CN114277069A - Method for producing L-valine and biomaterial used therefor - Google Patents

Method for producing L-valine and biomaterial used therefor Download PDF

Info

Publication number
CN114277069A
CN114277069A CN202111563021.0A CN202111563021A CN114277069A CN 114277069 A CN114277069 A CN 114277069A CN 202111563021 A CN202111563021 A CN 202111563021A CN 114277069 A CN114277069 A CN 114277069A
Authority
CN
China
Prior art keywords
cey17
seq
microorganism
valine
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111563021.0A
Other languages
Chinese (zh)
Other versions
CN114277069B (en
Inventor
赵春光
孟刚
魏爱英
田斌
毕国东
贾慧萍
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangxin Biological Intelligent Manufacturing Technology Innovation (Shenzhen) Co.,Ltd.
Original Assignee
Ningxia Eppen Biotech Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ningxia Eppen Biotech Co ltd filed Critical Ningxia Eppen Biotech Co ltd
Priority to CN202111563021.0A priority Critical patent/CN114277069B/en
Publication of CN114277069A publication Critical patent/CN114277069A/en
Application granted granted Critical
Publication of CN114277069B publication Critical patent/CN114277069B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses a method for preparing L-valine and a biological material used by the same. Specifically disclosed is a mutein CEY17_ RS13420G239EAnd a gene encoding the same. The invention constructs genetically engineered bacteria containing point mutation (G-A), and over-expression CEY17_ RS13420 gene or CEY17_ RS13420G716AEngineering bacteria of genes. Experiments show that the CEY17_ RS13420 gene and variants thereof are involved in L-valine biosynthesis, and the coding region of the CEY17_ RS13420 gene is subjected to point mutation or in-situ generationThe over-expression of the CEY17_ RS13420 gene and/or the mutant thereof in the strain is beneficial to the improvement of the yield and the conversion rate of the L-valine, can culture a high-yield and high-quality strain meeting the industrial production, and has important significance for the industrial production of the L-valine.

