CN114262714B - Enriched protein, construction method and application thereof, and method for rapidly detecting antibody based on enriched protein - Google Patents

Abstract

The invention discloses an enriched protein, a construction method and application thereof, and a method for rapidly detecting an antibody based on the enriched protein, and belongs to the technical field of biology. According to the invention, the enriched protein B-DC3 is firstly expressed and purified through a prokaryotic system, and then is applied to the detection process of an antibody, the enriched protein can simultaneously enrich the antibody and a secondary antibody which are specifically combined with the antigen in a sample to be detected, and after the enriched protein is added into the sample to be detected, the detection process can be completed at 20-35 mim, so that the time is effectively saved, and the detection efficiency and the sensitivity of the existing detection method are improved.

Description

Enriched protein, construction method and application thereof, and method for rapidly detecting antibody based on enriched protein

Technical Field

The invention belongs to the technical field of biology, and relates to a method for rapidly detecting an antibody, in particular to an enriched protein, a construction method and application thereof, and a method for rapidly detecting an antibody based on the enriched protein.

Background

Antibodies are a class of immunoglobulins that specifically bind to antigens, and methods for detecting antibodies that are currently widely used include immunofluorescence (cell-based CBA and tissue-based TBA), ELISA, chemiluminescence detection, Western blotting, immunoblotch, and the like.

When the above conventional method is used to detect antibodies, the pattern of the immune response is: the method comprises the steps of developing or photographing an antigen, a sample to be detected and an enzyme-labeled antibody, wherein the incubation time of a primary antibody and a secondary antibody is 30 min-1 h, some incubation times are even longer, the time consumed in the whole experiment process is about 1.5-3 h, and the experiment efficiency is low.

The immune colloidal gold method is an existing method capable of rapidly detecting an antibody, and a result can be obtained within 5-15 min, but the immune colloidal gold method is not widely applied because the detection range is limited, the sensitivity is low, and the use is greatly limited.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention aims to provide an enriched protein, a construction method and application thereof, and a method for rapidly detecting an antibody based on the enriched protein, which can effectively shorten the detection time and improve the detection efficiency and the detection sensitivity.

In order to achieve the purpose, the invention adopts the following technical scheme to realize the purpose:

the invention discloses an enriched protein, which is a recombinant protein and is obtained by transferring a constructed enriched protein expression vector into an expression strain to express and purify; wherein:

the protein enrichment expression vector is obtained by connecting an enrichment protein gene into an expression vector after amplification of a primer;

the enrichment protein gene is the gene combination of the B structural domain of staphylococcus aureus protein A and the DC3 structural domain of streptococcal protein G, and the nucleotide sequence is shown as SEQ ID NO. 1.

Preferably, the protein-enriched gene according to the present invention is further selected from a genetically engineered nucleic acid sequence capable of binding to the Fc-terminus of an antibody.

Preferably, the final concentration of the enriched protein is 500 ng/mL-25000 ng/mL.

The invention also discloses a construction method of the enriched protein, which comprises the following steps:

1) construction of an enriched protein expression vector

Synthesizing an enriched protein gene, designing a PCR primer to amplify a target fragment, and connecting the target fragment into an expression vector to obtain an enriched protein expression vector;

2) recombinant protein expression

Transferring the protein-enriched expression vector into an expression strain, performing low-temperature induction by adopting an inducer, centrifugally collecting thalli, and washing for later use;

3) recombinant protein purification

And adding the collected thalli into a bacteria-breaking liquid to carry out thallus crushing treatment, collecting supernatant of the bacteria-breaking liquid, and purifying by using affinity chromatography and ion exchange chromatography to obtain the enriched protein.

Preferably, the expression vector used in step 1) is pET22 b; in the step 2), the expression strain is expression strain Arctic express RIL, and the low-temperature induction is carried out by using isopropyl thiogalactoside at the temperature of 12-14 ℃; the centrifugation condition is 8000-12000 rpm/min, and the centrifugation is carried out for 3-5 min; the washing is carried out for 5-10 min by adopting TritonX-100 with the concentration of 0.5-1%.

