CN114277111A - Method for introducing label sequence - Google Patents
Method for introducing label sequence Download PDFInfo
- Publication number
- CN114277111A CN114277111A CN202111675724.2A CN202111675724A CN114277111A CN 114277111 A CN114277111 A CN 114277111A CN 202111675724 A CN202111675724 A CN 202111675724A CN 114277111 A CN114277111 A CN 114277111A
- Authority
- CN
- China
- Prior art keywords
- umi
- sequence
- amplification
- nucleic acid
- amplification product
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention belongs to the technical field of molecular biology and discloses a method for introducing a tag sequence. According to the invention, different UMI label sequences are configured in different emulsion droplets through emulsion PCR, and each emulsion droplet is ensured to have one DNA molecule as a template, so that the same UMI label sequence is introduced into an amplification product of the same template in each specific amplification process, and the sample label sequence Index is introduced into the amplification product through second amplification, so that the final amplification product is provided with the UMI label sequence and the sample label sequence Index at the same time, the condition that a plurality of amplification products correspond to a large number of UMI label sequences is avoided, and the problem of data waste in the related technology during sequencing is solved.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a method for introducing a tag sequence.
Background
Next Generation Sequencing (NGS) can sequence millions of DNA fragments simultaneously, and when analyzing the sequencing result, it is often necessary to distinguish whether a plurality of target fragments are derived from the same template, and a common amplification method needs to introduce a sample tag sequence Index for distinguishing the library on the target fragment, and also needs to introduce a UMI tag sequence for distinguishing the template.
In a specific operation, two rounds of amplification are required, wherein the introduction of the UMI tag sequence is firstly carried out in a first round of specific amplification, and then the introduction of the sample tag sequence Index is carried out in a second round of universal primer amplification, so as to distinguish fragments from different samples. However, the above method has certain disadvantages: since the first round of amplification is aimed at specific amplification, the number of amplification cycles cannot be too small (generally about 15 rounds), but each round of specific amplification randomly introduces the UMI tag sequence into the amplification product, and if the amplification efficiency is 2, 15 rounds of amplification will result in the presence of amplification products derived from the same template and about 215Due to the corresponding situation of the UMI tag sequences, a large number of clusters correspond to the same amplification product in subsequent cluster analysis, and a large amount of data is wasted. Therefore, it is necessary to provide a method for introducing the same UMI tag sequence into the amplification product of the same template for each specific amplification, so as to reduce the waste of data.
Disclosure of Invention
The present invention is directed to solving at least one of the problems of the prior art described above. Therefore, the invention provides a method for introducing a tag sequence, which can ensure that the same UMI tag sequence is introduced into an amplification product of the same template in each specific amplification process.
The nucleic acid sequences referred to in the specification are all in the 5 '-3' orientation.
According to one aspect of the present invention, there is provided a method of introducing a tag sequence, comprising the steps of:
s1: providing a first oil phase and a first aqueous phase, the first aqueous phase being a reaction system for preparing nucleic acid fragments comprising UMI tag sequences, mixing the first oil phase and the first aqueous phase to form first emulsion droplets, disposing the nucleic acid fragments comprising UMI tag sequences in different first emulsion droplets, such that the nucleic acid fragments disposed in each of the first emulsion droplets comprise different of the UMI tag sequences;
s2: providing a sample and a first primer pair, configuring each DNA molecule in the sample, the first primer pair and the nucleic acid fragment comprising the UMI tag sequence into different second emulsion droplets, and performing specific amplification through emulsion PCR to obtain a first amplification product, so that the same UMI tag sequence is carried by the first amplification product in one second emulsion droplet;
s3: providing a second primer pair comprising a sample tag sequence Index, amplifying by using the first amplification product as a template in step S2 to obtain a second amplification product, and allowing the second amplification product to carry the sample tag sequence Index and the UMI tag sequence.
According to a preferred embodiment of the present invention, at least the following advantages are provided:
according to the invention, different UMI label sequences are configured in different emulsion droplets through emulsion PCR, and each emulsion droplet is ensured to have one DNA molecule as a template, so that the same UMI label sequence is introduced into an amplification product of the same template in each specific amplification process, and the sample label sequence Index is introduced into the amplification product through second amplification, so that the final amplification product is provided with the UMI label sequence and the sample label sequence Index at the same time, the condition that a plurality of amplification products correspond to a large number of UMI label sequences is avoided, and the problem of data waste in the related technology during sequencing is solved.