Description

Method for producing L-valine and biomaterial used therefor
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method for preparing L-valine and a biological material used by the method.
Background
L-valine, whose chemical name is alpha-aminoisovaleric acid, is one of the branched chain amino acids and cannot be synthesized by humans and animals themselves. L-valine is one of eight essential amino acids, has effects of promoting protein synthesis, inhibiting protein decomposition, enhancing immunity, and correcting negative nitrogen balance caused by operation, wound, infection, etc. In addition, L-valine also has the effects of resisting central fatigue, resisting peripheral fatigue, delaying exercise-induced fatigue and accelerating the repair of an organism after exercise, so that the L-valine has wide application and commercial value in the food and medicine industries. L-valine gel has a positively charged terminal group, is a novel low molecular weight gel, can gel not only purified and aqueous solutions containing inorganic acids and salts but also organic solvents and oils, can prepare and form hydrogels, and has been widely used in the fields of biomedicine, tissue engineering, photochemistry, electrochemistry, food industry, cosmetics, and the like. L-valine has a large market demand because it has a specific physiological function, so that the production of L-valine is of great interest.
At present, the production method of L-valine mainly comprises an extraction method, a chemical synthesis method and a fermentation method. The extraction method and the chemical synthesis method have the defects of limited raw material sources, high production cost, low yield and serious pollution, and are difficult to realize industrial production. The method for producing L-valine by the direct microbial fermentation method has the advantages of wide raw material source, low cost, mild reaction conditions, easy realization of large-scale production and the like, and is a very economic and efficient production method. The strain with high yield obtained in industrial fermentation is important for the fermentation production of L-valine, is the core of the whole L-valine fermentation industry, and is an important factor for determining the industrial value of a fermentation product. With the increasing market demand of L-valine, breeding high-yield and stable production strains, promoting the accumulation of L-valine in microorganisms, and further improving the yield of L-valine are always hot spots of the technical development and fermentation engineering research of the L-valine fermentation industry, and have important significance for promoting the industrialization process of L-valine.
Disclosure of Invention
The technical problem to be solved by the invention is how to improve the yield of L-valine. The technical problem to be solved is not limited to the technical subject as described, and other technical subject not mentioned herein may be clearly understood by those skilled in the art through the following description.
To solve the above technical problems, the present invention first provides a method for producing L-valine, comprising producing L-valine using a recombinant microorganism expressing a protein;
the protein may be any one of the following:
A1) a protein having an amino acid sequence of SEQ ID No. 4;
A2) a protein which is obtained by substituting and/or deleting and/or adding amino acid residues to the amino acid sequence shown in SEQ ID No.4, has more than 80% of identity with the protein shown in A1), and has the same function;
A3) a fusion protein with the same function obtained by connecting labels at the N end and/or the C end of A1) or A2).
In the above method, the method may be a fermentation method for producing L-valine, and the recombinant microorganism may be Corynebacterium (Corynebacterium), specifically, Corynebacterium glutamicum (Corynebacterium glutamicum) and variants thereof.
In one embodiment of the present invention, the recombinant microorganism is Corynebacterium glutamicum (Corynebacterium glutamicum) CGMCC No.21260, recombinant bacteria YPV-055, YPV-056, YPV-057, YPV-058 or YPV-059.
In the above method, the protein is named as protein CEY17_ RS13420G239EThe protein CEY17_ RS13420G239EAre also within the scope of the invention。
The invention also provides a nucleic acid molecule which may be any one of:
B1) encoding the protein CEY17_ RS13420G239EThe nucleic acid molecule of (1);
B2) the coding sequence is a DNA molecule shown in SEQ ID No. 3;
B3) the nucleotide sequence is a DNA molecule shown in SEQ ID No. 3.
The DNA molecule shown in SEQ ID No.3 is the CEY17_ RS13420G716AA gene.
DNA molecule shown as SEQ ID No.3 (CEY17_ RS13420)G716A) Encoding the protein CEY17_ RS13420 shown in SEQ ID No.4G239E。
The protein CEY17_ RS13420G239EThe 239 th glutamic acid (E) in the amino acid sequence (SEQ ID No.4) is mutated from glycine (G).
The invention also provides a biomaterial, which can be any one of the following:
C1) containing the nucleic acid molecule CEY17_ RS13420G716AThe expression cassette of (1);
C2) containing the nucleic acid molecule CEY17_ RS13420G716AOr a recombinant vector containing the expression cassette of C1);
C3) containing the nucleic acid molecule CEY17_ RS13420G716AOr a recombinant microorganism containing C1) the expression cassette or a recombinant microorganism containing C2) the recombinant vector.
The invention also provides any one of the following applications of any one of D1) -D8):
F1) d1) -D8) in regulating the production of L-valine by a microorganism;
F2) d1) -D8) in constructing a genetic engineering bacterium for producing L-valine;
F3) the use of any one of D1) -D8) in the preparation of L-valine;
wherein, the D1) -D8) are:
D1) the protein CEY17_ RS13420G239E；
D2) The nucleic acid molecule CEY17_ RS13420G716A；
D3) The biological material;
D4) a DNA molecule with a nucleotide sequence of SEQ ID No. 1;
D5) a DNA molecule which is obtained by modifying and/or substituting and/or deleting and/or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1, has more than 90 percent of identity with the DNA molecule shown in SEQ ID No.1 and has the same function;
D6) an expression cassette comprising the DNA molecule of D4) or D5);
D7) a recombinant vector containing the DNA molecule described in D4) or D5), or a recombinant vector containing the expression cassette described in D6);
D8) a recombinant microorganism containing the DNA molecule described in D4) or D5), or a recombinant microorganism containing the expression cassette described in D6), or a recombinant microorganism containing the recombinant vector described in D7).
The DNA molecule shown in SEQ ID No.1 is the CEY17_ RS13420 gene.
The DNA molecule shown in SEQ ID No.1 (CEY17_ RS13420 gene) encodes the protein shown in SEQ ID No. 2.
Herein, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of the amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web pages of the NCBI home website. For example, in the advanced BLAST2.1, by using blastp as a program, setting the value of Expect to 10, setting all filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residual Gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a calculation by searching for the identity of a pair of amino acid sequences, a value (%) of identity can be obtained.
Herein, the 80% or greater identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
Herein, the 90% or greater identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
The regulation of the production of L-valine by the microorganism as described herein may be an increase or decrease in the production of L-valine by the microorganism, that is, an increase or decrease in the accumulation of L-valine in the microorganism (promotion or inhibition of L-valine biosynthesis).
The present invention also provides a method for increasing the production of L-valine in a microorganism, which comprises any one of:
E1) increasing the nucleic acid molecule CEY17_ RS13420 in a microorganism of interestG716AThe expression amount or content of (a), a microorganism having a higher L-valine yield than the target microorganism is obtained;
E2) increasing the expression level or the content of the DNA molecule D4) or D5) in the target microorganism to obtain a microorganism with higher L-valine yield than the target microorganism;
E3) and (2) carrying out mutation (such as base substitution, base insertion or base deletion) on the DNA molecule with the nucleotide sequence of SEQ ID No.1 in the target microorganism to obtain the microorganism with higher L-valine yield than the target microorganism.
In the above method, the mutation may be a point mutation (point mutation), i.e., a mutation of a single nucleotide.
In the above method, the point mutation may be a mutation of a residue of glycine at position 239 of an amino acid sequence encoded by the DNA molecule shown in SEQ ID No.1 to another residue.
In the method, the point mutation can be obtained by mutating the 239 th glycine of the amino acid sequence encoded by the DNA molecule shown in SEQ ID No.1 into glutamic acid to obtain the mutant protein CEY17_ RS13420 with the amino acid sequence of SEQ ID No.4G239E。
The mutation is to change one or several bases in the gene by site-directed mutation, which results in the change of the amino acid composition of the corresponding protein, the generation of new protein or the generation of new function of the original protein, i.e., the site-directed mutation of the gene. Techniques for site-directed mutagenesis of genes, such as oligonucleotide primer-mediated site-directed mutagenesis, PCR-mediated site-directed mutagenesis, or cassette mutagenesis are well known to those skilled in the art.
The point mutation described herein may be a single base substitution, a single base insertion, or a single base deletion, and specifically may be a single base substitution. The single base substitution may be an allelic substitution.
The point mutation can be nucleic acid modification of guanine (G) 716 of CEY17_ RS13420 gene (SEQ ID No. 1).
Specifically, the point mutation can be that guanine (G) at position 716 of the CEY17_ RS13420 gene (SEQ ID No.1) is mutated into adenine (A), so as to obtain the DNA molecule shown in SEQ ID No. 3.
Vectors described herein are well known to those skilled in the art and include, but are not limited to: plasmids, phages (e.g., lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), or viral vectors. Specifically, the compound may be pK18mobsacB or pXMJ 19.
Herein, the microorganism may be yeast, bacteria, algae or fungi. The bacteria may be derived from Brevibacterium (Brevibacterium), Corynebacterium (Corynebacterium), Escherichia (Escherichia), Aerobacter (Aerobacter), Micrococcus (Micrococcus), Flavobacterium (Flavobacterium), Bacillus (Bacillus), etc.
Specifically, the microorganism may be, but is not limited to, Corynebacterium glutamicum (Corynebacterium glutamicum), Brevibacterium flavum (Brevibacterium flavum), Brevibacterium lactofermentum (Brevibacterium lactofermentum), Micrococcus glutamicum (Micrococcus glutamicum), Brevibacterium ammoniagenes (Brevibacterium ammoniagenes), Escherichia coli (Escherichia coli), or Aerobacter aerogenes (Aerogenes).
Specifically, the microorganism may be Corynebacterium glutamicum (Corynebacterium glutamicum) CGMCC No.21260, or Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC 14067.
Herein, the recombinant vector may specifically be the recombinant vector pK18-CEY17_ RS13420G716A、pK18-CEY17_RS13420OE、pK18-CEY17_RS13420G716AOE, pXMJ19-CEY17_ RS13420 or pXMJ19-CEY17_ RS13420G716A。
The recombinant vector pK18-CEY17_RS13420G716AThe recombinant vector is obtained by replacing a fragment (small fragment) between Xbal I and/BamH I recognition sites of a pK18mobsacB vector with a DNA fragment shown in 37 th to 1286 th sites of SEQ ID No.5 in a sequence table and keeping other sequences of the pK18mobsacB vector unchanged. The recombinant vector pK18-CEY17_ RS13420G716AGene CEY17_ RS13420 containing a mutation shown in SEQ ID No.3G716AThe 108-th and 1357-th DNA molecule.
The recombinant vector pK18-CEY17_ RS13420OE is used for integrating a foreign gene CEY17_ RS13420 into a host chromosome and overexpressing a wild-type CEY17_ RS13420 gene in a production strain.
The recombinant vector pK18-CEY17_ RS13420G716AOE for use of exogenous gene CEY17_ RS13420G716AIntegration into host chromosome and overexpression of mutant gene CEY17_ RS13420 in producerG716A。
The recombinant vector pXMJ19-CEY17_ RS13420 is used for extrachromosomally expressing the exogenous gene CEY17_ RS13420 through a plasmid, and further over-expressing a wild-type CEY17_ RS13420 gene in a production strain.
The recombinant vector pXMJ19-CEY17_ RS13420G716AUsed for introducing exogenous gene CEY17_ RS13420G716AExpressing outside chromosome by plasmid, and then over-expressing mutant gene CEY17_ RS13420 in production bacteriaG716A。
The recombinant vector pK18-CEY17_ RS13420G716A、pK18-CEY17_RS13420OE、pK18-CEY17_RS13420G716AOE, pXMJ19-CEY17_ RS13420 and pXMJ19-CEY17_ RS13420G716AAre within the scope of the invention.
Herein, the recombinant microorganism may be specifically recombinant bacteria YPV-055, YPV-056, YPV-057, YPV-058 or YPV-059.
The recombinant bacterium YPV-055 is obtained by carrying out pK18-CEY17_ RS13420 on the recombinant vectorG716AA recombinant bacterium obtained by transforming Corynebacterium glutamicum (CGMCC No. 21260), wherein the recombinant bacterium YPV-055 contains a mutated gene CEY17_ RS13420 shown in SEQ ID No.3G716A。
The recombinant bacterium YPV-056 contains double copies of the CEY17_ RS13420 gene shown in SEQ ID No. 1; specifically, the recombinant bacterium YPV-056 is obtained by replacing the spacer of the upper homologous arm CEY17_02570 and the lower homologous arm CEY17_02575 in the genome of Corynebacterium glutamicum CGMCC No.21260 with a CEY17_ RS13420 gene and keeping the other nucleotides in the genome of Corynebacterium glutamicum CGMCC No.21260 unchanged. The recombinant bacterium containing the double-copy CEY17_ RS13420 gene can obviously and stably improve the expression level of the CEY17_ RS13420 gene. The recombinant bacterium YPV-056 is an engineering bacterium which overexpresses a wild-type CEY17_ RS13420 gene on a genome.
The recombinant bacterium YPV-057 contains mutant CEY17_ RS13420 shown as SEQ ID No.3G716AA gene; specifically, the recombinant bacterium YPV-057 is prepared by replacing the spacer of the upper homologous arm CEY17_02570 and the lower homologous arm CEY17_02575 in the genome of Corynebacterium glutamicum CGMCC No.21260 with CEY17_ RS13420G716AGene, recombinant bacterium obtained by keeping other nucleotide in the genome of Corynebacterium glutamicum CGMCC No.21260 unchanged. The recombinant bacterium YPV-057 is a mutant CEY17_ RS13420 overexpressed on the genomeG716AEngineering bacteria of genes.
The recombinant bacterium YPV-058 contains a CEY17_ RS13420 gene shown in SEQ ID No. 1; the recombinant bacterium YPV-058 is an engineering bacterium which overexpresses the wild-type CEY17_ RS13420 gene on a plasmid, namely, the plasmid pXMJ19-CEY17_ RS13420 is overexpressed outside a chromosome.
The recombinant bacterium YPV-059 contains mutant CEY17_ RS13420 shown as SEQ ID No.3G716AA gene; the recombinant bacterium YPV-059 is prepared by overexpressing mutant CEY17_ RS13420 on a plasmidG716AGenetically engineered bacteria, namely plasmid pXMJ19-CEY17_ RS13420G716AThe overexpression is carried out extrachromosomally.
The recombinant bacteria YPV-055, YPV-056, YPV-057, YPV-058 and YPV-059 are all in the protection scope of the invention.
The present invention also provides a method for constructing the recombinant microorganism, the method comprising at least any one of:
F1) subjecting the nucleic acid molecule to CEY17_ RS13420G716AIntroducing a target microorganism to obtain the recombinant microorganism;
F2) introducing a DNA molecule shown in SEQ ID No.1 into a target microorganism to obtain the recombinant microorganism;
F3) the DNA molecule shown in SEQ ID No.1 is edited by a gene editing means (such as single base gene editing) so that the target microorganism contains the DNA molecule shown in SEQ ID No. 3.
The introduction may be carried out by transforming the host bacterium with the vector carrying the DNA molecule of the present invention by any known transformation method such as chemical transformation or electroporation. The introduced DNA molecule may be in single or multiple copies. The introduction may be the integration of the foreign gene into the host chromosome or the extrachromosomal expression from a plasmid.
The invention firstly introduces point mutation in a CEY17_ RS13420 gene coding region (SEQ ID No.1) of Corynebacterium glutamicum (Corynebacterium glutamicum) CGMCC No.21260 (sequence confirmation confirms that a wild-type CEY17_ RS13420 gene is reserved on a strain chromosome) in an allelic gene replacement mode, and constructs genetically engineered bacteria YPV-055 containing the point mutation (G-A). For further research, the wild-type CEY17_ RS13420 gene or the mutant gene CEY17_ RS13420 thereof is over-expressed in production bacteriaG716ACan increase the yield of L-valine, integrate a foreign gene into a host chromosome or express the foreign gene outside the host chromosome by a plasmid, and construct a CEY17_ RS13420 gene or CEY17_ RS13420 gene which is overexpressed on the genome and the plasmidG716AGenetically engineered bacteria YPV-056, YPV-057, YPV-058 and YPV-059. Experiments show that the CEY17_ RS13420 gene and variants thereof are involved in L-valine biosynthesis, and the accumulation of L-valine in microorganisms can be regulated by overexpression or knockout of the CEY17_ RS13420 gene or site-directed mutation (such as point mutation). The coding region of the CEY17_ RS13420 gene is point mutated or the CEY17_ RS13420 gene is over-expressed in a production bacterium or the mutated gene CEY17_ RS13420 thereofG716AThe knockout or weakening of the CEY17_ RS13420 gene is not beneficial to the accumulation of L-valine. The CEY17_ RS13420 gene and variants thereof (e.g., CEY17_ RS13420) can be usedG716AGene) to construct a genetically engineered strain producing L-valine to promote the increase in the yield of L-valine,the culture of the high-yield and high-quality strain which meets the industrial production has wide application value and important economic significance for the industrial production of the L-valine.
Deposit description
The strain name is as follows: corynebacterium glutamicum
Latin name: corynebacterium glutamicum
The strain number is as follows: YPFV1
The preservation organization: china general microbiological culture Collection center
The preservation organization is abbreviated as: CGMCC (China general microbiological culture Collection center)
Address: xilu No.1 Hospital No.3 of Beijing market facing Yang district
The preservation date is as follows: year 2020, 11 and 30
Registration number of the preservation center: CGMCC No.21260
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Corynebacterium glutamicum (Corynebacterium glutamicum) YPFV1 CGMCC No.21260 in the following examples was obtained by mutagenesis of Corynebacterium glutamicum ATCC15168, and was deposited in China general microbiological culture Collection center (CGMCC, address: Sai Lu No.3, institute of microbiology, Ministry of China, GmbH, Ind., Tokyo, N.O.P.C.) on 11/30/2020, and the accession number of CGMCC No. 21260. Corynebacterium glutamicum YPFV1 (also called Corynebacterium glutamicum CGMCC No. 21260).
Example 1 construction of a recombinant vector containing a fragment of the coding region of the CEY17_ RS13420 Gene with a point mutation
According to the genome sequence of Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC14067 published by NCBI, two pairs of primers for amplifying CEY17_ RS13420 gene coding region are designed and synthesized, and point mutation is introduced in the CEY17_ RS13420 gene coding region (SEQ ID No.1) of Corynebacterium glutamicum (Corynebacterium glutamicum) CGMCC No.21260 (the wild type CEY17_ RS13420 gene is reserved on the chromosome by sequencing confirmation of the strain), wherein the point mutation is that guanine (G) at position 716 in the nucleotide sequence (SEQ ID No.1) of CEY17_ RS13420 gene is mutated into adenine (A), and a DNA molecule (mutated CEY17_ RS13420 gene, which is named as CEY17_ RS13420 geneG716A)。
Wherein, the DNA molecule shown in SEQ ID No.1 encodes a protein (the protein is named as protein CEY17_ RS13420) with the amino acid sequence of SEQ ID No. 2.
The DNA molecule shown in SEQ ID No.3 encodes the mutant protein with the amino acid sequence of SEQ ID No.4 (the name of the mutant protein is CEY17_ RS13420G239E). The mutein CEY17_ RS13420G239EThe 239 th glutamic acid (E) in the amino acid sequence (SEQ ID No.4) is mutated from glycine (G).
The site-directed mutagenesis of the gene was performed by the overlap PCR (overlap PCR) technique, the primers were designed as follows (synthesized by Shanghai Invitrogen), and the base in bold font is the position of the mutation:
Figure BDA0003421352140000081
the construction method comprises the following steps: PCR amplification was carried out using Corynebacterium glutamicum ATCC14067 as a template and primers P1 and P2, P3 and P4, respectively, to obtain two DNA fragments (CEY17_ RS13420Up and CEY17_ RS13420 Down) carrying 662bp and 696bp of coding regions of the CEY17_ RS13420 gene, respectively, as mutated bases.
The PCR amplification system is as follows: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 m each)M)4μL，Mg2+4. mu.L (25mM), 2. mu.L each of primers (10pM), 0.25. mu.L of Ex Taq (5U/. mu.L), and a total volume of 50. mu.L;
the PCR amplification reaction program is as follows: pre-denaturation at 94 ℃ for 5min, (denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 40s, 30 cycles), and over-extension at 72 ℃ for 10 min.
The two DNA fragments (CEY17_ RS13420Up and CEY17_ RS13420 Down) were separated and purified by agarose gel electrophoresis, the target band was recovered, and the two DNA fragments were used as templates and P1 and P4 as primers to amplify by Overlap PCR to obtain a DNA fragment 1324bp in size (named CEY17_ RS13420Up-Down, the sequence of which is shown in SEQ ID No. 5). In the DNA fragment shown in SEQ ID No.5, the 37 th to 1286 th (1250bp) are CEY17_ RS13420 containing mutation sitesG716AThe gene fragment (i.e., position 108-1357 of SEQ ID No. 3).
The Overlap PCR amplification reaction system is as follows: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 mM each) 4. mu.L, Mg2+4. mu.L (25mM), 2. mu.L each of primers (10pM), 0.25. mu.L of Ex Taq (5U/. mu.L), and a total volume of 50. mu.L;
the procedure of the Overlap PCR amplification reaction is as follows: pre-denaturation at 94 ℃ for 5min, (denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 60s, 30 cycles), and over-extension at 72 ℃ for 10 min.
The DNA fragment (CEY17_ RS13420Up-Down, SEQ ID No.5) contains a mutation site, and is used for introducing nucleic acid modification at the 716 th site of a coding region of a wild type CEY17_ RS13420 gene in a strain Corynebacterium glutamicum CGMCC No.21260, specifically, guanine (G) at the 716 th site is mutated into adenine (A), and finally, glycine (G) at the 239 th site of the encoded protein is mutated into glutamic acid (E). The DNA fragment (CEY17_ RS13420 Up-Down) was separated by agarose gel electrophoresis, purified, ligated with pK18mobsacB plasmid (obtained from Addgene, digested with XbaI/BamH I) purified by digestion (XbaI/BamH I) with NEBuilder enzyme (obtained from NEB) at 50 ℃ for 30min, and the ligation product was transformed into DH5a (obtained from TAKARA) to grow a single clone, which was then PCR-verified to obtain the positive recombinant vector pK18-CEY17_ RS13420G716AThe recombinant vector contains kanamycin resistance (Kan)r) And (4) marking. Cutting the enzyme to correct weightGroup vector pK18-CEY17_ RS13420G716ASequencing and identifying by a sequencing company, and adding a recombinant vector pK18-CEY17_ RS13420 containing the correct point mutation (G-A)G716AAnd (5) storing for later use.
The recombinant vector pK18-CEY17_ RS13420G716AThe recombinant vector is obtained by replacing a fragment (small fragment) between Xbal I and/BamH I recognition sites of a pK18mobsacB vector with a DNA fragment shown in 37 th to 1286 th sites of SEQ ID No.5 in a sequence table and keeping other sequences of the pK18mobsacB vector unchanged.
The recombinant vector pK18-CEY17_ RS13420G716AGene CEY17_ RS13420 containing a mutation shown in SEQ ID No.3G716AThe 108-th and 1357-th DNA molecule.
Example 2 construction of a plasmid containing the mutant Gene CEY17_ RS13420G716AOf (4) an engineered strain
The construction method comprises the following steps: the allele substitution plasmid (pK18-CEY17_ RS13420) in example 1 was usedG716A) After the strain is transformed into Corynebacterium glutamicum (Corynebacterium glutamicum) CGMCC No.21260 by electric shock, the culture is carried out in a culture medium, the components of the culture medium and the culture conditions are shown in Table 1, and the single colony generated by the culture is respectively identified by the primer P1 and the universal primer M13R in the example 1, so that the strain which can amplify a 1331bp band is a positive strain. The positive strain was cultured on a medium containing 15% sucrose, the single colonies resulting from the culture were cultured on a medium containing kanamycin and a medium not containing kanamycin, respectively, and strains that grew on a medium not containing kanamycin and did not grow on a medium containing kanamycin were further subjected to PCR identification using the following primers (synthesized by Shanghai Invitrogen Co.):
P5:5'GGGTTTGCCT ACTTTCTTCC 3'，
P6:5'CAGCAACAAT GCCGCCGGTA 3'。
