttcggtc acgttcgaca ctctaagtcg 60
acactcgaca ctctaagtcg acact 85
<210> 32
<211> 85
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
cgaacacgac tgtcgaacac cgaacacgac tgtcgaacac acgttacctg gagtatgtac 60
ctggaacctg gagtatgtac ctgga 85
<210> 33
<211> 90
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
gagtgttatg cgtgagtgtt gagtgttatg cgtgagtgtt acgtacgtac tatctcggac 60
cgttatctcg tatctcggac cgttatctcg 90
<210> 34
<211> 90
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
gcagtcggta agtgagtgtt gcagtcggta agtgagtgtt acgtacgtac gcatagcgta 60
agtgcatagc gcatagcgta agtgcatagc 90
<210> 35
<211> 95
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
gagtgttatg cgtgagtgtt gagtgttatg cgtgagtgtt acgtacgtac acgtttctgg 60
cgaacagttc tggcgtctgg cgaacagttc tggcg 95
<210> 36
<211> 95
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
gcagtcggta agtgagtgtt gcagtcggta agtgagtgtt acgtacgtac acgttgtgcc 60
tcagaagtgt gcctcgtgcc tcagaagtgt gcctc 95
<210> 37
<211> 100
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
tatgtcgtct cgttatgtcg tatgtcgtct cgttatgtcg gcagtcggta agtgagtgtt 60
gcagtcggta agtgagtgtt acaaggtcag cgtacaaggt 100
<210> 38
<211> 100
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
gagtgttatg cgtgagtgtt gagtgttatg cgtgagtgtt gcagtcggta agtgagtgtt 60
gcagtcggta agtgagtgtt gtgcctcaga agtgtgcctc 100
<210> 39
<211> 60
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
gctgcaggtt atcgcacctg ttcggtccac tgtttcggtc gagtttgtgc gcgagtttgc 60
<210> 40
<211> 60
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
gctgcaggtt atcgcacctg cgaacacgac tgtcgaacac gagtttgtgc gcgagtttgc 60
<210> 41
<211> 65
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
gctgcaggtt atcgcacctg ttcggtccac tgtttcggtc acgttgagtt tgtgcgcgag 60
tttgc 65
<210> 42
<211> 65
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
gctgcaggtt atcgcacctg cgaacacgac tgtcgaacac acgttgagtt tgtgcgcgag 60
tttgc 65
<210> 43
<211> 70
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
gctgcaggtt atcgcacctg taactcggac ggttaactcg taactcggac gagtttgtgc 60
gcgagtttgc 70
<210> 44
<211> 70
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
gctgcaggtt atcgcacctg aagtctacgg ccaaccgttg aaggatgaac gagtttgtgc 60
gcgagtttgc 70
<210> 45
<211> 75
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
gctgcaggtt atcgcacctg cgacactcta agtcgacact cgacactcta agtcggagtt 60
tgtgcgcgag tttgc 75
<210> 46
<211> 75
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
gctgcaggtt atcgcacctg acctggagta tgtacctgga acctggagta tgtacgagtt 60
tgtgcgcgag tttgc 75
<210> 47
<211> 80
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
gctgcaggtt atcgcacctg ttcggtccac tgtttcggtc ttcggtccac tgtttcggtc 60
gagtttgtgc gcgagtttgc 80
<210> 48
<211> 80
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
gctgcaggtt atcgcacctg cgaacacgac tgtcgaacac cgaacacgac tgtcgaacac 60
gagtttgtgc gcgagtttgc 80
<210> 49
<211> 85
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 49
gctgcaggtt atcgcacctg ttcggtccac tgtttcggtc ttcggtccac tgtttcggtc 60
acgttgagtt tgtgcgcgag tttgc 85
<210> 50
<211> 85
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 50
gctgcaggtt atcgcacctg cgaacacgac tgtcgaacac cgaacacgac tgtcgaacac 60
acgttgagtt tgtgcgcgag tttgc 85
<210> 51
<211> 90
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 51
gctgcaggtt atcgcacctg gagtgttatg cgtgagtgtt gagtgttatg cgtgagtgtt 60