In some embodiments of the present invention, the first emulsion droplets are water-in-oil emulsion droplets, and the volume ratio of the first oil phase to the first aqueous phase is (3-3.5): 1, and preparing the composition.
In some embodiments of the invention, the first oil phase is stabilized in a stabilizer 1: stabilizer 2: emulsifier 75: 4: (800-1000) by volume ratio; the stabilizer 1 comprises at least one of span 80, tween 60 or tween 20; the stabilizer 2 comprises at least one of TritonX-100 or TritonX-114; the emulsifier comprises at least one of triglycerol monostearate or glyceryl stearate.
In some embodiments of the present invention, the UMI tag sequence is configured to include a random sequence of 8-12 bases.
In some preferred embodiments of the present invention, the UMI tag sequence is configured as a random sequence comprising 8 bases.
In some embodiments of the invention, the nucleic acid fragment comprising the UMI tag sequence is configured on a vector that is ligated to the 5' end of the nucleic acid fragment.
In some embodiments of the invention, the support is configured as a magnetic bead.
In some embodiments of the present invention, after the first amplification product is obtained by the emulsion PCR amplification, the first amplification product is purified by magnetic bead isolation and purification.
In some embodiments of the invention, the first primer pair comprises an upstream primer and a downstream primer.
In some embodiments of the invention, the 5 ' end of the forward primer is identical to the 3 ' end sequence of the nucleic acid fragment comprising the UMI tag sequence, and the 3 ' end of the forward primer is the forward primer sequence required for amplification of the DNA molecule in the sample.
In some embodiments of the invention, the 3 'end of the reverse primer is a sequence of the reverse primer required for amplification of the DNA molecule in the sample, and a sequence joining the 3' end of the reverse primer is identical to a sequence of the nucleic acid fragment comprising the UMI tag sequence.
In some embodiments of the present invention, the second emulsion droplets are in a volume ratio of the second oil phase to the second aqueous phase of (3 to 3.5): 1, and preparing the composition.
In some embodiments of the invention, the second oil phase is stabilized in a stabilizer 1: stabilizer 2: emulsifier 75: 4: (800-1000) by volume ratio; the stabilizer 1 comprises at least one of span 80, tween 60 or tween 20; the stabilizer 2 comprises at least one of TritonX-100 or TritonX-114; the emulsifier comprises at least one of triglycerol monostearate or glyceryl stearate.
In some embodiments of the present invention, the second aqueous phase is a reaction solution of the emulsion PCR in step S2.
In some embodiments of the invention, the second amplification product is obtained by PCR amplification.
In some embodiments of the present invention, after the PCR is finished, the amplification product needs to be purified by a magnetic bead separation and purification method, so as to obtain a clean second amplification product.
Drawings
The invention is further described with reference to the following figures and examples, in which:
FIG. 1 is a schematic structural diagram of a magnetic bead-N1-N2-UMI-N3 prepared according to an embodiment of the present invention;
FIG. 2 is a schematic structural diagram of a first primer pair according to an embodiment of the present invention;
FIG. 3 is a schematic illustration of droplets of a second emulsion formed in accordance with an embodiment of the present invention;
FIG. 4 is a schematic diagram of an emulsion PCR process incorporating UMI tag sequences according to an embodiment of the present invention;
FIG. 5 is a schematic diagram of the structure of a first amplification product according to an embodiment of the present invention;
FIG. 6 is a schematic structural diagram of a second primer pair according to an embodiment of the present invention;
FIG. 7 is a schematic diagram of PCR amplification with a second primer pair according to an embodiment of the present invention;
FIG. 8 is a schematic diagram showing the structure of a second amplification product according to the embodiment of the present invention.
Reference numerals:
11-magnetic beads; 12-N1-N2-UMI-N3 nucleic acid fragment; 13-DNA sample; 14-a first forward primer; 15-a first downstream primer; 16-second emulsion droplets; 21-N1-N2-UMI-N3-Insert-N2 '-N4' nucleic acid fragment; 31-a second upstream primer; 32-second downstream primer.
Detailed Description
The embodiments of the invention will be described in detail hereinafter, examples of which are illustrated in the accompanying drawings, and the embodiments described hereinafter with reference to the drawings are illustrative only and are not to be construed as limiting the invention.