Preferably, in the step 3), the amount of the bacteria-breaking liquid is 10mL per 200mL of the bacteria; the thalli crushing treatment adopts an osmotic pressure crushing method, and comprises the following operations:

adding a hypertonic buffer solution, standing on ice for 20-30 min, centrifuging at 8000-12000 rpm/min for 10-20 min, collecting precipitate, and discarding supernatant;

and adding a hypotonic buffer solution, standing on ice for 20-30 min, centrifuging at 8000-12000 rpm/min for 20-30 min, and collecting the supernatant.

Preferably, the hypertonic buffer consists of: 0.6 to 1.4M trehalose, 20mM Tris-HCl, 2mM MgCl ₂ The pH value is 8.0-9.5; the hypotonic buffer solution comprises the following components: 20mM Tris-HCl, 1mM EDTA, 1 Xcocktail, 5-10 mM imidazole, and pH 8.0-9.5.

Preferably, in step 3), after the first-step affinity chromatography is completed, the thrombin is used for enzyme digestion of the eluent, after the enzyme digestion of the sample is dialyzed, the second-step affinity chromatography is performed, the flow-through liquid processed in the step is collected, the DEAE chromatography is continuously performed, and the eluent is collected, so that the enriched protein sample is obtained.

The invention also discloses application of the enriched protein in preparation of a kit for detecting an antibody, wherein the use final concentration range of the enriched protein is 500 ng/mL-25000 ng/mL.

The invention also discloses a method for rapidly detecting the antibody by adopting the enriched protein, which comprises the following steps:

step 1: fixing the antigen, and determining the fixing mode of the antigen according to the adopted detection method;

step 2: incubating a sample, and uniformly mixing the sample to be detected with the enriched protein and the secondary antibody, wherein the sample to be detected contains an antibody combined with the coating antigen; the sample to be detected adopts stock solution or diluent;

and step 3: and (3) detecting, namely washing the incubated sample, performing color development treatment or photographing under a fluorescence microscope to obtain a detection result.

Preferably, in step 1, the method for immobilizing an antigen comprises:

when the ELISA method is adopted for detecting the antibody, the antigen is coated by using a coating buffer solution;

when an antibody is detected by adopting an immune spot method, drawing a proper amount of protein to an NC membrane or a PVDF membrane, and drying for later use;

when the CBA method or the TBA method is adopted to detect the antibody, a certain protein expressed in cells or tissues is taken as an antigen; when Western blotting is used for detecting the antibody, the antigen is subjected to SDS-PAGE electrophoresis and transferred to an NC membrane or a PVDF membrane by a wet method or a semi-dry method.

Compared with the prior art, the invention has the following beneficial effects:

the invention discloses a method capable of improving antibody detection efficiency, which comprises the steps of firstly expressing and purifying an enrichment protein B-DC3 through a prokaryotic system, then applying the enrichment protein to the detection process of an antibody, wherein the enrichment protein can simultaneously enrich the antibody and a secondary antibody which are specifically combined with an antigen in a sample to be detected, and after the enrichment protein is added into the sample to be detected, the detection process can be completed at 20-35 mim, so that the time is effectively saved, and the detection efficiency and the sensitivity of the existing detection method are improved.

According to the method for rapidly detecting the antibody by utilizing the enriched protein, disclosed by the invention, the enriched protein which is simultaneously combined with the primary antibody and the secondary antibody is added in the sample incubation process, so that the enriched protein can enrich the primary antibody and the secondary antibody in the sample to be detected in a short time, and the detection process of the antibody is accelerated.

Drawings

FIG. 1 is a graph showing the result of electrophoresis of the enriched protein B-DC3 of example 1;

FIG. 2 shows the positive result of the anti-GAD 65 antibody (immunoblotch);

FIG. 3 shows the positive results of anti-HMGCR antibody (immuno-spot);

FIG. 4 shows the structure of the recombinant vector pET22B-6 × his-Thrombin-B-DC 3.