acgtacgtac gagtttgtgc gcgagtttgc 90
<210> 52
<211> 90
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 52
gctgcaggtt atcgcacctg gcagtcggta agtgagtgtt gcagtcggta agtgagtgtt 60
acgtacgtac gagtttgtgc gcgagtttgc 90
<210> 53
<211> 95
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 53
gctgcaggtt atcgcacctg gagtgttatg cgtgagtgtt gagtgttatg cgtgagtgtt 60
acgtacgtac acgttgagtt tgtgcgcgag tttgc 95
<210> 54
<211> 95
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 54
gctgcaggtt atcgcacctg gcagtcggta agtgagtgtt gcagtcggta agtgagtgtt 60
acgtacgtac acgttgagtt tgtgcgcgag tttgc 95
<210> 55
<211> 100
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 55
gctgcaggtt atcgcacctg ttcggtccac tgtttcggtc acggtagaac agtacggtag 60
cgtaacgtac gagtgttatg gagtttgtgc gcgagtttgc 100
<210> 56
<211> 100
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 56
gctgcaggtt atcgcacctg cgaacacgac tgtcgaacac cggtcaagat tgtcggtcaa 60
cgtaacgtac gcagtcggta gagtttgtgc gcgagtttgc 100
<210> 57
<211> 105
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 57
gctgcaggtt atcgcacctg ttcggtccac tgtttcggtc acgttgagtg ttatgcgtga 60
gtgttgagtg ttatgcgtga gtgttgagtt tgtgcgcgag tttgc 105
<210> 58
<211> 105
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 58
gctgcaggtt atcgcacctg cgaacacgac tgtcgaacac acgttgcagt cggtaagtga 60
gtgttgcagt cggtaagtga gtgttgagtt tgtgcgcgag tttgc 105
<210> 59
<211> 110
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 59
gctgcaggtt atcgcacctg taactcggac ggttaactcg taactcggac cacggatgac 60
tgtttccgag acaaggtcag cgtacaaggt gagtttgtgc gcgagtttgc 110
<210> 60
<211> 110
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 60
gctgcaggtt atcgcacctg aggcgactac tgtaggcgac gcatagcgta cctgtaacgc 60
tgtcctgtaa gtgcctcaga agtgtgcctc gagtttgtgc gcgagtttgc 110
<210> 61
<211> 115
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 61
gctgcaggtt atcgcacctg cgacactcta agtcgacact cgacactcta agtcgttccg 60
aggtaagttt ccgagttccg aggtaagttt ccgaggagtt tgtgcgcgag tttgc 115
<210> 62
<211> 115
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 62
gctgcaggtt atcgcacctg acctggagta tgtacctgga acctggagta tgtaccacgg 60
atgactgttt ccgagcacgg atgactgttt ccgaggagtt tgtgcgcgag tttgc 115
<210> 63
<211> 120
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 63
gctgcaggtt atcgcacctg ttcggtccac tgtttcggtc ttcggtccac tgtttcggtc 60
cctgtaacgc tgtcctgtaa cctgtaacgc tgtcctgtaa gagtttgtgc gcgagtttgc 120
<210> 64
<211> 120
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 64
gctgcaggtt atcgcacctg cgaacacgac tgtcgaacac cgaacacgac tgtcgaacac 60
cagagtagtt cgtcagagta cagagtagtt cgtcagagta gagtttgtgc gcgagtttgc 120
<210> 65
<211> 125
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 65
gctgcaggtt atcgcacctg ttcggtccac tgtttcggtc ttcggtccac tgtttcggtc 60
acgttcgaca ctctaagtcg acactcgaca ctctaagtcg acactgagtt tgtgcgcgag 120
tttgc 125
<210> 66
<211> 125
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 66
gctgcaggtt atcgcacctg cgaacacgac tgtcgaacac cgaacacgac tgtcgaacac 60
acgttacctg gagtatgtac ctggaacctg gagtatgtac ctggagagtt tgtgcgcgag 120
tttgc 125
<210> 67
<211> 130
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 67
gctgcaggtt atcgcacctg gagtgttatg cgtgagtgtt gagtgttatg cgtgagtgtt 60
acgtacgtac tatctcggac cgttatctcg tatctcggac cgttatctcg gagtttgtgc 120
gcgagtttgc 130
<210> 68
<211> 130
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 68