If the first and second are described for the purpose of distinguishing technical features, they are not to be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated or implicitly indicating the precedence of the technical features indicated.
In the description of the present invention, unless otherwise specifically limited, terms such as amplification, ligation and the like should be understood in a broad sense, and those skilled in the art can reasonably determine the specific meanings of the above terms in the present invention by combining the specific contents of the technical solutions.
Reference in the description of the invention to the terms "one embodiment," "some embodiments," and the like, means that a particular feature or material described in connection with the embodiment is included in at least one embodiment of the invention. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment. Furthermore, the particular features or materials described may be combined in any suitable manner in any one or more embodiments.
The test methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.
Example 1
In this embodiment, a tag sequence is introduced to a sample to be tested, and the specific process is as follows:
(1) preparing a first oil phase: according to the weight ratio of Tween 80: TritonX-100: triglycerol monostearate 75: 4: 920, preparing a volume ratio;
preparing a first water phase: preparing according to the following table 1;
TABLE 1
N1 is a fixed sequence, and the sequence information is shown as SEQ ID NO. 1, specifically ACACTCTTTCCCTACACGAC; n2 is a fixed sequence, and the sequence information is shown as SEQ ID NO. 2, specifically GCTCTTCCGATCT; n3 is a fixed sequence, and the sequence information is shown as SEQ ID NO. 3, specifically GGTCTTAGGAAGACAA; UMI is a random sequence of 8 bases, denoted NNNNNNNN; n3 ' and N3 are in reverse complementary pairing, the sequence information is shown as SEQ ID NO. 4, specifically TTGTCTTCCTAAGACC, and the 5 ' end of N3 ' is modified by biotin;
first emulsion droplet formation and amplification: adding 320 mu L of first oil phase into each 100 mu L of first water phase system, and oscillating for 5min at the maximum rotation speed of a vortex mixer to prepare a first emulsion droplet system; and performing emulsion PCR (polymerase chain reaction) on each 50 mu L tube, and obtaining the nucleic acid fragment comprising the UMI tag sequence after the PCR is finished, wherein each first emulsion droplet comprises one UMI tag sequence, and the UMI tag sequences contained in the first emulsion droplets are different. The amplification procedure is shown in table 2;
TABLE 2
And (3) purifying an amplification product: taking an emulsion PCR amplification product, adding washed M270 magnetic Beads (which are magnetic Beads modified with streptavidin and can be combined with the amplification product with biotin), incubating at room temperature for 45min, mounting a magnetic frame, removing reaction liquid and unadsorbed magnetic Beads, cleaning twice by using 1 xBeads Wash Buffer, and washing by ddH2Cleaning O once and redissolving to ddH2Obtaining magnetic beads-N1-N2-UMI-N3-M270 magnetic beads (wherein the magnetic beads are connected with the 5 ' end of N1, and the M270 magnetic beads are connected with the 5 ' end of N3 ' in a complementary strand) in O; taking purified product, denaturing at 90 deg.C for 5min, quickly transferring to magnetic rack, transferring liquid and unadsorbed magnetic beads to new centrifuge tube, centrifuging, removing supernatant, and adding ddH2Cleaning twice with O, and redissolving to ddH2And O, obtaining a nucleic acid fragment magnetic bead-N1-N2-UMI-N3, wherein as shown in FIG. 1, the N1-N2-UMI-N3 nucleic acid fragment 12 is single-stranded DNA and is connected with the magnetic bead 11 through the 5' end of N1, each first emulsion droplet contains one magnetic bead-N1-N2-UMI-N3, and the nucleic acid fragment in each first emulsion droplet is different due to different UMI tag sequences.
(2) Extraction of genomic DNA: collecting 200 μ L of human whole blood, extracting whole blood DNA with universal genomic DNA extraction kit (TIANGEN, DP705) by paramagnetic particle method, collecting the extract, and extracting with ddH2O is diluted to a DNA sample concentration of 0.88 ng/. mu.L.