Detailed Description

In order to make the technical solutions of the present invention better understood, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

It should be noted that the terms "first," "second," and the like in the description and claims of the present invention and in the drawings described above are used for distinguishing between similar elements and not necessarily for describing a particular sequential or chronological order. It is to be understood that the data so used is interchangeable under appropriate circumstances such that the embodiments of the invention described herein are capable of operation in sequences other than those illustrated or described herein. Furthermore, the terms "comprises," "comprising," and "having," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements expressly listed, but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.

The invention is described in further detail below with reference to the accompanying drawings:

EXAMPLE 1 expression and purification of enriched protein B-DC3

Construction of 1-enriched protein B-DC3 prokaryotic expression vector

1.1 searching a sequence of a B domain of a target gene proteinA protein, a D connection sequence of a proteinG protein and a sequence of a C3 domain of the proteinG protein from NCBI, carrying out gene synthesis on a Thrombin gene sequence, a B domain gene sequence of the proteinA, a D connection sequence of the proteinG and a C3 domain gene sequence of the proteinG according to a Thrombin enzyme digestion sequence-B-D-C3 sequence (the sequence of a Thrombin enzyme digestion site is GTTCCGCGTGGATCC), wherein the sequence of the enriched protein B-DC3 is shown as SEQ ID NO:1, and amplifying the target gene by PCR by adopting the following primers after synthesis.

The sequence of the upstream primer is as follows: GTGAATTCGCACCACCACCACCACCACCTG

The sequence of the downstream primer is as follows: AGCTCGAGTCATTCAGTTACCGTAAAG

1.2 inserting the target gene with enzyme cutting site into expression vector pET22B, wherein the insertion site is EcoRI/xhoI to obtain recombinant vector, and the recombinant vector is named as pET22B-6 × his-Thrombin-B-DC3, and the structural diagram is shown in figure 4.

1.3 sequencing the recombinant vector pET22B-6 × his-Thrombin-B-DC3, and transferring the recombinant vector with correct sequencing into an expression strain Arctic express RIL for later use.

2 inducible expression of the enrichment protein B-DC3

2.1 picking transformed single clones into 3mL medium (final amp concentration 0.5mg/mL), 220rpm, 37 ℃ overnight culture;

transferring the cells to 200mL of culture medium at a ratio of 1:100 for 2.2 days, adding IPTG (isopropyl thiogalactoside) with a final concentration of 0.5mM when the OD600 is 0.8, and inducing overnight at 14 ℃;

2.3, collecting bacteria: centrifuging at 12000rpm for 3min, and collecting thallus;

2.4 washing: washing thallus with 0.5% TritonX-100, rotating at 4 deg.C for 10min, centrifuging, collecting thallus, and freezing at-20 deg.C for use.

3 purification of recombinant protein B-DC3

3.1 disruption of the cells

3.1.1 adding hypertonic buffer solution, wherein the buffer solution comprises the following components: 0.6 to 1.4M trehalose, 20mM Tris-HCl, 2mM MgCl ₂ Keeping the pH value at 8.0-9.5, standing on ice for 20-30 min, centrifuging at 8000-12000 rpm/min for 10-20 min, collecting precipitate, and discarding supernatant;

3.1.2 adding hypotonic buffer solution, the buffer solution comprises the following components: 20mM Tris-HCl, 1mM EDTA, 1 Xcocktail, 5-10 mM imidazole, pH 8.0-9.5, and placing on ice for 20-30 min;

3.1.3 collecting crude extract of protein: centrifuging the sample obtained at 3.1.2 at 8000-12000 rpm/min for 20-30 min, and collecting the supernatant;

3.2 purification of B-DC3

3.2.1 the first step is affinity chromatography;

(1) balance filling: balancing 2mL of the washed filler with a balance buffer solution of 20mM Tris-HCl, 1mM EDTA, 1 Xcocktail and 5-10 mM imidazole at a pH of 8.0-9.5;

(2) mixing the treated sample with a filler, and placing the mixture on a shaker for ice bath for about 2 hours to ensure that the target protein is fully combined with the filler;

(3) placing the sample in a tube with a filter membrane, allowing unbound heteroproteins to flow through and washing 30-50 column volumes with an equilibration buffer;

(4) and (3) elution: eluting with an elution buffer solution, wherein the elution buffer solution is 20mM Tris-HCl, 150mM NaCl, 20 mM-1M imidazole and pH8.0; after SDS-PAGE verification of the eluted sample, thrombin is added into the sample containing the target protein band, the enzyme digestion is carried out at 20 ℃ overnight, and the enzyme digested sample is dialyzed by using dialysate 20mM Tris-HCl and pH8.0.