gctgcaggtt atcgcacctg gcagtcggta agtgagtgtt gcagtcggta agtgagtgtt 60
acgtacgtac gcatagcgta agtgcatagc gcatagcgta agtgcatagc gagtttgtgc 120
gcgagtttgc 130
<210> 69
<211> 135
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 69
gctgcaggtt atcgcacctg gagtgttatg cgtgagtgtt gagtgttatg cgtgagtgtt 60
acgtacgtac acgtttctgg cgaacagttc tggcgtctgg cgaacagttc tggcggagtt 120
tgtgcgcgag tttgc 135
<210> 70
<211> 135
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 70
gctgcaggtt atcgcacctg gcagtcggta agtgagtgtt gcagtcggta agtgagtgtt 60
acgtacgtac acgttgtgcc tcagaagtgt gcctcgtgcc tcagaagtgt gcctcgagtt 120
tgtgcgcgag tttgc 135
<210> 71
<211> 140
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 71
gctgcaggtt atcgcacctg tatgtcgtct cgttatgtcg tatgtcgtct cgttatgtcg 60
gcagtcggta agtgagtgtt gcagtcggta agtgagtgtt acaaggtcag cgtacaaggt 120
gagtttgtgc gcgagtttgc 140
<210> 72
<211> 140
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 72
gctgcaggtt atcgcacctg gagtgttatg cgtgagtgtt gagtgttatg cgtgagtgtt 60
gcagtcggta agtgagtgtt gcagtcggta agtgagtgtt gtgcctcaga agtgtgcctc 120
gagtttgtgc gcgagtttgc 140
Claims (9)
1. A method for detecting the quality of oligonucleotide synthesis during oligonucleotide synthesis, said method comprising the steps of:
1) Synthesizing an oligonucleotide sequence to be detected by a phosphoramidite chemical synthesis method, and reserving uncoupled 5' hydroxyl group for no sealing in the synthesis process; two ends of the sequence to be detected are connected with primer sequences;
2) Sequencing the oligonucleotide test sequence synthesized in step 1) to obtain sequencing data, wherein the step 2) comprises the following steps:
a) And (3) PCR amplification: taking the oligonucleotide sequence to be detected in the step 1) as a template, and taking a sequence complementary with the primer sequence in the step 1) as a primer to perform PCR amplification, wherein the amplification cycle number is 2 cycles;
b) Generation of the library: performing end repair and adenylic acid (A) addition on the sequence obtained in the step a), connecting the sequence with a linker sequence, and performing no PCR amplification in the construction process to obtain a PCR-free library so that each reading result in a sequencing result corresponds to a primer sequence;
c) Sequencing on a computer: sequencing the sequence obtained in step b);
3) Analyzing and calculating gene mutation information of the sequencing data obtained in the step 2) to obtain the proportion of error sequences in the oligonucleotide sequence to be tested in all sequences and the proportion of correct, missing, mutated and inserted bases in different positions;
wherein the length of the sequence to be detected is 10nt-300nt;
wherein the on-machine sequencing of step 2) is performed on a second-generation sequencing platform.
2. The method according to claim 1, wherein the length of the sequence to be tested is 20nt to 100nt.
3. The method according to claim 1 or 2, wherein the sequencing is performed on an illumina sequencing platform.
4. The method according to claim 1 or 2, wherein the gene mutation information analysis and calculation is a single nucleotide polymorphism analysis.
5. The method according to claim 1 or 2, wherein the primer sequences are as follows:
the 5' end is a sequence GCTGCAGGTTATCGCACCTG; and
the 3' end is the sequence GAGTTGTGCGCGGAGTTGC.