(3) Preparing a second oil phase: according to the weight ratio of Tween 80: TritonX-100: triglycerol monostearate 75: 4: 920, preparing a volume ratio;
preparing a second water phase: compounding as shown in Table 3;
TABLE 3
The schematic structure of the upstream primer F1 and the downstream primer R1 is shown in FIG. 2, wherein A is the upstream primer required for amplifying the DNA sample, and B is the downstream primer required for amplifying the DNA sample; the sequence information of N1, N2 and N3 is described in (1), N4 is a fixed sequence, and the sequence information is shown in SEQ ID NO:5, specifically GTGACTGGAGTTCAGACGTGT; magnetic beads-N1-N2-UMI-N3 were used to introduce UMI tag sequences during amplification;
second emulsion droplet formation and amplification: adding 320 mu L of second oil phase into each 100 mu L of second water phase system, oscillating for 5min at the maximum rotation speed of a vortex mixer to prepare second emulsion droplets 16 (shown in figures 3 and 4), wherein the second emulsion droplets 16 comprise magnetic beads 11, N1-N2-UMI-N3 nucleic acid fragments 12, DNA samples 13, first upstream primers 14 and first downstream primers 15; emulsion PCR is carried out in one tube of 100 mu L, the amplification of the DNA sample is finished after the PCR is finished, and the UMI tag sequence is introduced into an amplification product. The amplification procedure is shown in table 4;
TABLE 4
And (3) purifying an amplification product: taking the amplification product, centrifuging, removing reaction liquid, washing twice by using 80% ethanol, airing at room temperature for 1-2 min until the surface is matt, and redissolving to 20 mu L ddH2O, the first amplification product (shown in fig. 5) was obtained: magnetic bead-N1-N2-UMI-N3-Insert-N2 '-N4' (5 '-3'), composed of magnetic bead 11 and N1-N2-UMI-N3-Insert-N2 '-N4' nucleic acid fragment 21; wherein Insert is introduced by amplification and is derived from a DNA sample, N2 'is reverse complementary paired with N2, N4' is reverse complementary paired with N4,at this time, the first amplification product has a UMI tag sequence, the UMI tag sequences carried by the first amplification products located in the same second emulsion droplet are the same, and the UMI tag sequences carried by the first amplification products located in different second emulsion droplets are different, so that whether the amplification products are derived from the same template can be judged according to the UMI tag sequences, that is, the first amplification products carrying the same UMI tag sequence are obtained by amplifying the same DNA template.
(4) Preparing a PCR reaction system according to the following table 5;
TABLE 5
| Template: purified first amplification product | 20μL |
| 2×Kapa Hifi Mix | 25μL |
| The upstream primer F2: P1-Index1-N1 (5. mu.M) | 2.5μL |
| The downstream primer R2: P2-Index2-N4 (5. mu.M) | 2.5μL |
| Total volume | 50μL |
The schematic structural diagram of the upstream primer F2 and the downstream primer R2 is shown in FIG. 6, P1 is a fixed sequence, and the sequence information is shown in SEQ ID NO. 6, specifically AATGATACGGCGACCACCGAGATCTACAC; index1 is the tag sequence 1 that distinguishes the samples; p2 is a fixed sequence, the sequence information is shown in SEQ ID NO. 7, specifically CAAGCAGAAGACGGCATACGAGAT, Index2 is a tag sequence 2 for distinguishing samples;
performing PCR (as shown in FIG. 7), wherein N1-N2-UMI-N3-Insert-N2 '-N4' nucleic acid fragment 21 connected with magnetic beads 11 is used as a template, a second upstream primer 31 and a second downstream primer 32 are used as primer pairs for amplification, and after the amplification is finished, a sample tag sequence is introduced to each of two ends of an amplification product; following the amplification procedure of Table 6;
TABLE 6
And (3) purifying an amplification product: taking 50 mu L of amplification product, adding 60 mu L of XPBeads, incubating for 5min at room temperature, putting on a magnetic frame, removing reaction liquid and unadsorbed magnetic Beads, washing twice with 80% ethanol, airing for 1-2 min at room temperature until the surface is matt, and redissolving to 20 mu L of ddH2In O, the magnetic frame was reapplied to obtain a second amplification product (shown in FIG. 8): P1-Index1-N1-N2-UMI-N3-Insert-N2 '-N4' -Index2 '-P2' (5 '-3'), wherein Index2 'is reverse complementary paired with Index2 and P2' is reverse complementary paired with P2.