3.2.2 the second step is affinity chromatography;

(1) balance filling: taking 2mL of the washed filler, and balancing the filler with a balance buffer solution of 20mM Tris-HCl and pH 8.0;

(2) loading: the dialyzed sample was added to the packing and the flow-through was collected.

3.2.3 the third step is DEAE chromatography

(1) Balance filling: taking 2mL of filler, and balancing with balance buffer solution 20mM Tris-HCl and pH 8.0;

(2) loading: adding the flow-through liquid collected in the 3.2.2 step (2) into a packing;

(3) washing: balancing 30-50 column volumes with an equilibrium buffer;

(4) and (3) elution: eluting with an elution buffer solution of 20mM Tris-HCl, 20 mM-1M NaCl, pH8.0, performing SDS-PAGE on the eluted sample, and measuring the protein concentration by using a BCA method.

The result of the protein electrophoresis band of the enriched protein B-DC3 obtained after DEAE chromatography is shown in FIG. 1.

Example 2 detection of antibodies Using enriched protein (immunoSpot method)

3 cases of GAD65 antibody positive blood (positive blood 1, positive blood 2, positive blood 3), 3 cases of HMGCR antibody positive blood (positive blood 4, positive blood 5, positive blood 6), 6 cases of normal serum (normal blood 1, normal blood 2 and normal blood 3 cases applied to the patch coated with GAD65 antigen, normal blood 4, normal blood 5 and normal blood 6 applied to the patch coated with HMGCR antigen) were selected.

1. Putting the membrane coated with the GAD65 and HMGCR antigens into a 24-hole plate for later use;

2. incubation of the sample: diluting a sample to be detected by 100 times by using working solution (1 XPBS, 0.5% Triton X-100 and 0.04% EDTA), diluting an AP-labeled goat anti-human IgG antibody by 2000 times (the antibody is purchased from jackson company and dry antibody powder is dissolved according to the instructions), diluting the enriched protein by 200 times (the concentration of the enriched protein is 1mg/ml) and the total volume is 200ul (wherein the sample to be detected is 2ul of serum, the AP-labeled goat anti-human IgG antibody is 0.1ul, the enriched protein is 1ul and the working solution volume is 196.9ul), mixing uniformly, adding the mixture into a well in which a membrane is placed, and incubating at room temperature for 15 min;

3. washing: removing the secondary antibody incubation solution in the wells, adding washing solution (0.8% NaCl, 0.5% Triton X-100) 200 μ L/well, placing in a shaking table, washing for 4 min/time for 2 times;

4. color development: removing the washing solution in the holes, adding 200 mu L/hole of substrate diluent BCIP/NBT (substrate: reaction buffer solution is 1:49), and standing at room temperature in a dark place for 4 minutes to obtain a color development result;

5. and (3) stopping color development: and discarding substrate diluent in the holes, rinsing the membrane for 1-2 times by using distilled water, taking out and airing the membrane or drying the membrane at 37-45 ℃, and analyzing the result.

Comparative example 1 (immunoblot method)

The selection and incubation of the comparative example sera was the same as in example 2.

1. Putting the membrane coated with the GAD65 and HMGCR antigens into a 24-hole plate for later use; 2. incubation of the sample: diluting the sample to be detected by 100 times with working solution (1 × PBS, 0.5% Triton X-100, 0.04% EDTA), adding into the well with the membrane, and incubating at room temperature for 30 min;

3. washing: removing the serum incubation solution in the wells, adding the working solution at 200 μ L/well, and washing in a shaker (frequency of about 40 times/min) for 4 min/time for 2 times;

4. and (3) secondary antibody incubation: the working solution in the wells was removed, and 200. mu.L/well of AP-labeled goat anti-human IgG antibody diluted 1:2000 was added. Placing in a shaking table, and incubating at room temperature for 30 min;