6. The method according to claim 1 or 2, wherein the PCR amplification temperature in step a) is between 45 ℃ and 65 ℃.
7. The method according to claim 6, wherein the PCR amplification temperature in step a) is 60 ℃.
8. The method according to claim 1 or 2, wherein the purity of the oligonucleotide is specifically calculated as follows:
9. the method according to claim 1 or 2, wherein the specific calculation formula of the single base mutation rate of the oligonucleotide is as follows:
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111407032.XA CN114277113B (en) | 2021-11-24 | 2021-11-24 | Method and system for detecting oligonucleotide synthesis quality |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111407032.XA CN114277113B (en) | 2021-11-24 | 2021-11-24 | Method and system for detecting oligonucleotide synthesis quality |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114277113A CN114277113A (en) | 2022-04-05 |
| CN114277113B true CN114277113B (en) | 2022-11-15 |
Family
ID=80870281
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111407032.XA Active CN114277113B (en) | 2021-11-24 | 2021-11-24 | Method and system for detecting oligonucleotide synthesis quality |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114277113B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517889B (en) * | 2017-09-18 | 2022-04-05 | 苏州吉赛基因测序科技有限公司 | Method for analyzing oligonucleotide sequence impurities based on high-throughput sequencing and application |
| CN112105745A (en) * | 2018-05-07 | 2020-12-18 | 罗氏创新中心哥本哈根有限公司 | Massively parallel discovery methods for oligonucleotide therapeutics |
-
2021
- 2021-11-24 CN CN202111407032.XA patent/CN114277113B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114277113A (en) | 2022-04-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108300716B (en) | Linker element, application thereof and method for constructing targeted sequencing library based on asymmetric multiplex PCR | |
| EP2970951B1 (en) | Methods for nucleic acid sequencing | |
| EP3555305B1 (en) | Method for increasing throughput of single molecule sequencing by concatenating short dna fragments | |
| CN106555226B (en) | A kind of method and kit constructing high-throughput sequencing library | |
| US8182989B2 (en) | Methods for indexing samples and sequencing multiple polynucleotide templates | |
| CN106591441B (en) | Alpha and/or beta-thalassemia mutation detection probe, method and chip based on whole gene capture sequencing and application | |
| CN105986015B (en) | Method and kit for detecting one or more target sequences of multiple samples based on high-throughput sequencing | |
| JP7033602B2 (en) | Barcoded DNA for long range sequencing | |
| CN110546272B (en) | Method for attaching adaptors to sample nucleic acids | |
| CN110959045B (en) | Improved methods and kits for generating large-scale parallel sequenced DNA libraries | |
| CN113337576A (en) | Library preparation method, kit and sequencing method | |
| CN109825552B (en) | Primer and method for enriching target region | |
| CN113811618A (en) | Sequencing library constructed based on methylated DNA target region, system and application | |
| CN114277113B (en) | Method and system for detecting oligonucleotide synthesis quality | |
| EP2456892B1 (en) | Method for sequencing a polynucleotide template | |
| CN114277114A (en) | Method for adding unique identifier in amplicon sequencing and application | |
| CN115925774B (en) | Method for synthesizing specific molecular tag and molecular tag connector thereof | |
| CN112322704B (en) | Method for rapidly detecting DNA sequence mutation in batches | |
| Urmanov et al. | ANALYSIS OF THE EVOLUTION OF TECHNOLOGIES FOR DETERMINING THE NUCLEOTIDE SEQUENCE OF A DNA MOLECULE | |
| CN115948522A (en) | Method for detecting oligonucleotide sequence consistency | |
| CN114657239A (en) | Primer combination, kit and library building method for multiplex PCR (polymerase chain reaction) second-generation sequencing | |
| KR20220122095A (en) | Composition for improving molecular barcoding efficiency and use thereof | |
| CN114214734A (en) | Single-molecule target gene library building method and kit thereof | |
| CN112646809A (en) | Nucleic acid sequence, method and kit for detecting enzyme end repair capacity | |
| CN117965709A (en) | Joint for detecting mutation frequency of gene by single-ended multiple amplification and using method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 100176 Floor 6, West Half Unit, Building 3, Yard 105, Jinghai 3rd Road, Daxing District, Beijing Economic-Technological Development Area Patentee after: Beijing Qingke Biotechnology Co.,Ltd. Address before: 100176 Beijing Daxing District Beijing Economic and Technological Development Zone No. 156 Courtyard Building 401 Jinghai Fourth Road Patentee before: Beijing Qingke Biotechnology Co.,Ltd. |