At the moment, the amplified products simultaneously carry sample label sequences Index and UMI label sequences, so that the amplified products can be labeled with samples, each amplified product is provided with an exclusive number plate belonging to the amplified product, and sequencing data from each sample can be obtained through the number plate after multi-sample mixed sequencing; and the amplification products amplified in the same template carry the same UMI label, so that the source of the amplification products can be judged, the same amplification product does not need to be clustered correspondingly in subsequent sequencing and clustering analysis, and the data waste is greatly reduced.
The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present invention. Furthermore, the embodiments of the present invention and the features of the embodiments may be combined with each other without conflict.
SEQUENCE LISTING
<110> Shenzhen nuclear gene technology Limited
<120> a method for introducing tag sequence
<130> 1
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> N1
<400> 1
acactctttc cctacacgac 20
<210> 2
<211> 13
<212> DNA
<213> N2
<400> 2
<210> 3
<211> 16
<212> DNA
<213> N3
<400> 3
<210> 4
<211> 16
<212> DNA
<213> N3'
<400> 4
<210> 5
<211> 21
<212> DNA
<213> N4
<400> 5
<210> 6
<211> 29
<212> DNA
<213> P1
<400> 6
aatgatacgg cgaccaccga gatctacac 29
<210> 7
<211> 24
<212> DNA
<213> P2
<400> 7
caagcagaag acggcatacg agat 24
Claims (10)
1. A method of introducing a tag sequence, comprising the steps of:
s1: providing a first oil phase and a first aqueous phase, the first aqueous phase being a reaction system for preparing nucleic acid fragments comprising UMI tag sequences, mixing the first oil phase and the first aqueous phase to form first emulsion droplets, disposing the nucleic acid fragments comprising UMI tag sequences in different first emulsion droplets, such that the nucleic acid fragments disposed in each of the first emulsion droplets comprise different of the UMI tag sequences;
s2: providing a sample and a first primer pair, configuring each DNA molecule in the sample, the first primer pair and the nucleic acid fragment comprising the UMI tag sequence into different second emulsion droplets, and performing specific amplification through emulsion PCR to obtain a first amplification product, so that the same UMI tag sequence is carried by the first amplification product in one second emulsion droplet;
s3: providing a second primer pair comprising a sample tag sequence Index, amplifying by using the first amplification product as a template in step S2 to obtain a second amplification product, and allowing the second amplification product to carry the sample tag sequence Index and the UMI tag sequence.
2. The method according to claim 1, wherein the first emulsion droplets are water-in-oil emulsion droplets, and the ratio of the volume of the first oil phase to the volume of the first aqueous phase is (3-3.5): 1, preparing;
the first oil phase is prepared by mixing a stabilizer 1: stabilizer 2: emulsifier 75: 4: (800-1000) by volume ratio; the stabilizer 1 comprises at least one of span 80, tween 60 or tween 20; the stabilizer 2 comprises at least one of TritonX-100 or TritonX-114; the emulsifier comprises at least one of triglycerol monostearate or glyceryl stearate.
3. The method of claim 1, wherein the UMI tag sequence is configured as a random sequence comprising 8-12 bases.
4. The method of claim 1, wherein the nucleic acid fragment comprising the UMI tag sequence is configured on a vector that is ligated to the 5' end of the nucleic acid fragment.
5. The method of claim 4, wherein the support is configured as a magnetic bead.
6. The method of claim 1, wherein the first primer pair comprises an upstream primer and a downstream primer.
7. The method of claim 6, wherein the 5 ' end of the forward primer is identical to the 3 ' end of the nucleic acid fragment comprising the UMI tag sequence, and the 3 ' end of the forward primer is the forward primer sequence required for amplification of the DNA molecule in the sample.
8. The method of claim 6, wherein the 3 'end of the reverse primer is a reverse primer sequence required for amplification of the DNA molecule in the sample, and wherein a sequence joining the 3' end of the reverse primer is identical to a sequence of the nucleic acid fragment comprising the UMI tag sequence.
9. The method according to claim 1, wherein the second emulsion droplets are mixed in a volume ratio of the second oil phase to the second aqueous phase of (3-3.5): 1, preparing;
the second oil phase is prepared by mixing a stabilizing agent 1: stabilizer 2: emulsifier 75: 4: (800-1000) by volume ratio; the stabilizer 1 comprises at least one of span 80, tween 60 or tween 20; the stabilizer 2 comprises at least one of TritonX-100 or TritonX-114; the emulsifier comprises at least one of triglycerol monostearate or glyceryl stearate;
the second aqueous phase is the reaction solution of the emulsion PCR in step S2.