5. washing: removing the secondary antibody incubation solution from the wells, adding washing solution (0.8% NaCl, 0.5% Triton X-100) at a volume of 200 μ L/well, and washing for 2 times in a shaking table for 4 min/time;

6. color development: after removing the washing solution in the wells, 200. mu.L/well of a substrate diluent (substrate: reaction buffer: 1:49) was added, and the mixture was left standing at room temperature in the dark for 4 minutes to obtain a color development result;

7. and (3) stopping color development: and discarding substrate diluent in the holes, rinsing the membrane for 1-2 times by using distilled water, taking out and airing the membrane or drying the membrane at 37-45 ℃, and analyzing the result.

Comparative example 2 (immunoblot method)

This comparative example differs from example 2 in that the incubation of the step 2 samples did not add enrichment protein.

Results referring to fig. 2 and 3, the results of example 2, comparative example 1 and comparative example 2 of the immunoblot method were analyzed as follows:

the difference between the comparative example 1 and the example 2 is that the comparative example 1 uses a normal spot detection step for detection, while the example 2 adds the enriched protein in the detection process, the results of the two detection steps are basically consistent, the example 2 has the advantages that the detection step is simplified, the whole detection process only needs about 30min, the comparative example 1 needs more steps, and the whole detection process needs about 80min, so that compared with the comparative example 1, the example 2 has simple steps, the detection time is obviously shortened, and the detection efficiency is further improved.

The difference between the comparative example 2 and the example 2 is that the enriched protein is not added in the incubation process of the sample in the comparative example 2, and the positive sample is not detected after the color development, while the example 2 obtains a normal detection result, so the addition of the enriched protein is a precondition for detecting the positive sample;

therefore, it can be seen that the addition of the enriched protein simplifies the experimental procedure and improves the detection efficiency.

Example 3 detection of antibodies Using enriched protein (ELISA method)

The serum was selected and used as in example 2.

1. And (3) fixing the antigen: taking appropriate amount of purified antigens GAD65 and HMGCR, diluting to 2ng/μ L with coating buffer (50mM carbonate buffer, pH9.6), adding 100ul per well, and coating at 4 deg.C overnight;

2. and (3) sealing: blocking with 5% BSA at room temperature for 30 min;

3. incubation of the sample: diluting a sample to be detected by 100 times by using PBST (T: 0.5% Tween20), diluting an HRP-labeled goat anti-human IgG antibody by 2000 times (the antibody is purchased from jackson company and the antibody dry powder is dissolved according to the instruction), diluting an enriched protein by 200 times (the concentration of the enriched protein is 1mg/ml) and the total volume is 200 mu L (wherein the sample to be detected is 2 mu L of serum, the volume of the HRP-labeled goat anti-human IgG antibody is 0.1 mu L, the volume of the enriched protein is 1 mu L and the volume of the PBST is 196.9 mu L), mixing uniformly, adding the mixture into a hole, and incubating at room temperature for 15 min;

4. washing: removing the secondary antibody incubation solution in the wells, adding PBST (T: 0.5% Tween20) at 200 μ L/well, placing in a shaking table, washing for 3 times in total;

5. color development: after PBST in the hole is removed, 100ul of TMB color development liquid is added, and color development is carried out for 5 minutes in a dark place at room temperature;

6. and (3) stopping color development: and after the color development is finished, adding 50ul of stop solution for stopping, and measuring the numerical value by using the ELISA plate.

Comparative example 3(ELISA method)

The serum was selected and used as in example 2.

1. And (3) fixing the antigen: diluting appropriate amount of purified antigen GAD65 and HMGCR with coating buffer (50mM carbonate buffer, pH9.6) to 2ng/ul, adding 100ul per well, and coating at 4 deg.C overnight;

2. and (3) sealing: blocking with 5% BSA at room temperature for 30 min;

3. and (3) serum incubation: the sample to be tested was diluted 100-fold using PBST (T: 0.5% Tween20), added to the corresponding ELISA well and incubated at room temperature for 30 min;

4. washing: removing the serum incubation solution from the wells, adding PBST (T: 0.5% Tween20), 200 μ L/well, 3 min/time, and washing 3 times;

5. and (3) secondary antibody incubation: the washing solution in the wells was removed, and HRP-labeled goat anti-human IgG antibody diluted 1:2000 was added at 200. mu.L/well and incubated at room temperature for 30 min.