the resulting PCR amplification product (251bp) was subjected to SSCP (Single-Strand transformation Polymorphis) electrophoresis (plasmid pK18-CEY17_ RS13420) after denaturation at 95 ℃ for 10min and ice-cooling for 5minG716APositive control for amplified fragment, negative control for amplified fragment of Corynebacterium glutamicum ATCC14067, water as blank control), PAGE by SSCP electrophoresisThe preparation and electrophoresis conditions are shown in table 2, and because the fragment structures are different and the electrophoresis positions are different, the strains of which the electrophoresis positions are inconsistent with those of the negative control fragments and consistent with those of the positive control fragments are strains of which allelic replacement is successful. The positive strain CEY17_ RS13420 gene fragment was PCR-amplified again by primers P5/P6 and ligated to PMD19-T vector for sequencing, and the strain with mutation in base sequence (G-A) was a positive strain with successful allelic substitution by sequence alignment and was named YPV-055.
Recombinant bacterium YPV-055 contains mutant gene CEY17_ RS13420 shown in SEQ ID No.3G716A。
TABLE 1 composition of culture Medium and culture conditions
Figure BDA0003421352140000101
TABLE 2 preparation of SSCP electrophoretic PAGE and electrophoresis conditions
Figure BDA0003421352140000102
Example 3 construction of overexpression of the CEY17_ RS13420 Gene or CEY17_ RS13420 on the genomeG716AEngineered strains of genes
For further research, the wild-type CEY17_ RS13420 gene or the mutant gene CEY17_ RS13420 thereof is over-expressed in production bacteriaG716ACan increase the yield of L-valine, integrate exogenous genes into host chromosomes, and construct over-expression CEY17_ RS13420 gene or CEY17_ RS13420 gene on the genomeG716AEngineering strain of gene.
Based on the genome sequence of Corynebacterium glutamicum ATCC14067 published by NCBI, three pairs of amplified upstream and downstream homologous arm fragments and CEY17_ RS13420 or CEY17_ RS13420 were designed and synthesizedG716APrimers of gene coding region and promoter region are introduced into Corynebacterium glutamicum CGMCC No.21260 with homologous recombination method to obtain CEY17_ RS13420 or CEY17_ RS13420G716AA gene.
The primers were designed as follows (synthesized by Shanghai Invitrogen corporation):
P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GTAGTGCCGT GCGTACCCCA 3'，
P8:5'TGATCATCAG CATCTGCGGT CCCAACCCCA ATCGCAATGT 3'，
P9:5'ACATTGCGAT TGGGGTTGGG ACCGCAGATG CTGATGATCA 3'，
P10:5'GTGCGGGTTG GGGTTTTTGA TTACCTTTTA TTACCGAATC 3'，
P11:5'GATTCGGTAA TAAAAGGTAA TCAAAAACCC CAACCCGCAC 3'，
P12:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GTTGGTTTAG CGGAGCTGCA 3'。
the construction method of the recombinant strain (engineering strain) comprises the following steps: respectively taking Corynebacterium glutamicum ATCC14067 or YPV-055 as a template, respectively taking primers P7/P8, P9/P10 and P11/P12 to carry out PCR amplification to obtain an upstream homologous arm fragment 795bp (corresponding to a Corynebacterium glutamicum CGMCC No.21260CEY17_ RS02570 gene and a spacer region of CEY17_ RS02575, the sequence of which is shown as SEQ ID No. 6), a CEY17_ RS13420 gene and a promoter fragment 1657bp (the sequence of which is shown as SEQ ID No. 7) or CEY17_ RS13420G716AThe gene and its promoter fragment 1657bp (sequence is shown as SEQ ID No. 8) and downstream homology arm fragment 769bp (corresponding to Corynebacterium glutamicum CGMCC No.21260CEY17_ RS02575 gene and its spacer region with CEY17_ RS02570, sequence is shown as SEQ ID No. 9). After the PCR reaction is finished, 3 fragments obtained by amplifying each template are respectively subjected to electrophoresis recovery by adopting a column type DNA gel recovery kit. The 3 recovered fragments were ligated with pK18mobsacB plasmid (purchased from Addgene) purified by XbaI/BamH I digestion at 50 ℃ for 30min using NEBuilder enzyme (purchased from NEB), and the ligation product was transformed into DH5a (purchased from TAKARA) and the single clone grown from the transformed DH5a (purchased from TAKARA) was identified by PCR using M13 primer to obtain positive integration plasmids (recombinant vectors) pK18-CEY17_ RS13420OE and pK18-CEY17_ RS13420G716AOE, the positive integration plasmid contains a kanamycin resistance marker, and recombinants with plasmid integrated into the genome can be obtained by kanamycin selection.
The PCR reaction system is as follows: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 mM each) 4. mu.L, Mg2+4. mu.L (25mM), 2. mu.L each of primers (10pM), Ex Taq (5U)/. mu.L) 0.25. mu.L, and a total volume of 50. mu.L.
The PCR reaction program is: pre-denaturation at 94 ℃ for 5min and denaturation at 94 ℃ for 30 s; annealing at 52 ℃ for 30 s; extension at 72 ℃ for 60s (30 cycles) and over-extension at 72 ℃ for 10 min.
The correctly sequenced integrative plasmids (pK18-CEY17_ RS13420OE, pK18-CEY17_ RS13420G716AOE) are respectively electrically transformed into Corynebacterium glutamicum CGMCC No.21260, the Corynebacterium glutamicum CGMCC No.21260 is cultured in a culture medium, the components of the culture medium and the culture conditions are shown in Table 1, a single colony generated by the culture is identified by PCR through a P13/P14 primer, the strain which contains 1820bp fragments and is positive is amplified by PCR, and the strain which can not amplify the fragments is original bacteria. Culturing the positive strain on a culture medium containing 15% sucrose, and performing PCR identification on the single colony generated by culture by adopting a P15/P16 primer to amplify bacteria with the size of 1711bp, namely CEY17_ RS13420 or CEY17_ RS13420G716APositive strains in which genes were integrated into the spacer region of the homology arm CEY17_02570 and the lower homology arm CEY17_02575 of Corynebacterium glutamicum CGMCC No.21260 genome were designated YPV-056 (without mutation points) and YPV-057 (with mutation points), respectively.
The recombinant bacterium YPV-056 contains double copies of the CEY17_ RS13420 gene shown in SEQ ID No. 1; specifically, the recombinant bacterium YPV-056 is obtained by replacing the spacer of the upper homologous arm CEY17_02570 and the lower homologous arm CEY17_02575 in the genome of Corynebacterium glutamicum CGMCC No.21260 with a CEY17_ RS13420 gene and keeping the other nucleotides in the genome of Corynebacterium glutamicum CGMCC No.21260 unchanged. The recombinant bacterium containing the double-copy CEY17_ RS13420 gene can obviously and stably improve the expression level of the CEY17_ RS13420 gene. The recombinant bacterium YPV-056 is an engineering bacterium which overexpresses a wild-type CEY17_ RS13420 gene on a genome.
The recombinant bacterium YPV-057 contains mutant CEY17_ RS13420 shown as SEQ ID No.3G716AA gene; specifically, the recombinant bacterium YPV-057 is prepared by replacing the spacer of the upper homologous arm CEY17_02570 and the lower homologous arm CEY17_02575 in the genome of Corynebacterium glutamicum CGMCC No.21260 with CEY17_ RS13420G716AGene, recombinant bacterium obtained by keeping other nucleotide in the genome of Corynebacterium glutamicum CGMCC No.21260 unchanged. The recombinant bacterium YPV-057 is a recombinant bacterium which has been cultured on the genomeExpression of mutant CEY17_ RS13420G716AEngineering bacteria of genes.
The PCR identifying primers are shown below:
p13:5'CGGTTAGATT TTTTGGCCCC 3' (corresponding to the outside of the upper homology arm CEY17_ RS 02570),
p14:5'CATGACATGC AAGATTTCAG 3' (corresponding to the interior of the CEY17_ RS13420 gene),
p15:5'GATCATTGCC ACGACGTCAT 3' (corresponding to the interior of the CEY17_ RS13420 gene),
p16:5'TCTGGACTGG GTGTTGCGCT 3' (corresponding to the outside of the lower homology arm CEY17_ RS 02575).
Example 4 construction of plasmids overexpressing either the CEY17_ RS13420 Gene or CEY17_ RS13420G716AEngineered strains of genes
For further research, the wild-type CEY17_ RS13420 gene or the mutant gene CEY17_ RS13420 thereof is over-expressed in production bacteriaG716ACan increase the yield of L-valine, and the exogenous gene is extrachromosomally expressed by a plasmid to construct a plasmid over-expressed CEY17_ RS13420 gene or CEY17_ RS13420 geneG716AEngineering strain of gene.
Based on the genomic sequence of Corynebacterium glutamicum ATCC14067 published by NCBI, a pair of amplified CEY17_ RS13420 or CEY17_ RS13420 was designed and synthesizedG716APrimers for the gene coding region and promoter region were designed as follows (synthesized by Shanghai Invitrogen corporation):
P17:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCACCGCAGATG CTGATGATCA 3' (the underlined nucleotide sequence is that on pXMJ 19),
P18:5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTTACCTTTTA TTACCGAATC 3' (the underlined nucleotide sequence is that on pXMJ 19).
The construction method comprises the following steps: respectively taking Corynebacterium glutamicum ATCC14067 and YPV-055 as templates, and carrying out PCR amplification by using primers P17/P18 to obtain CEY17_ RS13420 gene and promoter fragment (the sequence is shown as SEQ ID No. 10) thereof and CEY17_ RS13420G716A1687bp (shown in SEQ ID No. 11) of gene and promoter fragment thereof, electrophoresing the amplified product, purifying and recovering the amplified product by using a column type DNA gel recovery kit, and recovering the purified productThe DNA fragment was ligated with shuttle plasmid pXMJ19 digested with EcoR I for 30min at 50 ℃ using NEBuilder enzyme (available from NEB Co.), and the single clone that grew after the ligation was transformed was identified by PCR using M13 primer to obtain positive overexpression plasmids pXMJ19-CEY17_ RS13420 (containing CEY17_ RS13420 gene) and pXMJ19-CEY17_ RS13420G716A(containing CEY17_ RS13420G716AGene), the plasmid was sent for sequencing. Since the plasmid contains a chloramphenicol resistance marker, whether the plasmid is transformed into a strain or not can be screened by chloramphenicol.
The PCR reaction system is as follows: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 mM each) 4. mu.L, Mg2+mu.L (25mM), 2. mu.L each of primers (10pM), 0.25. mu.L of Ex Taq (5U/. mu.L), and a total volume of 50. mu.L.
The PCR reaction program is: pre-denaturation at 94 ℃ for 5min and denaturation at 94 ℃ for 30 s; annealing at 52 ℃ for 30 s; extension at 72 ℃ for 60s (30 cycles) and over-extension at 72 ℃ for 10 min.
The correctly sequenced pXMJ19-CEY17_ RS13420 and pXMJ19-CEY17_ RS13420 will be usedG716AThe plasmids are respectively transformed into Corynebacterium glutamicum CGMCC No.21260, and cultured in a culture medium, the components of the culture medium and culture conditions are shown in Table 1, a single colony generated by culture is identified by PCR through a primer M13R (-48)/P18, and the positive strain containing a 1726bp fragment is amplified by PCR and is named as YPV-058 (without mutation points) and YPV-059 (with mutation points).
The recombinant bacterium YPV-058 contains a CEY17_ RS13420 gene shown in SEQ ID No. 1; the recombinant bacterium YPV-058 is an engineering bacterium which overexpresses the wild-type CEY17_ RS13420 gene on a plasmid, namely, the plasmid pXMJ19-CEY17_ RS13420 is overexpressed outside a chromosome.
The recombinant bacterium YPV-059 contains mutant CEY17_ RS13420 shown as SEQ ID No.3G716AA gene; the recombinant bacterium YPV-059 is prepared by overexpressing mutant CEY17_ RS13420 on a plasmidG716AGenetically engineered bacteria, namely plasmid pXMJ19-CEY17_ RS13420G716AThe overexpression is carried out extrachromosomally.
Example 5 construction of an engineered Strain with deletion of CEY17_ RS13420 Gene on genome
Two pairs of primers for amplifying fragments at both ends of the coding region of the CEY17_ RS13420 gene were synthesized as upstream and downstream homology arm fragments based on the genomic sequence of c.glutamicum ATCC14067 published by NCBI. The primers were designed as follows (synthesized by Shanghai Invitrogen corporation):
P19:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG ACAAAACCCG ATTCTGGGTA 3'，
P20:5'ACGCCTAAGC AGGTTGATTT CTGCTGGAAA ACATTTTGCA 3'，
P21:5'TGCAAAATGT TTTCCAGCAG AAATCAACCT GCTTAGGCGT 3'，
P22:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC CAGCAAAACA CCCGTATCTG 3'。
the construction method of the recombinant strain (engineering strain) comprises the following steps: PCR amplification was performed using Corynebacterium glutamicum ATCC14067 as a template and primers P19/P20 and P21/P22, respectively, to obtain 789bp of the upstream homology arm fragment of CEY17_ RS13420 and 695bp of the downstream homology arm fragment of CEY17_ RS 13420. Then, the primer P19/P22 is used for carrying out Overlap PCR to obtain a whole homologous arm fragment of 1444bp (the sequence is shown as SEQ ID No. 12). And (2) carrying out electrophoresis on the amplified product and purifying by adopting a column type DNA gel recovery kit, connecting the recovered DNA fragment with a pK18mobsacB plasmid (purchased from Addgene company) which is purified after Xbal I/BamH I enzyme digestion for 30min at 50 ℃ by using NEBuilder enzyme (purchased from NEB company), carrying out PCR identification on a single clone which grows after the conversion of a connecting product by using an M13 primer to obtain a positive knockout vector pK 18-delta CEY17_ RS13420, and sequencing the plasmid. This plasmid contains kanamycin resistance as a selection marker.
The Overlap PCR amplification reaction system is as follows: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 mM each) 4. mu.L, Mg2+mu.L (25mM), 2. mu.L each of primers (10pM), 0.25. mu.L of Ex Taq (5U/. mu.L), and a total volume of 50. mu.L.
The procedure of the Overlap PCR amplification reaction is as follows: pre-denaturation at 94 ℃ for 5min and denaturation at 94 ℃ for 30 s; annealing at 52 ℃ for 30 s; extension at 72 ℃ for 90s (30 cycles) and over-extension at 72 ℃ for 10 min.
The correctly sequenced knock-out plasmid pK18- Δ CEY17_ RS13420 was electrically transformed into Corynebacterium glutamicum CGMCC No.21260, cultured in a medium whose composition and culture conditions are shown in Table 1, and the single colonies generated by the culture were identified by PCR using the following primers (synthesized by Shanghai Invitrogen):
p23:5'ACAAAACCCG ATTCTGGGTA 3' (corresponding to the interior of the CGMCC No.21260CEY17_ RS13410 gene of Corynebacterium glutamicum),
p24:5'CAGCAAAACA CCCGTATCTG 3' (corresponding to the interior of the Corynebacterium glutamicum CGMCC No.21260CEY17_ RS13430 gene).
The bacterial strain which is simultaneously amplified by the PCR to obtain bands with the sizes of 1370bp and 2840bp is a positive bacterial strain, and the bacterial strain which is only amplified to obtain the band with the size of 2840bp is an original bacterial strain. The positive strains are screened on a 15% sucrose medium, then are respectively cultured on a kanamycin-containing medium and a kanamycin-free medium, strains which grow on the kanamycin-free medium and do not grow on the kanamycin-containing medium are selected, PCR identification is further carried out by adopting a P23/P24 primer, and the strain which is amplified to be 1370bp in band is a positive strain CEY17_ RS13420 with the coding region of the CEY17_ RS13420 gene knocked out. The positive strain CEY17_ RS13420 fragment was PCR-amplified again by P23/P24 primer and ligated to pMD19-T vector for sequencing, and the correctly sequenced strain was named YPV-060 (CEY17_ RS13420 gene on genome of Corynebacterium glutamicum CGMCC No.21260 was knocked out).
EXAMPLE 6L-valine fermentation experiment
The strains constructed in examples 2-5 above and the original strain Corynebacterium glutamicum CGMCC No.21260 were subjected to fermentation experiments in a BLBIO-5GC-4-H model fermenter (purchased from Bailan Biotech Co., Ltd., Shanghai) using the media shown in Table 3 and the control process shown in Table 4, and the fermentation processes of the respective strains were completely the same. Each strain was replicated three times, and the results are shown in Table 5.
As a result, as shown in Table 5, the coding region of CEY17_ RS13420 gene was point-mutated in Corynebacterium glutamicum CEY17_ RS13420G716AAnd/or overexpression of the CEY17_ RS13420 gene or mutant gene CEY17_ RS13420 thereof in a production strainG716AThe knockout or weakening of the CEY17_ RS13420 gene is not beneficial to the accumulation of L-valine.
TABLE 3 fermentation Medium formulation (balance water)
Composition (I) Formulation of
Ammonium sulfate 14g/L
Potassium dihydrogen phosphate 1g/L
Dipotassium hydrogen phosphate 1g/L
Magnesium sulfate 0.5g/L
Yeast powder 2g/L
Ferrous sulfate 18mg/L
Manganese sulfate 4.2mg/L
Biotin 0.02mg/L
Vitamin B1 2mg/L
Antifoam (CB-442) antifoaming agent) 0.5mL/L
70% glucose (base candy) 40g/L
TABLE 4 fermentation control Process
Figure BDA0003421352140000151
TABLE 5 results of L-valine fermentation experiments
Bacterial strains OD610 L-valine yield (g/L)
Corynebacterium glutamicum CGMCC No.21260 98.2 84.1
YPV-055 99.0 84.2
YPV-056 98.3 84.4
YPV-057 99.4 84.5
YPV-058 99.3 85.1
YPV-059 99.0 85.3
YPV-060 96.3 83.4
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
SEQUENCE LISTING
<110> Ningxia Yipin Biotechnology Ltd
<120> Process for producing L-valine and biomaterial therefor
<160> 12
<170> PatentIn version 3.5
<210> 1
<211> 1470
<212> DNA
<213> Corynebacterium glutamicum (Corynebacterium glutamicum)
<400> 1
atgttgagtt ttgcgaccct tcgtggccgc atttcaacag ttgacgctgc aaaagccgca 60
cctccgccat cgccactagc cccgattgat ctcactgacc atagtcaagt ggccggtgtg 120
atgaatttgg ctgcgagaat tggcgatatt ttgctttctt caggtacgtc aaatagtgac 180
accaaggtac aagttcgagc agtgacctct gcgtacggtt tgtactacac gcacgtggat 240
atcacgttga atacgatcac catcttcacc aacatcggtg tggagaggaa gacgccggtc 300
aacgtgtttc atgttgtggg caagttggac accaacttct ccaaactgtc tgaggttgac 360
cgtttgatcc gttccattca ggctggtgcg accccgcctg aggttgccga gaaaatcctg 420
gacgagttgg agcaatcccc tgcgtcttat ggtttccctg ttgcgttgct tggctgggca 480
atgatgggtg gcgctgttgc tgtgctgttg ggtggtggat ggcaggtttc cctaattgct 540
tttattaccg cgttcacgat cattgccacg acgtcatttt tgggaaagaa gggtttgcct 600
actttcttcc aaaatgttgt tggtggtttt attgccacgc tgcctgcatc gattgcttat 660
tctttggcgt tgcaatttgg tcttgagatc aaaccgagcc agatcatcgc atctggaatt 720
gttgtgctgt tggcaggttt gacacttgtg caatctctgc aggacggcat cacgggcgct 780
ccggtgacag caagtgcacg attttttgaa acactcctgt ttaccggcgg cattgttgct 840
ggcgtgggtt tgggcattca gctttctgaa atcttgcatg tcatgttgcc tgccatggag 900
tccgctgcag cacctaatta ttcgtctaca ttcgcccgca ttatcgctgg tggcgtcacc 960
gcagcggcct tcgcagtggg ttgttacgcg gagtggtcct cggtgattat tgcggggctt 1020
actgcgctga tgggttctgc gttttattac ctcttcgttg tttatttagg ccccgtctct 1080
gccgctgcga ttgctgcaac agcagttggt ttcactggtg gtttgcttgc ccgtcgattc 1140
ttgattccac cgttgattgt ggcgattgcc ggcatcacac caatgcttcc aggtctagca 1200
atttaccgcg gaatgtacgc caccctaaat gatcaaacac tcatgggttt caccaacatt 1260
gcggttgctt tagccactgc ttcatcactt gccgctggcg tggttttggg tgagtggatt 1320
gcccgcaggc tacgtcgtcc accacgcttc aacccatacc gtgcatttac caaggcgaat 1380
gagttctcct tccaggagga agctgagcag aatcagcgcc ggcagagaaa acgtccaaag 1440
actaatcaga gattcggtaa taaaaggtaa 1470
<210> 2
<211> 489
<212> PRT
<213> Corynebacterium glutamicum (Corynebacterium glutamicum)
<400> 2
Met Leu Ser Phe Ala Thr Leu Arg Gly Arg Ile Ser Thr Val Asp Ala
1 5 10 15
Ala Lys Ala Ala Pro Pro Pro Ser Pro Leu Ala Pro Ile Asp Leu Thr
20 25 30
Asp His Ser Gln Val Ala Gly Val Met Asn Leu Ala Ala Arg Ile Gly
35 40 45
Asp Ile Leu Leu Ser Ser Gly Thr Ser Asn Ser Asp Thr Lys Val Gln
50 55 60
Val Arg Ala Val Thr Ser Ala Tyr Gly Leu Tyr Tyr Thr His Val Asp
65 70 75 80
Ile Thr Leu Asn Thr Ile Thr Ile Phe Thr Asn Ile Gly Val Glu Arg
85 90 95
Lys Thr Pro Val Asn Val Phe His Val Val Gly Lys Leu Asp Thr Asn
100 105 110
Phe Ser Lys Leu Ser Glu Val Asp Arg Leu Ile Arg Ser Ile Gln Ala
115 120 125
Gly Ala Thr Pro Pro Glu Val Ala Glu Lys Ile Leu Asp Glu Leu Glu
130 135 140
Gln Ser Pro Ala Ser Tyr Gly Phe Pro Val Ala Leu Leu Gly Trp Ala
145 150 155 160
Met Met Gly Gly Ala Val Ala Val Leu Leu Gly Gly Gly Trp Gln Val
165 170 175
Ser Leu Ile Ala Phe Ile Thr Ala Phe Thr Ile Ile Ala Thr Thr Ser
180 185 190
Phe Leu Gly Lys Lys Gly Leu Pro Thr Phe Phe Gln Asn Val Val Gly
195 200 205
Gly Phe Ile Ala Thr Leu Pro Ala Ser Ile Ala Tyr Ser Leu Ala Leu
210 215 220
Gln Phe Gly Leu Glu Ile Lys Pro Ser Gln Ile Ile Ala Ser Gly Ile
225 230 235 240
Val Val Leu Leu Ala Gly Leu Thr Leu Val Gln Ser Leu Gln Asp Gly
245 250 255
Ile Thr Gly Ala Pro Val Thr Ala Ser Ala Arg Phe Phe Glu Thr Leu
260 265 270
Leu Phe Thr Gly Gly Ile Val Ala Gly Val Gly Leu Gly Ile Gln Leu
275 280 285
Ser Glu Ile Leu His Val Met Leu Pro Ala Met Glu Ser Ala Ala Ala
290 295 300
Pro Asn Tyr Ser Ser Thr Phe Ala Arg Ile Ile Ala Gly Gly Val Thr
305 310 315 320
Ala Ala Ala Phe Ala Val Gly Cys Tyr Ala Glu Trp Ser Ser Val Ile
325 330 335
Ile Ala Gly Leu Thr Ala Leu Met Gly Ser Ala Phe Tyr Tyr Leu Phe
340 345 350
Val Val Tyr Leu Gly Pro Val Ser Ala Ala Ala Ile Ala Ala Thr Ala
355 360 365
Val Gly Phe Thr Gly Gly Leu Leu Ala Arg Arg Phe Leu Ile Pro Pro
370 375 380
Leu Ile Val Ala Ile Ala Gly Ile Thr Pro Met Leu Pro Gly Leu Ala
385 390 395 400
Ile Tyr Arg Gly Met Tyr Ala Thr Leu Asn Asp Gln Thr Leu Met Gly
405 410 415
Phe Thr Asn Ile Ala Val Ala Leu Ala Thr Ala Ser Ser Leu Ala Ala
420 425 430
Gly Val Val Leu Gly Glu Trp Ile Ala Arg Arg Leu Arg Arg Pro Pro
435 440 445
Arg Phe Asn Pro Tyr Arg Ala Phe Thr Lys Ala Asn Glu Phe Ser Phe
450 455 460
Gln Glu Glu Ala Glu Gln Asn Gln Arg Arg Gln Arg Lys Arg Pro Lys
465 470 475 480
Thr Asn Gln Arg Phe Gly Asn Lys Arg
485
<210> 3
<211> 1470
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
atgttgagtt ttgcgaccct tcgtggccgc atttcaacag ttgacgctgc aaaagccgca 60
cctccgccat cgccactagc cccgattgat ctcactgacc atagtcaagt ggccggtgtg 120
atgaatttgg ctgcgagaat tggcgatatt ttgctttctt caggtacgtc aaatagtgac 180
accaaggtac aagttcgagc agtgacctct gcgtacggtt tgtactacac gcacgtggat 240
atcacgttga atacgatcac catcttcacc aacatcggtg tggagaggaa gacgccggtc 300
aacgtgtttc atgttgtggg caagttggac accaacttct ccaaactgtc tgaggttgac 360
cgtttgatcc gttccattca ggctggtgcg accccgcctg aggttgccga gaaaatcctg 420
gacgagttgg agcaatcccc tgcgtcttat ggtttccctg ttgcgttgct tggctgggca 480
atgatgggtg gcgctgttgc tgtgctgttg ggtggtggat ggcaggtttc cctaattgct 540
tttattaccg cgttcacgat cattgccacg acgtcatttt tgggaaagaa gggtttgcct 600
actttcttcc aaaatgttgt tggtggtttt attgccacgc tgcctgcatc gattgcttat 660
tctttggcgt tgcaatttgg tcttgagatc aaaccgagcc agatcatcgc atctgaaatt 720
gttgtgctgt tggcaggttt gacacttgtg caatctctgc aggacggcat cacgggcgct 780
ccggtgacag caagtgcacg attttttgaa acactcctgt ttaccggcgg cattgttgct 840
ggcgtgggtt tgggcattca gctttctgaa atcttgcatg tcatgttgcc tgccatggag 900
tccgctgcag cacctaatta ttcgtctaca ttcgcccgca ttatcgctgg tggcgtcacc 960
gcagcggcct tcgcagtggg ttgttacgcg gagtggtcct cggtgattat tgcggggctt 1020
actgcgctga tgggttctgc gttttattac ctcttcgttg tttatttagg ccccgtctct 1080
gccgctgcga ttgctgcaac agcagttggt ttcactggtg gtttgcttgc ccgtcgattc 1140
ttgattccac cgttgattgt ggcgattgcc ggcatcacac caatgcttcc aggtctagca 1200
atttaccgcg gaatgtacgc caccctaaat gatcaaacac tcatgggttt caccaacatt 1260
gcggttgctt tagccactgc ttcatcactt gccgctggcg tggttttggg tgagtggatt 1320
gcccgcaggc tacgtcgtcc accacgcttc aacccatacc gtgcatttac caaggcgaat 1380
gagttctcct tccaggagga agctgagcag aatcagcgcc ggcagagaaa acgtccaaag 1440
actaatcaga gattcggtaa taaaaggtaa 1470
<210> 4
<211> 489
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 4
Met Leu Ser Phe Ala Thr Leu Arg Gly Arg Ile Ser Thr Val Asp Ala
1 5 10 15
Ala Lys Ala Ala Pro Pro Pro Ser Pro Leu Ala Pro Ile Asp Leu Thr
20 25 30
Asp His Ser Gln Val Ala Gly Val Met Asn Leu Ala Ala Arg Ile Gly
35 40 45
Asp Ile Leu Leu Ser Ser Gly Thr Ser Asn Ser Asp Thr Lys Val Gln
50 55 60
Val Arg Ala Val Thr Ser Ala Tyr Gly Leu Tyr Tyr Thr His Val Asp
65 70 75 80
Ile Thr Leu Asn Thr Ile Thr Ile Phe Thr Asn Ile Gly Val Glu Arg
85 90 95
Lys Thr Pro Val Asn Val Phe His Val Val Gly Lys Leu Asp Thr Asn
100 105 110
Phe Ser Lys Leu Ser Glu Val Asp Arg Leu Ile Arg Ser Ile Gln Ala
115 120 125
Gly Ala Thr Pro Pro Glu Val Ala Glu Lys Ile Leu Asp Glu Leu Glu
130 135 140
Gln Ser Pro Ala Ser Tyr Gly Phe Pro Val Ala Leu Leu Gly Trp Ala
145 150 155 160
Met Met Gly Gly Ala Val Ala Val Leu Leu Gly Gly Gly Trp Gln Val
165 170 175
Ser Leu Ile Ala Phe Ile Thr Ala Phe Thr Ile Ile Ala Thr Thr Ser
180 185 190
Phe Leu Gly Lys Lys Gly Leu Pro Thr Phe Phe Gln Asn Val Val Gly
195 200 205
Gly Phe Ile Ala Thr Leu Pro Ala Ser Ile Ala Tyr Ser Leu Ala Leu
210 215 220
Gln Phe Gly Leu Glu Ile Lys Pro Ser Gln Ile Ile Ala Ser Glu Ile
225 230 235 240
Val Val Leu Leu Ala Gly Leu Thr Leu Val Gln Ser Leu Gln Asp Gly
245 250 255
Ile Thr Gly Ala Pro Val Thr Ala Ser Ala Arg Phe Phe Glu Thr Leu
260 265 270
Leu Phe Thr Gly Gly Ile Val Ala Gly Val Gly Leu Gly Ile Gln Leu
275 280 285
Ser Glu Ile Leu His Val Met Leu Pro Ala Met Glu Ser Ala Ala Ala
290 295 300
Pro Asn Tyr Ser Ser Thr Phe Ala Arg Ile Ile Ala Gly Gly Val Thr
305 310 315 320
Ala Ala Ala Phe Ala Val Gly Cys Tyr Ala Glu Trp Ser Ser Val Ile
325 330 335
Ile Ala Gly Leu Thr Ala Leu Met Gly Ser Ala Phe Tyr Tyr Leu Phe
340 345 350
Val Val Tyr Leu Gly Pro Val Ser Ala Ala Ala Ile Ala Ala Thr Ala
355 360 365
Val Gly Phe Thr Gly Gly Leu Leu Ala Arg Arg Phe Leu Ile Pro Pro
370 375 380
Leu Ile Val Ala Ile Ala Gly Ile Thr Pro Met Leu Pro Gly Leu Ala
385 390 395 400
Ile Tyr Arg Gly Met Tyr Ala Thr Leu Asn Asp Gln Thr Leu Met Gly
405 410 415
Phe Thr Asn Ile Ala Val Ala Leu Ala Thr Ala Ser Ser Leu Ala Ala
420 425 430
Gly Val Val Leu Gly Glu Trp Ile Ala Arg Arg Leu Arg Arg Pro Pro
435 440 445
Arg Phe Asn Pro Tyr Arg Ala Phe Thr Lys Ala Asn Glu Phe Ser Phe
450 455 460
Gln Glu Glu Ala Glu Gln Asn Gln Arg Arg Gln Arg Lys Arg Pro Lys
465 470 475 480
Thr Asn Gln Arg Phe Gly Asn Lys Arg
485
<210> 5
<211> 1324
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
cagtgccaag cttgcatgcc tgcaggtcga ctctagagtg gccggtgtga tgaatttggc 60
tgcgagaatt ggcgatattt tgctttcttc aggtacgtca aatagtgaca ccaaggtaca 120
agttcgagca gtgacctctg cgtacggttt gtactacacg cacgtggata tcacgttgaa 180
tacgatcacc atcttcacca acatcggtgt ggagaggaag acgccggtca acgtgtttca 240