10. The method of claim 1, wherein the second amplification product is amplified by PCR.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111675724.2A CN114277111A (en) | 2021-12-31 | 2021-12-31 | Method for introducing label sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111675724.2A CN114277111A (en) | 2021-12-31 | 2021-12-31 | Method for introducing label sequence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114277111A true CN114277111A (en) | 2022-04-05 |
Family
ID=80879718
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111675724.2A Pending CN114277111A (en) | 2021-12-31 | 2021-12-31 | Method for introducing label sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114277111A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111379033A (en) * | 2020-04-21 | 2020-07-07 | 深圳易倍科华生物科技有限公司 | Multiple PCR method for adding molecular label and library building instrument |
| US20210214791A1 (en) * | 2018-05-22 | 2021-07-15 | Universite De Strasbourg | Absolute quantification of target molecules at single-entity resolution using tandem barcoding |
| WO2021168015A1 (en) * | 2020-02-17 | 2021-08-26 | Universal Sequencing Technology Corporation | Methods of barcoding nucleic acid for detection and sequencing |
-
2021
- 2021-12-31 CN CN202111675724.2A patent/CN114277111A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210214791A1 (en) * | 2018-05-22 | 2021-07-15 | Universite De Strasbourg | Absolute quantification of target molecules at single-entity resolution using tandem barcoding |
| WO2021168015A1 (en) * | 2020-02-17 | 2021-08-26 | Universal Sequencing Technology Corporation | Methods of barcoding nucleic acid for detection and sequencing |
| CN111379033A (en) * | 2020-04-21 | 2020-07-07 | 深圳易倍科华生物科技有限公司 | Multiple PCR method for adding molecular label and library building instrument |
Non-Patent Citations (1)
| Title |
|---|
| ASSAF ROTEM等: "High-Throughput Single-Cell Labeling (Hi-SCL) for RNA-Seq Using Drop-Based Microfluidics", PLOS ONE, vol. 10, no. 5, pages 2 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110050067B (en) | Methods of producing amplified double-stranded deoxyribonucleic acid, and compositions and kits for use in the methods | |
| WO2016037394A1 (en) | Method for constructing nucleic acid single-stranded cyclic library and reagents thereof | |
| CN110409001A (en) | The method and kit in a kind of building capture library | |
| JP5906740B2 (en) | RNA extraction solution | |
| CN109576347B (en) | Sequencing joint containing single-molecule label and construction method of sequencing library | |
| CN110684829A (en) | High-throughput single-cell transcriptome sequencing method and kit | |
| CN111808854B (en) | Balanced joint with molecular bar code and method for quickly constructing transcriptome library | |
| US10435736B2 (en) | Target region enrichment method based on multiplex PCR, and reagent | |
| CN107893100A (en) | A kind of unicellular mRNA reverse transcriptions and the method for amplification | |
| JP7248228B2 (en) | Methods and kits for construction of RNA libraries | |
| CN108531475A (en) | A kind of high throughput transcript profile library constructing method | |
| CN105602939A (en) | DNA amplification method | |
| CN112410331A (en) | Linker with molecular label and sample label and single-chain library building method thereof | |
| EP3719182B1 (en) | Method for constructing library of cell-free dnas in body fluids and application thereof | |
| CN109750086A (en) | The construction method in single stranded circle library | |
| CN113039283B (en) | Method and reagent for separating and/or enriching host source nucleic acid and pathogenic nucleic acid and preparation method thereof | |
| CN114277111A (en) | Method for introducing label sequence | |
| CN116287115A (en) | Method for obtaining single cell or single cell nucleus sample, sample obtained by using same and application | |
| CN109486922A (en) | A method of based on single primed probe Acquisition Detection microorganism target sequence | |
| CN111793623A (en) | Typing genetic marker composition, kit, identification system and typing method of 62 multi-allelic SNP-NGS | |
| US20230120072A1 (en) | Methods for extracting and sequencing single-stranded dna and rna from non-treated biospecimens | |
| CN114774514B (en) | Library construction method and kit suitable for high-throughput targeted genome methylation detection | |
| CN114836415B (en) | Preparation of MGI platform transposase double-end tag library | |
| CN110168087B (en) | DNA tag and application thereof | |
| WO2023159416A1 (en) | Single-cell transcriptome sequencing method and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |