CN114231568A - Auxiliary protein for improving DNA repair efficiency and gene editing vector and application thereof - Google Patents

Auxiliary protein for improving DNA repair efficiency and gene editing vector and application thereof Download PDF

Info

Publication number
CN114231568A
CN114231568A CN202111562790.9A CN202111562790A CN114231568A CN 114231568 A CN114231568 A CN 114231568A CN 202111562790 A CN202111562790 A CN 202111562790A CN 114231568 A CN114231568 A CN 114231568A
Authority
CN
China
Prior art keywords
vector
protein
dna
seq
gene editing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111562790.9A
Other languages
Chinese (zh)
Other versions
CN114231568B (en
Inventor
郭熙志
刘金昊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ankeli Chongqing Biomedical Technology Co ltd
Original Assignee
Ankeli Chongqing Biomedical Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ankeli Chongqing Biomedical Technology Co ltd filed Critical Ankeli Chongqing Biomedical Technology Co ltd
Priority to CN202111562790.9A priority Critical patent/CN114231568B/en
Publication of CN114231568A publication Critical patent/CN114231568A/en
Application granted granted Critical
Publication of CN114231568B publication Critical patent/CN114231568B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides an auxiliary protein for improving DNA repair efficiency, a gene editing vector and application thereof, and belongs to the technical field of gene editing and gene therapy. The nucleotide sequence of the auxiliary protein for improving the DNA repair efficiency is shown in SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3. The accessory protein fragment provided by the invention is shorter, compared with a RAD51-Cas9n system, the homologous recombination efficiency is higher, and the accessory protein fragment is more suitable for packaging a transgenic virus vector; compared with the Prime editing system, the method can repair the variation of the multi-base and large-fragment DNA, and has stronger repair function.

Description

Auxiliary protein for improving DNA repair efficiency and gene editing vector and application thereof
Technical Field
The invention relates to the technical field of gene editing and gene therapy, in particular to an auxiliary protein for improving DNA repair efficiency, a gene editing vector and application thereof.
Background
At present, human beings lack effective therapeutic means for Genetic Diseases (Genetic Diseases) caused by changes in sequence or structure of Genetic DNA. The current methods of treatment are more focused on preventive measures such as prenatal diagnosis and the like rather than active treatment. Precision medicine (Precision medicine) provides a solution for radical cure of complex genetic diseases, which is a new concept developed along with the progress of gene sequencing and pharmacogenomics, breaks through the bottleneck of traditional medicine in individual diagnosis and special treatment, and covers genetic diseases such as immune inflammation, cancer, heart disease and the like, and other chronic diseases such as diabetes, neurodegenerative diseases and the like. Gene therapy (Gene therapies) and Gene editing (Gene editing) are achieved by introducing a DNA fragment with a correct sequence into cells carrying mutations of a patient to replace a harmful fragment or introducing protein molecules, activating a cell stress-resistant path, closing a pathogenic Gene action path, assisting correct DNA replacement and carrying out fixed-point correction on bases so as to radically treat genetic diseases. Gene editing techniques have been widely used in the field of biological treatment of disease, and have been well evaluated clinically in the field of immunotherapy for some genetic diseases and rare diseases, such as thalassemia, Duchenne muscular dystrophy, and tumors.
Gene editing (Gene editing) refers to the insertion, deletion, modification or substitution of a DNA fragment at a specific position in the genome of a living body. The CRISPR gene editing system was successively elucidated by the teams jennek, m., chrysnski, k., Fonfara, i., Hauer, m., Doudna, j.a., and charpienter, e. (2012). a programmable dual-RNA-guided dna end in adaptive bacterial immunity 337, 816-821), in 2012, by jenner Doudna and emmuelle charpienter, etc., and it only needs 1 sgRNA (single-guided RNA) and Cas (CRISPR-assisted) nuclease to achieve efficient site-directed cleavage, which has become the mainstream of gene engineering technology due to its simple and efficient characteristics. Cas9 is a representative nuclease among others. Cas9 nuclease has HNH and RuvC nuclease domains, is guided by sgRNA to specific genome positions, recognizes PAM (Protospace AdjacentMotif) to be stable, and further forms Double-Strand Break (DSB) at 3bp upstream of 5' of PAM. However, this system has the disadvantage that off-target effects, which can currently be improved by bioinformatically optimizing the design of sgrnas, are present.
Under the cutting action of enzymes such as Cas9, the genome of the cell is induced to generate DSB and spontaneous repair. The spontaneous DNA repair mechanism of cells is various, including Non-homologous End Joining (NHEJ), homologous Recombination (HDR), selective Non-homologous End Joining (altEJ), and single-strand annealing (SSA). In the NHEJ pathway the protein module pulls the fragmented double-stranded DNA together spatially and then is joined by DNA ligase, a process that does not require a template but often introduces random insertions or deletions (indels). HDR-dependent DNA damage repair mechanisms are also one of the DSB-induced mechanisms of spontaneous gene repair. The whole process of HDR requires the involvement of DNA damage stress proteins, including Brac2, BARD1, Rad51, etc. The genome of the cell can carry out accurate repair on the gene segment cut by the Cas9 through HDR according to a template provided by an endogenous sister chromosome or an exogenous gene segment.
The basic strategy of gene therapy is to use a viral (e.g. adenovirus AAV) vector to carry Cas9 protein, sgRNA and a donor DNA template to perform gene editing and repair on mutant DNA of a body cell genome. The HDR mode of DNA repair is the desired mode of gene repair during CRISPR/Cas9 gene editing, but it is a relatively low proportion, typically less than 1%, in cell-spontaneous gene repair processes. While NHEJ-dependent DNA repair accounts for a substantial proportion of this process. Therefore, the important objective of the scientific community is to improve the DNA repair proportion depending on an HDR mode in the CRISPR/Cas9 gene editing process and better realize accurate gene editing and treatment.
Therefore, gene repair by homologous recombination in gene editing has become one of the important strategies for gene therapy. In order to achieve better targeted and precise gene repair, there are currently several approaches:
(1) single base editing. CBE (cysteine Base editor) and ABE (formed by integrating inactivated Cas9 and tRNA adenosine deaminase) have been developed to perform catalytic conversion of chemical groups of cytosine of deoxynucleotides in specific regions of a genome, so as to realize single Base editing. At present, the single base editing technology is widely confirmed, but the risk of RNA mutation caused by off-target still exists, and researchers should pay attention to side effects in aspects such as off-target of transcriptome and the like.
(2) A Prime Editing (Prime Editing) system is used. Cas9n protein and engineered reverse transcriptase are integrated together, and a pegRNA (primary editing gRNA) which can specifically target and encode a target sequence is combined, so that new genetic information is directly written in a specific site of a human cell genome. And then by improving the pilot editing system, indel byproducts are reduced by transiently expressing an MMR (DNA Mismatch repair) inhibitor MLH1dn, and meanwhile, the editing efficiency is remarkably improved by modifying the prime editor, so that a PEmax framework compatible with a PE4 system, a PE5 system and an epegRNA system is established.
(3) The efficiency of embryonic gene Knock-In (KI) was significantly improved by activating the IHR (Interhololog replay) pathway using the Rad51 protein to assist In embryonic gene editing. Studies have shown that fusion expression of hRad51(S208E-a209D) and Cas9n results in higher integration efficiency, lower deletion and off-target rates in HEK293T cells.
(4) The aim of improving the insertion efficiency of the target segment can be achieved by inhibiting other DSB repair pathways such as NHEJ and the like. For example, the use of small molecule drugs NU7441 and KU-0060648 to inhibit DNA-PK, a key member of the NHEJ pathway, in a variety of cells has been investigated to increase the proportion of HDR.
The current sequence length of various precise gene editors (ABE/CBE, Prime editing, etc.) is too long to exceed the capacity limit of the common transgenic vectors. The capacity of adenovirus vector (AAV) commonly used in gene therapy is only 4.7kb at present, the basic framework in the vector is about 1200bp (including 290bp for two ITRs, 750bp for hCMV and 150bp for polyA), and the capacity of the remaining vector is only about 3 kb. The capacity of a Lentivirus vector (Lentivirus) can be about 6-6.5 kb, hCMV and PolyA are removed, and generally, an insert fragment of less than 5kb is not obtained. And the larger the insert, the significantly lower the lentiviral packaging titer. Whereas the Cas9 gene itself is 4.1kb in length. This results in that binary and even ternary vector systems often have to be used when designing gene editor vector systems, which in turn leads to a significant reduction in the efficiency of virus packaging.
Disclosure of Invention
The invention aims to provide a method for screening shorter auxiliary protein, assisting a DNA repair process induced by gene editing and improving the accurate repair ratio of a gene in an HDR (homologous recombination) mode.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides an accessory protein for improving DNA repair efficiency, wherein the nucleotide sequence of the accessory protein is shown as SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3.
The invention also provides an expression plasmid comprising the helper protein.
Preferably, the nucleotide sequence of the expression plasmid is shown as SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6.
The invention also provides a gene editing vector for improving the DNA repair efficiency, which comprises the auxiliary protein, the DNA editing protein and a delivery vector.
Preferably, the DNA-editing proteins include Cas9 protein, CasX protein, Cas Φ protein, Cas12 protein, Cas14 protein.
Preferably, the helper protein is fused to the carbon terminus or nitrogen terminus of the DNA editing protein.
Preferably, the delivery vector includes a viroid vector Lentivirus, an adenoviral vector AAV, a retroviral vector pMSCV, a pCMV cloning vector, and an integration-defective viroid vector.
Preferably, the integration-defective viroid vector system comprises psPAX2-D64V-NC-MS2(Addgene, #122944), pCMV-BRID-Cas9-6XMS2 (plasmid map as shown in FIG. 14 and plasmid sequence as shown in SEQ ID NO: 14).
The invention also provides application of the auxiliary protein, the expression plasmid and the gene editing vector in preparation of products for improving DNA repair efficiency.
Preferably, the DNA repair is DNA repair by homologous recombination.
Preferably, the product for improving the efficiency of DNA repair comprises a drug or an agent for improving the efficiency of DNA repair.
The accessory protein fragment provided by the invention is shorter, compared with a RAD51-Cas9n system, the homologous recombination efficiency is higher, and the accessory protein fragment is more suitable for packaging a transgenic virus vector; compared with the Prime editing system, the method can repair the variation of the multi-base and large-fragment DNA, and has stronger repair function.
Drawings
FIG. 1 is a plasmid map of pcDNA3.1-NLS-BARD1 plasmid;
FIG. 2 is a plasmid map of pcDNA3-BRID plasmid;
FIG. 3 is a plasmid map of pcDNA3-ARD plasmid;
FIG. 4 is a plasmid map of pcDNA3-BRID-ARD plasmid;
FIG. 5 shows fluorescence intensity of 293T cells with GFP + under fluorescent microscope in example 2;
FIG. 6 shows the proportion of 293T cells analyzing GFP + by FACS in group 1 of example 2;
FIG. 7 shows the proportion of 293T cells analyzing GFP + by FACS in group 2 of example 2;
FIG. 8 shows the proportion of 293T cells analyzing GFP + by FACS in group 3 of example 2;
FIG. 9 shows the proportion of 293T cells analyzing GFP + by FACS in group 4 of example 2;
FIG. 10 shows the proportion of 293T cells analyzing GFP + by FACS in group 5 of example 2;
FIG. 11 is a histogram of the proportion of 293T cells analyzed for GFP + by FACS in groups 1-5 of example 2;
FIG. 12 is an electrophoretogram of accessory protein BRID;
FIG. 13 is an electrophoretogram of the BRID-Cas9 fragment;
FIG. 14 is a plasmid map of integration-defective viroid-like vector pCMV-BRID-Cas9-6XMS 2.
Detailed Description
Example 1
Expression plasmids for the accessory proteins BRID, ARD and BRID-ARD were constructed separately.
The expression plasmids pcDNA3-BRID, pcDNA3-ARD and pcDNA3BRID-ARD are constructed by using the fragments of auxiliary proteins BRID, ARD and BRID-ARD as inserted DNA and pcDNA3.1-NLS-BARD1 plasmid as vector skeleton. Wherein, the nucleotide sequences of the accessory proteins BRID, ARD and BRID-ARD are respectively shown as SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3. The plasmid map of pcDNA3.1-NLS-BARD1 plasmid is shown in FIG. 1, and the nucleotide sequence is shown in SEQ ID NO: 7.
The construction process is as follows: the BRID, ARD and BRID-ARD helper proteins were separately removed, digested simultaneously with BamH1+ Xho1 endonuclease (NEB) at 37 ℃ for 2h, and DNA products (as insert DNA) were separately recovered using a kit (Novozan, cat # DC 301-01); the pcDNA3.1-NLS-BARD1 plasmid was also digested simultaneously with BamH1+ Xho1 endonuclease (NEB Co.) at 37 ℃ for 2h, and DNA products (as vector backbone DNA) were recovered separately using a kit (Novozam, cat # DC 301-01); ligation was then completed with T4 ligase following the following ligation system (Table 1) at 25 ℃ for more than 5 min:
TABLE 1 construction of the ligation System of three expression plasmids
Composition of matter Dosage of
5×T4 Ligase Buffer 2μl
Insert DNA 90fmol
Vector backbone DNA 30fmol
T4 Ligase 1μl
ddH2O Make up system to 10. mu.l
After the connection is finished, the three connection products are respectively transformed into DH5 competent bacteria (Scopheraceae, cat number: TSC-C14), the colonies are selected on an LB plate, the colonies are obtained by sequencing identification, and expression plasmids pcDNA3-BRID, pcDNA3-ARD and pcDNA3-BRID-ARD are obtained by sequencing identification. The plasmid map of the expression plasmid pcDNA3-BRID is shown in FIG. 2, and the nucleotide sequence is shown in SEQ ID NO. 4; the plasmid map of the expression plasmid pcDNA3-ARD is shown in FIG. 3, and the nucleotide sequence is shown in SEQ ID NO. 5; the plasmid map of expression plasmid pcDNA3-BRID-ARD is shown in FIG. 4, and the nucleotide sequence is shown in SEQ ID NO. 6.
Example 2
The fluorescent reporter plasmid pDR-GFP induces the DNA repair process of the NHEJ pathway or the HDR pathway of the cell autonomy under the action of CRISPR/Cas 9. Only HDR-dependent repair modalities, cells normally fluoresce green, while GFP fluorescence is weaker or no fluorescence if NHEJ-mediated DNA ligation is repaired.
This example utilizes the fluorescent reporter plasmid pDR-GFP (purchased from Addgene, #26475) as a reporter plasmid for HDR pathway-dependent DNA repair efficiency. The expression plasmids for the three helper proteins constructed in example 1 were tested for DNA repair efficiency for the HDR pathway.
SceGFPgRNA1 is designed aiming at a DNA sequence near an I-SceI enzyme cutting site on a fluorescent reporter plasmid pDR-GFP, and is cloned into a Lenti-sgRNA-CRISPR-v2 vector (purchased from Addge, #52961) through a BsmB1 site to obtain a Lenti-SceGFPgRNA1-CRISPR gene editing vector. The cloning method is as follows:
(1) the lentiviral vector Lenti-sgRNA-CRISPR-v2 was digested with BsmB1 restriction enzyme (NEB) for 2h at 37 ℃. The DNA fragment was recovered using a kit (Novozan, cat # DC 301-01).
(2) The following 2 primer DNA fragments were mixed, denatured at 95 ℃ for 5 minutes, and cooled at 20 ℃ for 20 minutes at room temperature.
SceGFPsgRNA1-for: aaacaagttcagcgtgtccggcta (shown as SEQ ID NO: 8)
SceGFPsgRNA1-rev: aaaatagccggacacgctgaactt (shown in SEQ ID NO: 9).
(3) The purified Lenti-sgRNA-CRISPR-v2 enzyme-cleaved vector was mixed with the denatured 2 primers, and then reacted with 1. mu.l of T4 ligase (Invitrogen) at 25 ℃ for 5min or more, as shown in Table 2:
table 2 construction of a ligation System of Lenti-SceGFPgRNA1-CRISPR vector
Composition of matter Dosage of
5×T4 Ligase Buffer 2μl
2 primers 90fmol
Purified Lenti-sgRNA-CRISPR (v2) enzyme cutting vector 30fmol
T4 Ligase 1μl
ddH2O Make up system to 10. mu.l
(4) The ligation product is transformed into Stbl3 escherichia coli competent strain (Strongco, cat # TSC06), and the strain is selected and cloned on LB culture medium, after overnight culture, DNA is extracted, and the clone inserted into sgRNA1 is identified by a sequencing method, and is named as Lenti-SceGFPgRNA1-CRISPR gene editing vector.
The fluorescent reporter plasmids pDR-GFP and Lenti-SceGFPgRNA1-CRISPR gene editing vectors are transfected into 293T cells, then are respectively transferred into expression plasmids pcDNA3-BRID, pcDNA3-ARD and pcDNA3-BRID-ARD, and the influence of the three expression plasmids on HDR pathway DNA repair efficiency is determined. And 293T cells transfected with the fluorescent reporter plasmid pDR-GFP alone are used as blanks, and 293T cells transfected with the fluorescent reporter plasmid pDR-GFP and the Lenti-SceGFPgRNA1-CRISPR gene editing vector are used as controls.
By 6.25X 104Density of cells/well 293T cells were seeded in 24-well plates in DMEM high-glucose medium + 10% fetal bovine serum FBS at 37And growing the film on the wall at the temperature of 24 hours. The transfection premix system was configured as in table 3, with 3 well replicates for each group. The mixed system was prepared by mixing DNA with Lipo8000 liposome (Biyuntian Co.) and standing at room temperature for 10min or more. The corresponding transfection system was added to each well, the 24-well plate was gently tilted and rotated to mix well the well systems, and then the 24-well plate was placed in a cell incubator, and culture was continued with DMEM high-sugar medium + 10% fetal bovine serum FBS at 37 ℃.
TABLE 3 transfection premix System
Figure BDA0003421085810000031
Figure BDA0003421085810000041
TABLE 4 composition Table of culture Medium
Composition (per 50ml) Brand Dosage of
DMEM high-sugar medium HAKATA 45ml
Fetal Bovine Serum (FBS) Gibco 5ml
Penicillin-streptomycin solution (100X) Biyuntian (a Chinese character) 0.5ml
The cells were cultured for 48h, and the fluorescence intensity was observed under a fluorescence microscope. The cells in each well were then replaced with complete medium containing puromycin at a working concentration of 2 μ g/mL, and a short period of drug stimulation was performed to enhance plasmid gene expression and amplify the fluorescence signal intensity without loss of cells. After 24h incubation with puromycin stimulation, the fluorescence intensity was observed under a fluorescence microscope and recorded as figure 5. As can be seen from fig. 5, the fluorescence intensities of group 3, group 4 and group 5 were significantly higher than those of the control group 2. Therefore, the three accessory proteins BRID, ARD and BRID-ARD provided by the invention can effectively improve the HDR pathway DNA repair efficiency.
After photographing, 293T cells were digested and transferred to a flow analysis tube, washed 2 times with DPBS, and then analyzed for the proportion of GFP + fluorescent cells to the total number of cells using a flow analyzer, and quantitative statistics for the HDR-dependent DNA repair ratio were performed, with the analysis results shown in fig. 6 to 11. As can be seen from FIGS. 6 to 11, the three accessory proteins BRID, ARD and BRID-ARD provided by the present invention can effectively improve the DNA repair efficiency to 12% to 15%. However, the BRID fragment is the smallest and only has 96 amino acids, so that the fragment is suitable for being fused with Cas9 protein to be used as a new gene editor.
In the embodiment, 18bp I-sce1 endonuclease is inserted into a GFP gene fragment of a pDR-GFP report vector, and the gene editing vector provided by the invention can completely cut off an 18bp segment by taking 100bp donor homologous arm DNA at the 2 side of an I-sce1 site as an auxiliary, and realize the perfect repair of the fragment. This demonstrates that the gene editing system provided by the present invention can repair multi-base DNA variations. Similarly, under the guidance of the homology arm, the replacement and repair of large-fragment DNA can be realized in an HDR-dependent DNA repair mode.
Example 3
Construction of Gene editing vectors comprising BRID, ARD or BRID-ARD
Amplification of Cas9 fragment
The Cas9 fragment was amplified using the Lenti-sgRNA-CRISPR-v2 plasmid (purchased from Addgene, #52961) as a vector template.
The primer sequence is as follows:
BARD1-Cas9-5-for2:tataggcagtgggctgtcttcagaaatggacaagaagtacagcatcggc(SEQ ID NO:10);
BARD1-Cas9-5-rev2:taacgcgttcacttatcgtcatcgtctttgtaatcgtcgcctcccagctgagacag(SEQ ID NO:11)。
amplification was performed using the high fidelity PCR kit (Novozam, cat # P505-d1), the amplification system is shown in Table 5, and the amplification procedure is shown in Table 6:
TABLE 5 amplification System for amplification of Cas9 fragment
Composition of matter Dosage of
2×Phanta Max Buffer 25μl
dNTP(10mMeach) 1μl
Primer F (Primer Cas9-5-for2) 2μl
Primer R (Primer Cas9-5-rev2) 2μl
DNA template(plasmid,Lenti-sgRNA-CRISPR-v2) 1ng
Phanta Max Super-Fidelity DNA Polymerase (high Fidelity DNA Polymerase) 1μl
ddH2O Make up system to 50. mu.l
Table 6 amplification procedure for amplifying Cas9 fragment
Figure BDA0003421085810000042
The PCR product was purified using the kit (Novozan, cat # DC301-01) to obtain a Cas9 fragment of 4.1kb in size.
Second, connecting Cas9 fragment and accessory protein BRID
The electrophoresis chart of the accessory protein BRID is shown in FIG. 12, and the size is 288 bp.
The BRID-Cas9 fragment was amplified using a high fidelity PCR kit (Novozam, cat # P505-d1) using the purified Cas9 fragment and accessory protein BRID fragment as templates.
The primer sequence is as follows:
BARD1-Cas9-5-For1:gttctagaatgccaaagaagaagcggaag(SEQ ID NO:12)
BARD1-Cas9-5-rev2:gccgatgctgtacttcttgtccatttctgaagacagcccactgcctata(SEQ ID NO:13)。
the amplification system is shown in Table 7, and the amplification reaction procedure is identical to that shown in Table 6.
TABLE 7 amplification System for BRID-Cas9 fragments
Composition of matter Dosage of
2×Phanta Max Buffer 25μl
dNTP(10mM each) 1μl
Primer F (Primer Cas9-5-for1) 2μl
Primer R (Primer Cas9-5-rev1) 2μl
DNA template (plasmid, BRID, Cas9 fragment) 1ng
Phanta Max Super-Fidelity DNA Polymerase (high Fidelity DNA Polymerase) 1μl
ddH2O Make up system to 50. mu.l
The PCR product was purified using the kit (Novozan, cat # DC301-01) to obtain a BRID-Cas9 fragment of 4.4kb in size, and the electrophoretogram is shown in FIG. 13.
Thirdly, constructing a Lenti-U6-sgRNA-EF1a-BRID-Cas9 gene editing vector
The BRID-Cas9 fragment amplified and purified in step two and the Lenti-sgRNA-CRISPRv2 plasmid were digested simultaneously with Xba1+ Mlu1 endonuclease (NEB Co.) at 37 ℃ for2 hours, and the two DNA fragments were purified separately with a kit (Novozam, cat # DC 301-01). Ligation was performed by using T4 ligase (Invitrogen) according to the following ligation scheme (Table 8) and the ligation reaction was carried out at 25 ℃ for 5min or more to obtain a ligated product.
TABLE 8 ligation System of Lenti-U6-sgRNA-EF1a-BRID-Cas9
Composition of matter Dosage of
5×T4 Ligase Buffer 2μl
BRID-Cas9 fragment 90fmol
Lenti-sgRNA-CRISPRv2 plasmid 30fmol
T4 Ligase 1μl
ddH2O Make up system to 10. mu.l
The ligation product is transformed into DH5 competent bacteria (Prokinensis, Catharaceae, cat # TSC-C14), selected and cloned on an LB plate, and sequenced and identified to obtain a Lenti-U6-sgRNA-EF1a-BRID-Cas9 gene editing vector system.
In this gene editing vector system, sgRNA is transcribed by the U6 promoter, and the BRID-Cas9 protein is expressed by EF1 a. The BRID-Cas9 protein and sgRNA can be simultaneously expressed in cells, and the cleavage of target genes and the accurate repair of an HDR mode can be simultaneously realized. The DNA repair efficiency of the HDR mode of the gene editing vector system is about 16%, compared with the situation that the HDR efficiency of the homologous recombination in the traditional method is only 3%, the method can greatly improve the gene editing efficiency for accurate treatment of disease genes, and provides a new method and thought for gene and cell treatment.