6. Washing: removing the secondary antibody incubation solution in the wells, adding PBST (T: 0.5% Tween20) at 200 μ L/well, placing in a shaking table, washing for 3 times in total;

7. color development: after removing PBST (T: 0.5% Tween20) in the wells, adding 100ul of TMB color development solution, and developing for 5 minutes in a dark place at room temperature;

8. and (3) stopping color development: and after the color development is finished, adding 50ul of stop solution for stopping, and measuring the numerical value by using the ELISA plate.

Comparative example 4(ELISA method)

Comparative example 4 differs from example 3 in that the incubation step of the step 3 sample is not enriched for protein.

The results of the experiment are shown in tables 1 and 2 below:

TABLE 1 Positive anti-GAD 65 antibody (ELISA)

TABLE 2 anti-HMGCR antibody positive (ELISA)

	Comparative example 3	Example 3	Comparative example 4
				Positive blood 4	0.302	0.378	0.058
Positive blood 5	0.686	0.883	0.056
				Positive blood 6	0.796	0.876	0.058
Normal blood 4	0.054	0.055	0.056
				Normal blood 5	0.056	0.055	0.056
Normal blood 6	0.055	0.056	0.056

The results of example 3, comparative example 3 and comparative example 4 of the ELISA method were analyzed as follows:

the difference between the comparative example 3 and the example 3 is that the comparative example 3 uses a normal ELISA step for detection, while the example 3 adds the enriched protein in the detection process, the results of the two detection steps are basically consistent, the example 3 has the advantage that the detection step is simplified, the time from sample incubation to color development is only about 30min, while the comparative example 3 needs more steps, the time from sample incubation to color development requires about 85min, therefore, compared with the comparative example 3, the example 3 has simple steps, the detection time is shortened by about 55min, and the detection efficiency is further improved;

the difference between the comparative example 4 and the example 3 is that the enriched protein is not added in the incubation process of the sample in the comparative example 4, and the positive sample is not detected after the color development, while the example 3 obtains a normal detection result, so the addition of the enriched protein is a precondition for detecting the positive sample;

therefore, the addition of the enriched protein can simplify the experimental steps of the ELISA method and improve the detection efficiency.

The above-mentioned contents are only for illustrating the technical idea of the present invention, and the protection scope of the present invention is not limited thereby, and any modification made on the basis of the technical idea of the present invention falls within the protection scope of the claims of the present invention.

Sequence listing

<110> Shanxi vessel Biotechnology GmbH

<120> enrichment protein, construction method and application thereof, and method for rapidly detecting antibody based on enrichment protein

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 387

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcggataaca aattcaacaa agaacaacaa aatgctttct atgaaatctt acatttacct 60

aacttaaacg aagaacaacg caatggtttc atccaaagct taaaagatga cccaagccaa 120

agcgctaacc ttttagcaga agctaaaaag ctaaatgatg cacaagcacc aaaaaaacca 180

gaagtgatcg atgcgtctga attaacacca gccgtgacaa cttacaaact tgttattaat 240

ggtaaaacat tgaaaggcga aacaactact aaagcagtag acgcagaaac tgcagaaaaa 300

gccttcaaac aatacgctaa cgacaacggt gttgatggtg tttggactta tgatgatgcg 360

actaagacct ttacggtaac tgaatga 387

Claims (10)

1. An enriched protein is characterized in that the enriched protein is a recombinant protein and is obtained by transferring a constructed enriched protein expression vector into an expression strain to express and purify; wherein:

the protein-enriched expression vector is obtained by connecting an enriched protein gene into an expression vector after amplification of a primer; the enrichment protein gene is the gene combination of the B structural domain of staphylococcus aureus protein A and the DC3 structural domain of streptococcal protein G, and the nucleotide sequence is shown as SEQ ID NO. 1.