tgttgtgggc aagttggaca ccaacttctc caaactgtct gaggttgacc gtttgatccg 300
ttccattcag gctggtgcga ccccgcctga ggttgccgag aaaatcctgg acgagttgga 360
gcaatcccct gcgtcttatg gtttccctgt tgcgttgctt ggctgggcaa tgatgggtgg 420
cgctgttgct gtgctgttgg gtggtggatg gcaggtttcc ctaattgctt ttattaccgc 480
gttcacgatc attgccacga cgtcattttt gggaaagaag ggtttgccta ctttcttcca 540
aaatgttgtt ggtggtttta ttgccacgct gcctgcatcg attgcttatt ctttggcgtt 600
gcaatttggt cttgagatca aaccgagcca gatcatcgca tctgaaattg ttgtgctgtt 660
ggcaggtttg acacttgtgc aatctctgca ggacggcatc acgggcgctc cggtgacagc 720
aagtgcacga ttttttgaaa cactcctgtt taccggcggc attgttgctg gcgtgggttt 780
gggcattcag ctttctgaaa tcttgcatgt catgttgcct gccatggagt ccgctgcagc 840
acctaattat tcgtctacat tcgcccgcat tatcgctggt ggcgtcaccg cagcggcctt 900
cgcagtgggt tgttacgcgg agtggtcctc ggtgattatt gcggggctta ctgcgctgat 960
gggttctgcg ttttattacc tcttcgttgt ttatttaggc cccgtctctg ccgctgcgat 1020
tgctgcaaca gcagttggtt tcactggtgg tttgcttgcc cgtcgattct tgattccacc 1080
gttgattgtg gcgattgccg gcatcacacc aatgcttcca ggtctagcaa tttaccgcgg 1140
aatgtacgcc accctaaatg atcaaacact catgggtttc accaacattg cggttgcttt 1200
agccactgct tcatcacttg ccgctggcgt ggttttgggt gagtggattg cccgcaggct 1260
acgtcgtcca ccacgcttca acccatgggt accgagctcg aattcgtaat catggtcata 1320
gctg 1324
<210> 6
<211> 795
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
cagtgccaag cttgcatgcc tgcaggtcga ctctaggtag tgccgtgcgt accccattag 60
aaagtgaaaa ttcactgatt ctagccagtc acgctgggaa tcattacatg ggccttcttc 120
gatcattcca tgatcgacaa gaaaagcctc acgttcatca ggttgtaaat aggggacagt 180
agacattaat tacacctaaa aagaaaaggg cccccatgag gcgcatcgtt gagaggcgtt 240
gggggtgctg ttggcttcta cgatatatct aattttgcct gatgtgtcag tagctcgaac 300
gtcactttca cttgtcgtct gaagtttcga tgtttctgca ccataaacgg tgtttatgaa 360
ttatcccccc ctctaccccc cgggggtgag gttttcgctg agaaggctgg cttcaaacgg 420
gggctggaca cgtacgcgga gatggcgacg cgttctgtca cgaatcgtgc gttgcgtgct 480
ggccattccg ccacccaagc cagatccagg tcatgagggc taccaggcca cacagaagca 540
gcgctaccta gaacgccaga tcagggcgtc gaaacggatg gaagctgcag ccatcgaccc 600
tagagacatt gacaccgcaa aacagcgcat acgggcatac caggcaaaac tacgcgacca 660
catcaaacag cacgacctgc caaggcgcag acaccgagaa cagattaaaa tgcgctaaag 720
aagttaacat catgctgcca ccgcccaagc gggaaacatt gcgattgggg ttgggaccgc 780
agatgctgat gatca 795
<210> 7
<211> 1657
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
acattgcgat tggggttggg accgcagatg ctgatgatca acaactacga atacgtatct 60
tagcgtatgt gtacatcaca atggaattcg gggctagagt atctggtgaa ccgtgcataa 120
acgacctgtg attggactct ttttccttgc aaaatgtttt ccagcagatg ttgagttttg 180
cgacccttcg tggccgcatt tcaacagttg acgctgcaaa agccgcacct ccgccatcgc 240
cactagcccc gattgatctc actgaccata gtcaagtggc cggtgtgatg aatttggctg 300
cgagaattgg cgatattttg ctttcttcag gtacgtcaaa tagtgacacc aaggtacaag 360
ttcgagcagt gacctctgcg tacggtttgt actacacgca cgtggatatc acgttgaata 420
cgatcaccat cttcaccaac atcggtgtgg agaggaagac gccggtcaac gtgtttcatg 480
ttgtgggcaa gttggacacc aacttctcca aactgtctga ggttgaccgt ttgatccgtt 540
ccattcaggc tggtgcgacc ccgcctgagg ttgccgagaa aatcctggac gagttggagc 600
aatcccctgc gtcttatggt ttccctgttg cgttgcttgg ctgggcaatg atgggtggcg 660
ctgttgctgt gctgttgggt ggtggatggc aggtttccct aattgctttt attaccgcgt 720
tcacgatcat tgccacgacg tcatttttgg gaaagaaggg tttgcctact ttcttccaaa 780
atgttgttgg tggttttatt gccacgctgc ctgcatcgat tgcttattct ttggcgttgc 840
aatttggtct tgagatcaaa ccgagccaga tcatcgcatc tggaattgtt gtgctgttgg 900
caggtttgac acttgtgcaa tctctgcagg acggcatcac gggcgctccg gtgacagcaa 960
gtgcacgatt ttttgaaaca ctcctgttta ccggcggcat tgttgctggc gtgggtttgg 1020
gcattcagct ttctgaaatc ttgcatgtca tgttgcctgc catggagtcc gctgcagcac 1080
ctaattattc gtctacattc gcccgcatta tcgctggtgg cgtcaccgca gcggccttcg 1140
cagtgggttg ttacgcggag tggtcctcgg tgattattgc ggggcttact gcgctgatgg 1200
gttctgcgtt ttattacctc ttcgttgttt atttaggccc cgtctctgcc gctgcgattg 1260
ctgcaacagc agttggtttc actggtggtt tgcttgcccg tcgattcttg attccaccgt 1320
tgattgtggc gattgccggc atcacaccaa tgcttccagg tctagcaatt taccgcggaa 1380
tgtacgccac cctaaatgat caaacactca tgggtttcac caacattgcg gttgctttag 1440
ccactgcttc atcacttgcc gctggcgtgg ttttgggtga gtggattgcc cgcaggctac 1500
gtcgtccacc acgcttcaac ccataccgtg catttaccaa ggcgaatgag ttctccttcc 1560
aggaggaagc tgagcagaat cagcgccggc agagaaaacg tccaaagact aatcagagat 1620
tcggtaataa aaggtaatca aaaaccccaa cccgcac 1657
<210> 8
<211> 1657
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
acattgcgat tggggttggg accgcagatg ctgatgatca acaactacga atacgtatct 60
tagcgtatgt gtacatcaca atggaattcg gggctagagt atctggtgaa ccgtgcataa 120
acgacctgtg attggactct ttttccttgc aaaatgtttt ccagcagatg ttgagttttg 180
cgacccttcg tggccgcatt tcaacagttg acgctgcaaa agccgcacct ccgccatcgc 240
cactagcccc gattgatctc actgaccata gtcaagtggc cggtgtgatg aatttggctg 300
cgagaattgg cgatattttg ctttcttcag gtacgtcaaa tagtgacacc aaggtacaag 360
ttcgagcagt gacctctgcg tacggtttgt actacacgca cgtggatatc acgttgaata 420
cgatcaccat cttcaccaac atcggtgtgg agaggaagac gccggtcaac gtgtttcatg 480
ttgtgggcaa gttggacacc aacttctcca aactgtctga ggttgaccgt ttgatccgtt 540
ccattcaggc tggtgcgacc ccgcctgagg ttgccgagaa aatcctggac gagttggagc 600
aatcccctgc gtcttatggt ttccctgttg cgttgcttgg ctgggcaatg atgggtggcg 660
ctgttgctgt gctgttgggt ggtggatggc aggtttccct aattgctttt attaccgcgt 720
tcacgatcat tgccacgacg tcatttttgg gaaagaaggg tttgcctact ttcttccaaa 780
atgttgttgg tggttttatt gccacgctgc ctgcatcgat tgcttattct ttggcgttgc 840
aatttggtct tgagatcaaa ccgagccaga tcatcgcatc tgaaattgtt gtgctgttgg 900
caggtttgac acttgtgcaa tctctgcagg acggcatcac gggcgctccg gtgacagcaa 960
gtgcacgatt ttttgaaaca ctcctgttta ccggcggcat tgttgctggc gtgggtttgg 1020
gcattcagct ttctgaaatc ttgcatgtca tgttgcctgc catggagtcc gctgcagcac 1080
ctaattattc gtctacattc gcccgcatta tcgctggtgg cgtcaccgca gcggccttcg 1140
cagtgggttg ttacgcggag tggtcctcgg tgattattgc ggggcttact gcgctgatgg 1200
gttctgcgtt ttattacctc ttcgttgttt atttaggccc cgtctctgcc gctgcgattg 1260
ctgcaacagc agttggtttc actggtggtt tgcttgcccg tcgattcttg attccaccgt 1320
tgattgtggc gattgccggc atcacaccaa tgcttccagg tctagcaatt taccgcggaa 1380
tgtacgccac cctaaatgat caaacactca tgggtttcac caacattgcg gttgctttag 1440
ccactgcttc atcacttgcc gctggcgtgg ttttgggtga gtggattgcc cgcaggctac 1500
gtcgtccacc acgcttcaac ccataccgtg catttaccaa ggcgaatgag ttctccttcc 1560
aggaggaagc tgagcagaat cagcgccggc agagaaaacg tccaaagact aatcagagat 1620
tcggtaataa aaggtaatca aaaaccccaa cccgcac 1657
<210> 9
<211> 769
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
gattcggtaa taaaaggtaa tcaaaaaccc caacccgcac atttttagat ttctattttg 60
tgtacatagg gttcggaaca aagcttaaac catccccaat tgaaatgtcg ttacacaccc 120
acatgtttga agtggagcaa accgaaaacc agttttcccc aacggcagcc gccccccacg 180
ttgaaccttc gaaatagtag gcaacaccat caagcggatc ttcatcaagc gaaatagtga 240
ttgactcttc accgttccgc ttacaaactg cgttagtgtc gctattttcc acccacttgt 300
cacactcgta cccgttttca tttagccatt tttcggcatg tcctattttc tcgaaccggg 360
caggagcgtc agggcttccg cagcccgcta gtagtagtcc ggctgcaatg atgcttaatg 420
tttttttcat gaattaaaca tagtactttg ctggtaaaaa tattggagaa ccccactggc 480
ctacatggtc agtgggggca tttttgcgtt tcacccctca aaaatcatca ccacacttgc 540
gggatttccc cctgatttcc cccactccca caccattccc agtggacagt gtggacgtat 600
tggacacatt aaacacattg cgaccaggta aaacgtcatg accaggtatc gtcaatgttc 660
ttgatgaatt tccgcaccgc aggattatca ttcgaggtgg aataaatagc ctgcagctcc 720
gctaaaccaa cgggtaccga gctcgaattc gtaatcatgg tcatagctg 769
<210> 10
<211> 1687
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
gcttgcatgc ctgcaggtcg actctagagg atccccaccg cagatgctga tgatcaacaa 60
ctacgaatac gtatcttagc gtatgtgtac atcacaatgg aattcggggc tagagtatct 120
ggtgaaccgt gcataaacga cctgtgattg gactcttttt ccttgcaaaa tgttttccag 180
cagatgttga gttttgcgac ccttcgtggc cgcatttcaa cagttgacgc tgcaaaagcc 240
gcacctccgc catcgccact agccccgatt gatctcactg accatagtca agtggccggt 300
gtgatgaatt tggctgcgag aattggcgat attttgcttt cttcaggtac gtcaaatagt 360
gacaccaagg tacaagttcg agcagtgacc tctgcgtacg gtttgtacta cacgcacgtg 420
gatatcacgt tgaatacgat caccatcttc accaacatcg gtgtggagag gaagacgccg 480
gtcaacgtgt ttcatgttgt gggcaagttg gacaccaact tctccaaact gtctgaggtt 540
gaccgtttga tccgttccat tcaggctggt gcgaccccgc ctgaggttgc cgagaaaatc 600
ctggacgagt tggagcaatc ccctgcgtct tatggtttcc ctgttgcgtt gcttggctgg 660
gcaatgatgg gtggcgctgt tgctgtgctg ttgggtggtg gatggcaggt ttccctaatt 720
gcttttatta ccgcgttcac gatcattgcc acgacgtcat ttttgggaaa gaagggtttg 780
cctactttct tccaaaatgt tgttggtggt tttattgcca cgctgcctgc atcgattgct 840
tattctttgg cgttgcaatt tggtcttgag atcaaaccga gccagatcat cgcatctgga 900
attgttgtgc tgttggcagg tttgacactt gtgcaatctc tgcaggacgg catcacgggc 960
gctccggtga cagcaagtgc acgatttttt gaaacactcc tgtttaccgg cggcattgtt 1020
gctggcgtgg gtttgggcat tcagctttct gaaatcttgc atgtcatgtt gcctgccatg 1080
gagtccgctg cagcacctaa ttattcgtct acattcgccc gcattatcgc tggtggcgtc 1140
accgcagcgg ccttcgcagt gggttgttac gcggagtggt cctcggtgat tattgcgggg 1200
cttactgcgc tgatgggttc tgcgttttat tacctcttcg ttgtttattt aggccccgtc 1260
tctgccgctg cgattgctgc aacagcagtt ggtttcactg gtggtttgct tgcccgtcga 1320
ttcttgattc caccgttgat tgtggcgatt gccggcatca caccaatgct tccaggtcta 1380
gcaatttacc gcggaatgta cgccacccta aatgatcaaa cactcatggg tttcaccaac 1440
attgcggttg ctttagccac tgcttcatca cttgccgctg gcgtggtttt gggtgagtgg 1500
attgcccgca ggctacgtcg tccaccacgc ttcaacccat accgtgcatt taccaaggcg 1560
aatgagttct ccttccagga ggaagctgag cagaatcagc gccggcagag aaaacgtcca 1620
aagactaatc agagattcgg taataaaagg taagttttgg cggatgagag aagattttca 1680
gcctgat 1687
<210> 11
<211> 1687
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 11
gcttgcatgc ctgcaggtcg actctagagg atccccaccg cagatgctga tgatcaacaa 60
ctacgaatac gtatcttagc gtatgtgtac atcacaatgg aattcggggc tagagtatct 120
ggtgaaccgt gcataaacga cctgtgattg gactcttttt ccttgcaaaa tgttttccag 180
cagatgttga gttttgcgac ccttcgtggc cgcatttcaa cagttgacgc tgcaaaagcc 240
gcacctccgc catcgccact agccccgatt gatctcactg accatagtca agtggccggt 300
gtgatgaatt tggctgcgag aattggcgat attttgcttt cttcaggtac gtcaaatagt 360
gacaccaagg tacaagttcg agcagtgacc tctgcgtacg gtttgtacta cacgcacgtg 420
gatatcacgt tgaatacgat caccatcttc accaacatcg gtgtggagag gaagacgccg 480
gtcaacgtgt ttcatgttgt gggcaagttg gacaccaact tctccaaact gtctgaggtt 540
gaccgtttga tccgttccat tcaggctggt gcgaccccgc ctgaggttgc cgagaaaatc 600
ctggacgagt tggagcaatc ccctgcgtct tatggtttcc ctgttgcgtt gcttggctgg 660
gcaatgatgg gtggcgctgt tgctgtgctg ttgggtggtg gatggcaggt ttccctaatt 720
gcttttatta ccgcgttcac gatcattgcc acgacgtcat ttttgggaaa gaagggtttg 780
cctactttct tccaaaatgt tgttggtggt tttattgcca cgctgcctgc atcgattgct 840
tattctttgg cgttgcaatt tggtcttgag atcaaaccga gccagatcat cgcatctgaa 900
attgttgtgc tgttggcagg tttgacactt gtgcaatctc tgcaggacgg catcacgggc 960
gctccggtga cagcaagtgc acgatttttt gaaacactcc tgtttaccgg cggcattgtt 1020
gctggcgtgg gtttgggcat tcagctttct gaaatcttgc atgtcatgtt gcctgccatg 1080
gagtccgctg cagcacctaa ttattcgtct acattcgccc gcattatcgc tggtggcgtc 1140
accgcagcgg ccttcgcagt gggttgttac gcggagtggt cctcggtgat tattgcgggg 1200
cttactgcgc tgatgggttc tgcgttttat tacctcttcg ttgtttattt aggccccgtc 1260
tctgccgctg cgattgctgc aacagcagtt ggtttcactg gtggtttgct tgcccgtcga 1320
ttcttgattc caccgttgat tgtggcgatt gccggcatca caccaatgct tccaggtcta 1380
gcaatttacc gcggaatgta cgccacccta aatgatcaaa cactcatggg tttcaccaac 1440
attgcggttg ctttagccac tgcttcatca cttgccgctg gcgtggtttt gggtgagtgg 1500
attgcccgca ggctacgtcg tccaccacgc ttcaacccat accgtgcatt taccaaggcg 1560
aatgagttct ccttccagga ggaagctgag cagaatcagc gccggcagag aaaacgtcca 1620
aagactaatc agagattcgg taataaaagg taagttttgg cggatgagag aagattttca 1680
gcctgat 1687
<210> 12
<211> 1444
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
cagtgccaag cttgcatgcc tgcaggtcga ctctagacaa aacccgattc tgggtaatcg 60
acctcgaaaa aggaatatcc cggagaaccg gtgaaccatt caccgtcgat ccaatgatgt 120
gcatgaagct tgcagaggct ctcgaccttg atccagtaga ggttttaagc gcagcgaaag 180
ttcccgaatc tgaatggcca aatttttcga agatcatctc ccaaagtgac tatgtgaagc 240
atgtggacat aacaagactg accgtccgcc agcaagatct agtcatcaat ctggtcaacg 300
aatttaagga gcttaatttg aacacgccat atgaaaagta actaatttcg acccaaacgg 360
gagcctaagt gaaatgaaat aatctcctca ccaactggcg acattcaaac accgtttcat 420
ttccaaacat cgagccaagg aaaaagaaag cccctaagcc ccgtgttatt aaatggagac 480
tttttggaga cctcaagcca aaaaggggca ttttcattaa gaaaataccc ctttgacctg 540
gtgttattga gctggagaag agacttgaac tctcaaccta cgcattacaa gtgcgttgcg 600
ctgccaattg cgccactcca gcaccgcaga tgctgatgat caacaactac gaatacgtat 660
cttagcgtat gtgtacatca caatggaatt cggggctaga gtatctggtg aaccgtgcat 720
aaacgacctg tgattggact ctttttcctt gcaaaatgtt ttccagcaga aatcaacctg 780
cttaggcgtc tttcgcttaa atagcgtaga atatcgggtc gatcgctttt aaacactcag 840
gaggatcctt gccggccaaa atcacggaca ctcgtcccac cccagaatcc cttcacgctg 900
ttgaagagga aaccgcagcc ggtgcccgca ggattgttgc aacctattct aaggacttct 960
tcgacggcgt cactttgatg tgcatgctcg gcgttgaacc tcagggcctg cgttacacca 1020
aggtcgcttc tgaacacgag gaagctcagc caaagaaggc tacaaagcgg actcgtaagg 1080
caccagctaa gaaggctgct gctaagaaaa cgaccaagaa gaccactaag aaaactacta 1140
aaaagaccac cgcaaagaag accacaaaga agtcttaagc cggatcttat atggatgatt 1200
ccaatagctt tgtagttgtt gctaaccgtc tgccagtgga tatgactgtc cacccagatg 1260
gtagctatag catctccccc agccccggtg gccttgtcac ggggctttcc cccgttctgg 1320
aacaacatcg tggatgttgg gtcggatggc ctggaactgt agatgttgca cccgaaccat 1380
ttcgaacaga tacgggtgtt ttgctggggt accgagctcg aattcgtaat catggtcata 1440
gctg 1444

Claims (10)

1. A process for producing L-valine, which comprises producing L-valine using a recombinant microorganism which expresses a protein;
the protein is any one of the following proteins:
A1) a protein having an amino acid sequence of SEQ ID No. 4;
A2) a protein which is obtained by substituting and/or deleting and/or adding amino acid residues to the amino acid sequence shown in SEQ ID No.4, has more than 80% of identity with the protein shown in A1), and has the same function;
A3) a fusion protein with the same function obtained by connecting labels at the N end and/or the C end of A1) or A2).
2. The protein of claim 1.
3. A nucleic acid molecule, wherein said nucleic acid molecule is any one of:
B1) a nucleic acid molecule encoding the protein of claim 1 or 2;
B2) the coding sequence is a DNA molecule shown in SEQ ID No. 3;
B3) the nucleotide sequence is a DNA molecule shown in SEQ ID No. 3.
4. A biomaterial, characterized in that the biomaterial is any one of the following:
C1) an expression cassette comprising the nucleic acid molecule of claim 3;
C2) a recombinant vector comprising the nucleic acid molecule of claim 3, or a recombinant vector comprising the expression cassette of C1);
C3) a recombinant microorganism comprising the nucleic acid molecule of claim 3, or a recombinant microorganism comprising C1) the expression cassette, or a recombinant microorganism comprising C2) the recombinant vector.
5, D1) -D8) of any one of the following:
F1) d1) -D8) in regulating the production of L-valine by a microorganism;
F2) d1) -D8) in constructing a genetic engineering bacterium for producing L-valine;
F3) the use of any one of D1) -D8) in the preparation of L-valine;
wherein, the D1) -D8) are:
D1) a protein as claimed in claim 1 or 2;
D2) the nucleic acid molecule of claim 3;
D3) the biomaterial of claim 4;
D4) a DNA molecule with a nucleotide sequence of SEQ ID No. 1;
D5) a DNA molecule which is obtained by modifying and/or substituting and/or deleting and/or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1, has more than 90 percent of identity with the DNA molecule shown in SEQ ID No.1 and has the same function;
D6) an expression cassette comprising the DNA molecule of D4) or D5);
D7) a recombinant vector containing the DNA molecule described in D4) or D5), or a recombinant vector containing the expression cassette described in D6);
D8) a recombinant microorganism containing the DNA molecule described in D4) or D5), or a recombinant microorganism containing the expression cassette described in D6), or a recombinant microorganism containing the recombinant vector described in D7).
6. A method for increasing the production of L-valine in a microorganism, comprising any one of:
E1) increasing the expression level or the content of the nucleic acid molecule of claim 3 in a target microorganism to obtain a microorganism having a higher L-valine productivity than the target microorganism;
E2) increasing the expression level or the content of the DNA molecule of claim 5D 4) or D5) in a target microorganism to obtain a microorganism having a higher L-valine yield than the target microorganism;
E3) and (2) mutating the DNA molecule with the nucleotide sequence of SEQ ID No.1 in the target microorganism to obtain the microorganism with the L-valine yield higher than that of the target microorganism.
7. The method of claim 6, wherein the mutation is a point mutation.
8. The method of claim 7, wherein the point mutation is a mutation of a glycine residue at position 239 of the amino acid sequence encoded by the DNA molecule of SEQ ID No.1 to another residue.
9. The method as claimed in claim 7 or 8, characterized in that the point mutation is a mutation of the glycine at position 239 of the amino acid sequence encoded by the DNA molecule shown in SEQ ID No.1 to glutamic acid, resulting in a mutein with the amino acid sequence SEQ ID No. 4.
10. A method for constructing the recombinant microorganism according to claim 4 or 5, wherein the method comprises at least any one of:
F1) introducing the nucleic acid molecule of claim 3 into a microorganism of interest to obtain said recombinant microorganism;
F2) introducing a DNA molecule shown in SEQ ID No.1 into a target microorganism to obtain the recombinant microorganism;
F3) the DNA molecule shown in SEQ ID No.1 is edited by a gene editing means, so that the target microorganism contains the DNA molecule shown in SEQ ID No. 3.
CN202111563021.0A 2021-12-20 2021-12-20 Method for preparing L-valine and biological material used by same Active CN114277069B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111563021.0A CN114277069B (en) 2021-12-20 2021-12-20 Method for preparing L-valine and biological material used by same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111563021.0A CN114277069B (en) 2021-12-20 2021-12-20 Method for preparing L-valine and biological material used by same