2. The enriched protein of claim 1, wherein the enriched protein is used at a final concentration ranging from 500ng/mL to 25000 ng/mL.

3. The method for constructing an enriched protein according to claim 1 or 2, comprising the steps of:

1) construction of an enriched protein expression vector

Synthesizing an enriched protein gene, designing a PCR primer to amplify a target fragment, and connecting the target fragment into an expression vector to obtain an enriched protein expression vector;

2) recombinant protein expression

Transferring the protein-enriched expression vector into an expression strain, performing low-temperature induction by adopting an inducer, centrifugally collecting thalli, and washing for later use;

3) recombinant protein purification

And adding the collected thalli into a bacteria-breaking liquid to carry out thallus crushing treatment, collecting supernatant of the bacteria-breaking liquid, and purifying by using affinity chromatography and ion exchange chromatography to obtain the enriched protein.

4. The method for constructing an enriched protein according to claim 3, wherein the expression vector used in step 1) is pET22 b; in the step 2), the expression strain is expression strain Arctic express RIL, and the low-temperature induction is carried out by using isopropyl thiogalactoside at the temperature of 12-14 ℃; centrifuging at 8000-12000 rpm for 3-5 min; the washing is carried out for 5-10 min by adopting TritonX-100 with the concentration of 0.5% -1%.

5. The method for constructing an enriched protein according to claim 3, wherein in the step 3), the amount of the bacteria-breaking liquid is 10mL per 200mL of the bacteria; the thalli crushing treatment adopts an osmotic pressure crushing method, and comprises the following operations: adding a hypertonic buffer solution, standing on ice for 20-30 min, centrifuging at 8000-12000 rpm for 10-20 min, collecting precipitate, and discarding supernatant; and adding a hypotonic buffer solution, standing on ice for 20-30 min, centrifuging at 8000-12000 rpm for 20-30 min, and collecting the supernatant.

6. The method for constructing an enriched protein according to claim 5, wherein the hypertonic buffer solution comprises the following components: 0.6 to 1.4M trehalose, 20mM Tris-HCl, 2mM MgCl ₂ The pH value is 8.0-9.5; the hypotonic buffer solution comprises the following components: 20mM Tris-HCl, 1mM EDTA, 1 Xcocktail, 5-10 mM imidazole, and pH 8.0-9.5.

7. The method for constructing an enriched protein according to claim 3, wherein in step 3), after the first-step affinity chromatography is completed, the eluate is digested with thrombin, after the digested sample is dialyzed, the second-step affinity chromatography is performed, the flow-through solution processed in the step is collected, the DEAE chromatography is continuously performed, and the eluate is collected, so that the enriched protein sample is obtained.

8. The use of the enriched protein of claim 1 in the preparation of a kit for detecting antibodies, wherein the enriched protein is used at a final concentration ranging from 500ng/mL to 25000 ng/mL.

9. A method for rapid detection of antibodies for non-disease diagnostic purposes using the enriched protein of claim 1 or 2, comprising the steps of:

step 1: fixing the antigen, and determining the fixing mode of the antigen according to the adopted detection method;

step 2: incubating a sample, and uniformly mixing the sample to be detected with the enriched protein and the second antibody, wherein the sample to be detected contains an antibody combined with the coating antigen; the sample to be detected adopts stock solution or diluent;

and 3, step 3: and (3) detecting, namely washing the incubated sample, performing color development treatment or photographing under a fluorescence microscope to obtain a detection result.

10. The method for rapid detection of antibodies for non-disease diagnostic purposes according to claim 9, wherein in step 1, the method for immobilizing antigens comprises:

when the ELISA method is adopted to detect the antibody, the antigen is coated by using a coating buffer solution;

when an antibody is detected by adopting an immune spot method, drawing a proper amount of protein to an NC membrane or a PVDF membrane, and drying for later use;

when the CBA method or the TBA method is adopted to detect the antibody, a certain protein expressed in cells or tissues is taken as an antigen; when Western blotting is used for detecting the antibody, the antigen is subjected to SDS-PAGE electrophoresis and transferred to an NC membrane or a PVDF membrane by a wet method or a semi-dry method.

Images