Publications (2)

Publication Number Publication Date
CN114277069A true CN114277069A (en) 2022-04-05
CN114277069B CN114277069B (en) 2024-02-06

Family

ID=80873209

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111563021.0A Active CN114277069B (en) 2021-12-20 2021-12-20 Method for preparing L-valine and biological material used by same

Country Status (1)

Country Link
CN (1) CN114277069B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1291651A (en) * 1999-09-01 2001-04-18 德古萨－于尔斯股份公司 New nucleotide sequence of encode thrE gene and method of producing L-threonine using corynebacterium enzyme
CN1430672A (en) * 2000-05-27 2003-07-16 德古萨股份公司 Process for fermentative preparation of L-threonine

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1291651A (en) * 1999-09-01 2001-04-18 德古萨－于尔斯股份公司 New nucleotide sequence of encode thrE gene and method of producing L-threonine using corynebacterium enzyme
US6410705B1 (en) * 1999-09-01 2002-06-25 Degussa Huls Aktiengesellschaft Nucleotide sequences coding for the thrE gene and process for the enzymatic production of L-threonine using coryneform bacteria
CN1430672A (en) * 2000-05-27 2003-07-16 德古萨股份公司 Process for fermentative preparation of L-threonine

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SIMIC 等: "L-threonine export: use of peptides to identify a new translocator from Corynebacterium glutamicum.", JOURNAL OF BACTERIOLOGY, vol. 183, no. 18, pages 5317 - 5324, XP003005780, DOI: 10.1128/JB.183.18.5317-5324.2001 *
YEN 等: "The ubiquitous ThrE family of putative transmembrane amino acid efflux transporters.", RESEARCH IN MICROBIOLOGY, vol. 153, no. 1, pages 24 *

Also Published As

Publication number Publication date
CN114277069B (en) 2024-02-06

Similar Documents

Publication Publication Date Title
CN113667682B (en) YH66-RS11190 gene mutant and application thereof in preparation of L-valine
WO2022143763A1 (en) Strain having enhanced l-glutamic acid productivity, construction method therefor and application thereof
CN110846333B (en) Recombinant strain modified by deoB gene and construction method and application thereof
CN111471693B (en) Corynebacterium glutamicum for producing lysine and construction method and application thereof
CN110592109B (en) Recombinant strain modified by spoT gene and construction method and application thereof
CN114181288B (en) Process for producing L-valine, gene used therefor and protein encoded by the gene
CN111961635A (en) Recombinant strain for producing L-lysine and construction method and application thereof
CN114349831B (en) aspA gene mutant, recombinant bacterium and method for preparing L-valine
CN114540399B (en) Method for preparing L-valine, and gene mutant and biological material used by same
CN110592084A (en) Recombinant strain modified by rhtA gene promoter and construction method and application thereof
CN114409751A (en) YH 66-04470 gene mutation recombinant bacterium and application thereof in preparation of arginine
CN112592924B (en) YH66_10325 gene-modified recombinant strain producing L-isoleucine as well as construction method and application thereof
WO2022143646A1 (en) Recombinant strain for producing l-glutamic acid by modifying gene bbd29_09525, and construction method therefor and application thereof
CN110564742B (en) Recombinant strain modified by yebN gene and construction method and application thereof
CN110804617B (en) KdtA gene modified recombinant strain and construction method and application thereof
CN114277069B (en) Method for preparing L-valine and biological material used by same
CN112725253A (en) Recombinant strain for modifying gene BBD 29-14900 and construction method and application thereof
CN114317583B (en) Method for constructing recombinant microorganism producing L-valine and nucleic acid molecule used in method
CN114315998B (en) CEY17_RS00300 gene mutant and application thereof in preparation of L-valine
CN114507273B (en) YH66_07020 protein and application of related biological material thereof in improving arginine yield
CN114539367B (en) CEY17_RS11900 gene mutant and application thereof in preparation of L-valine
CN114410615B (en) YH66_00525 protein and application of encoding gene thereof in regulating and controlling bacterial arginine yield
CN114249803B (en) Engineering bacterium for high-yield arginine and construction method and application thereof
CN114560918B (en) Application of YH 66-14275 protein or mutant thereof in preparation of L-arginine
CN114540262B (en) Method for constructing recombinant microorganism producing L-valine and nucleic acid molecule and biological material used in same

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20240513

Address after: 518107, 1st and 2nd floors, Building A3, No. 1168 Huanli Road, Zhenmei Community, Xinhu Street, Guangming District, Shenzhen, Guangdong Province

Patentee after: Guangxin Biological Intelligent Manufacturing Technology Innovation (Shenzhen) Co.,Ltd.

Country or region after: China

Address before: 750100 Yanghe Industrial Park, Yongning County, Yinchuan City, Ningxia Hui Autonomous Region

Patentee before: NINGXIA EPPEN BIOTECH Co.,Ltd.

Country or region before: China

TR01 Transfer of patent right