According to the construction method, gene editing vectors Lenti-U6-sgRNA-EF1a-ARD-Cas9 and Lenti-U6-sgRNA-EF1a-BRID-ARD-Cas9 comprising accessory protein ARD and accessory protein BRID-ARD can also be obtained.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Ankelai (Chongqing) biomedical science and technology Co., Ltd
<120> auxiliary protein for improving DNA repair efficiency, gene editing vector and application thereof
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 288
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 1
atgccggata atcggcagcc gaggaaccgg cagccgagga tccgcaaacc taggaaaagt 60
ttgtttaatg atgcaggaaa caagaagaat tcaattaaaa tgtggtttag ccctcgaagt 120
aagaaagtca gatatgttgt gagtaaagct tcagtgcaaa cccagcctgc aataaaaaaa 180
gatccagaga agaatgaatc atcctcagct agccactgct cagtaatgaa cactgggcag 240
cgtagggatg gacctcttgt acttataggc agtgggctgt cttcagaa 288
<210> 2
<211> 534
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 2
atgccggata atcggcagcc gaggaaccgg cagccgagga tccgccccaa tatggctgtg 60
aaaagaaatc atagaggaga gactttgctc catattgctt ctattaaggg cgacatacct 120
tctgttgaat accttttaca aaatggaagt gatccaaatg ttaaagacca tgctggatgg 180
acaccattgc atgaagcttg caatcatggg cacctgaagg tagtggaatt attgctccag 240
cataaggcat tggtgaacac caccgggtat caaaatgact caccacttca cgatgcagcc 300
aagaatgggc atgtggatat agtcaagctg ttactttcct atggagcctc cagaaatgct 360
gttaatatat ttggtctgcg gcctgtcgat tatacagatg atgaaagtat gaaatcgcta 420
ttgctgctac cagagaagaa tgaatcatcc tcagctagcc actgctcagt aatgaacact 480
gggcagcgta gggatggacc tcttgtactt ataggcagtg ggctgtcttc agaa 534
<210> 3
<211> 684
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 3
atgccggata atcggcagcc gaggaaccgg cagccgagga tccgcaaacc taggaaaagt 60
ttgtttaatg atgcaggaaa caagaagaat tcaattaaaa tgtggtttag ccctcgaagt 120
aagaaagtca gatatgttgt gagtaaagct tcagtgcaaa cccagcctgc aataaaaaaa 180
gatatgaagc tgttgcccaa tatggctgtg aaaagaaatc atagaggaga gactttgctc 240
catattgctt ctattaaggg cgacatacct tctgttgaat accttttaca aaatggaagt 300
gatccaaatg ttaaagacca tgctggatgg acaccattgc atgaagcttg caatcatggg 360
cacctgaagg tagtggaatt attgctccag cataaggcat tggtgaacac caccgggtat 420
caaaatgact caccacttca cgatgcagcc aagaatgggc atgtggatat agtcaagctg 480
ttactttcct atggagcctc cagaaatgct gttaatatat ttggtctgcg gcctgtcgat 540
tatacagatg atgaaagtat gaaatcgcta ttgctgctac cagagaagaa tgaatcatcc 600
tcagctagcc actgctcagt aatgaacact gggcagcgta gggatggacc tcttgtactt 660
ataggcagtg ggctgtcttc agaa 684
<210> 4
<211> 5712
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 4
gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900
gtttaaactt aagcttggta cccaccatgc caaagaagaa gcggaaggtc agtatgccgg 960
ataatcggca gccgaggaac cggcagccga ggatccgcaa acctaggaaa agtttgttta 1020
atgatgcagg aaacaagaag aattcaatta aaatgtggtt tagccctcga agtaagaaag 1080
tcagatatgt tgtgagtaaa gcttcagtgc aaacccagcc tgcaataaaa aaagatccag 1140
agaagaatga atcatcctca gctagccact gctcagtaat gaacactggg cagcgtaggg 1200
atggacctct tgtacttata ggcagtgggc tgtcttcaga agattacaag gatgacgacg 1260
ataagtgact cgagtctaga gggcccgttt aaacccgctg atcagcctcg actgtgcctt 1320
ctagttgcca gccatctgtt gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg 1380
ccactcccac tgtcctttcc taataaaatg aggaaattgc atcgcattgt ctgagtaggt 1440
gtcattctat tctggggggt ggggtggggc aggacagcaa gggggaggat tgggaagaca 1500
atagcaggca tgctggggat gcggtgggct ctatggcttc tgaggcggaa agaaccagct 1560
ggggctctag ggggtatccc cacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 1620
tggttacgcg cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt 1680
tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 1740
tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg 1800
gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 1860
agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct 1920
cggtctattc ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg 1980
agctgattta acaaaaattt aacgcgaatt aattctgtgg aatgtgtgtc agttagggtg 2040
tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa agcatgcatc tcaattagtc 2100
agcaaccagg tgtggaaagt ccccaggctc cccagcaggc agaagtatgc aaagcatgca 2160
tctcaattag tcagcaacca tagtcccgcc cctaactccg cccatcccgc ccctaactcc 2220
gcccagttcc gcccattctc cgccccatgg ctgactaatt ttttttattt atgcagaggc 2280
cgaggccgcc tctgcctctg agctattcca gaagtagtga ggaggctttt ttggaggcct 2340
aggcttttgc aaaaagctcc cgggagcttg tatatccatt ttcggatctg atcaagagac 2400
aggatgagga tcgtttcgca tgattgaaca agatggattg cacgcaggtt ctccggccgc 2460
ttgggtggag aggctattcg gctatgactg ggcacaacag acaatcggct gctctgatgc 2520
cgccgtgttc cggctgtcag cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc 2580
cggtgccctg aatgaactgc aggacgaggc agcgcggcta tcgtggctgg ccacgacggg 2640
cgttccttgc gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt 2700
gggcgaagtg ccggggcagg atctcctgtc atctcacctt gctcctgccg agaaagtatc 2760
catcatggct gatgcaatgc ggcggctgca tacgcttgat ccggctacct gcccattcga 2820
ccaccaagcg aaacatcgca tcgagcgagc acgtactcgg atggaagccg gtcttgtcga 2880
tcaggatgat ctggacgaag agcatcaggg gctcgcgcca gccgaactgt tcgccaggct 2940
caaggcgcgc atgcccgacg gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc 3000
gaatatcatg gtggaaaatg gccgcttttc tggattcatc gactgtggcc ggctgggtgt 3060
ggcggaccgc tatcaggaca tagcgttggc tacccgtgat attgctgaag agcttggcgg 3120
cgaatgggct gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat 3180
cgccttctat cgccttcttg acgagttctt ctgagcggga ctctggggtt cgaaatgacc 3240
gaccaagcga cgcccaacct gccatcacga gatttcgatt ccaccgccgc cttctatgaa 3300
aggttgggct tcggaatcgt tttccgggac gccggctgga tgatcctcca gcgcggggat 3360
ctcatgctgg agttcttcgc ccaccccaac ttgtttattg cagcttataa tggttacaaa 3420
taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca ttctagttgt 3480
ggtttgtcca aactcatcaa tgtatcttat catgtctgta taccgtcgac ctctagctag 3540
agcttggcgt aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt 3600
ccacacaaca tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc 3660
taactcacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc 3720
cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct 3780
tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca 3840
gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac 3900
atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt 3960
ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg 4020
cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 4080
tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc 4140
gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc 4200
aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac 4260
tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt 4320
aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 4380
aactacggct acactagaag aacagtattt ggtatctgcg ctctgctgaa gccagttacc 4440
ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtttt 4500
tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc 4560
ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg 4620
agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca 4680
atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca 4740
cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag 4800
ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac 4860
ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc 4920
agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct 4980
agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc 5040
gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg 5100
cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc 5160
gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat 5220
tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag 5280
tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat 5340
aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg 5400
cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca 5460
cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga 5520
aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc 5580
ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag cggatacata 5640
tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg 5700
ccacctgacg tc 5712
<210> 5
<211> 5958
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 5
gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900
gtttaaactt aagcttggta cccaccatgc caaagaagaa gcggaaggtc agtatgccgg 960
ataatcggca gccgaggaac cggcagccga ggatccgccc caatatggct gtgaaaagaa 1020
atcatagagg agagactttg ctccatattg cttctattaa gggcgacata ccttctgttg 1080
aatacctttt acaaaatgga agtgatccaa atgttaaaga ccatgctgga tggacaccat 1140
tgcatgaagc ttgcaatcat gggcacctga aggtagtgga attattgctc cagcataagg 1200
cattggtgaa caccaccggg tatcaaaatg actcaccact tcacgatgca gccaagaatg 1260
ggcatgtgga tatagtcaag ctgttacttt cctatggagc ctccagaaat gctgttaata 1320
tatttggtct gcggcctgtc gattatacag atgatgaaag tatgaaatcg ctattgctgc 1380
taccagagaa gaatgaatca tcctcagcta gccactgctc agtaatgaac actgggcagc 1440
gtagggatgg acctcttgta cttataggca gtgggctgtc ttcagaagat tacaaggatg 1500
acgacgataa gtgactcgag tctagagggc ccgtttaaac ccgctgatca gcctcgactg 1560
tgccttctag ttgccagcca tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg 1620
aaggtgccac tcccactgtc ctttcctaat aaaatgagga aattgcatcg cattgtctga 1680
gtaggtgtca ttctattctg gggggtgggg tggggcagga cagcaagggg gaggattggg 1740
aagacaatag caggcatgct ggggatgcgg tgggctctat ggcttctgag gcggaaagaa 1800
ccagctgggg ctctaggggg tatccccacg cgccctgtag cggcgcatta agcgcggcgg 1860
gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt 1920
tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc 1980
gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg 2040
attagggtga tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga 2100
cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc 2160
ctatctcggt ctattctttt gatttataag ggattttgcc gatttcggcc tattggttaa 2220
aaaatgagct gatttaacaa aaatttaacg cgaattaatt ctgtggaatg tgtgtcagtt 2280
agggtgtgga aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa 2340
ttagtcagca accaggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag 2400
catgcatctc aattagtcag caaccatagt cccgccccta actccgccca tcccgcccct 2460
aactccgccc agttccgccc attctccgcc ccatggctga ctaatttttt ttatttatgc 2520
agaggccgag gccgcctctg cctctgagct attccagaag tagtgaggag gcttttttgg 2580
aggcctaggc ttttgcaaaa agctcccggg agcttgtata tccattttcg gatctgatca 2640
agagacagga tgaggatcgt ttcgcatgat tgaacaagat ggattgcacg caggttctcc 2700
ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa tcggctgctc 2760
tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg tcaagaccga 2820
cctgtccggt gccctgaatg aactgcagga cgaggcagcg cggctatcgt ggctggccac 2880
gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa gggactggct 2940
gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc ctgccgagaa 3000
agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg ctacctgccc 3060
attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg aagccggtct 3120
tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg aactgttcgc 3180
caggctcaag gcgcgcatgc ccgacggcga ggatctcgtc gtgacccatg gcgatgcctg 3240
cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact gtggccggct 3300
gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg ctgaagagct 3360
tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc ccgattcgca 3420
gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga gcgggactct ggggttcgaa 3480
atgaccgacc aagcgacgcc caacctgcca tcacgagatt tcgattccac cgccgccttc 3540
tatgaaaggt tgggcttcgg aatcgttttc cgggacgccg gctggatgat cctccagcgc 3600
ggggatctca tgctggagtt cttcgcccac cccaacttgt ttattgcagc ttataatggt 3660
tacaaataaa gcaatagcat cacaaatttc acaaataaag catttttttc actgcattct 3720
agttgtggtt tgtccaaact catcaatgta tcttatcatg tctgtatacc gtcgacctct 3780
agctagagct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg ttatccgctc 3840
acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg tgcctaatga 3900
gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg 3960
tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg 4020
cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg 4080
gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga 4140
aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg 4200
gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag 4260
aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc 4320
gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg 4380
ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt 4440
cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc 4500
ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc 4560
actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg 4620
tggcctaact acggctacac tagaagaaca gtatttggta tctgcgctct gctgaagcca 4680
gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc 4740
ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 4800
ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 4860
gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt 4920
aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt 4980
gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc 5040
gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg 5100
cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc 5160
gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg 5220
gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca 5280
ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga 5340
tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct 5400
ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg 5460
cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca 5520
accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata 5580
cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct 5640
tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact 5700
cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa 5760
acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc 5820
atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga 5880
tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga 5940
aaagtgccac ctgacgtc 5958
<210> 6
<211> 6132
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 6
gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900
gtttaaactt aagcttggta cccaccatgc caaagaagaa gcggaaggtc agtatgccgg 960
ataatcggca gccgaggaac cggcagccga ggatccgcaa acctaggaaa agtttgttta 1020
atgatgcagg aaacaagaag aattcaatta aaatgtggtt tagccctcga agtaagaaag 1080
tcagatatgt tgtgagtaaa gcttcagtgc aaacccagcc tgcaataaaa aaagatatga 1140
agctgttgcc caatatggct gtgaaaagaa atcatagagg agagactttg ctccatattg 1200
cttctattaa gggcgacata ccttctgttg aatacctttt acaaaatgga agtgatccaa 1260
atgttaaaga ccatgctgga tggacaccat tgcatgaagc ttgcaatcat gggcacctga 1320
aggtagtgga attattgctc cagcataagg cattggtgaa caccaccggg tatcaaaatg 1380
actcaccact tcacgatgca gccaagaatg ggcatgtgga tatagtcaag ctgttacttt 1440
cctatggagc ctccagaaat gctgttaata tatttggtct gcggcctgtc gattatacag 1500
atgatgaaag tatgaaatcg ctattgctgc taccagagaa gaatgaatca tcctcagcta 1560
gccactgctc agtaatgaac actgggcagc gtagggatgg acctcttgta cttataggca 1620
gtgggctgtc ttcagaaaag cgacctgccg ccacaaagaa ggctggacag gctaagaaga 1680
agaaatgact cgagtctaga gggcccgttt aaacccgctg atcagcctcg actgtgcctt 1740
ctagttgcca gccatctgtt gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg 1800
ccactcccac tgtcctttcc taataaaatg aggaaattgc atcgcattgt ctgagtaggt 1860
gtcattctat tctggggggt ggggtggggc aggacagcaa gggggaggat tgggaagaca 1920
atagcaggca tgctggggat gcggtgggct ctatggcttc tgaggcggaa agaaccagct 1980
ggggctctag ggggtatccc cacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 2040
tggttacgcg cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt 2100
tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 2160
tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg 2220
gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 2280
agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct 2340
cggtctattc ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg 2400
agctgattta acaaaaattt aacgcgaatt aattctgtgg aatgtgtgtc agttagggtg 2460
tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa agcatgcatc tcaattagtc 2520
agcaaccagg tgtggaaagt ccccaggctc cccagcaggc agaagtatgc aaagcatgca 2580
tctcaattag tcagcaacca tagtcccgcc cctaactccg cccatcccgc ccctaactcc 2640
gcccagttcc gcccattctc cgccccatgg ctgactaatt ttttttattt atgcagaggc 2700
cgaggccgcc tctgcctctg agctattcca gaagtagtga ggaggctttt ttggaggcct 2760
aggcttttgc aaaaagctcc cgggagcttg tatatccatt ttcggatctg atcaagagac 2820
aggatgagga tcgtttcgca tgattgaaca agatggattg cacgcaggtt ctccggccgc 2880
ttgggtggag aggctattcg gctatgactg ggcacaacag acaatcggct gctctgatgc 2940
cgccgtgttc cggctgtcag cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc 3000
cggtgccctg aatgaactgc aggacgaggc agcgcggcta tcgtggctgg ccacgacggg 3060
cgttccttgc gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt 3120
gggcgaagtg ccggggcagg atctcctgtc atctcacctt gctcctgccg agaaagtatc 3180
catcatggct gatgcaatgc ggcggctgca tacgcttgat ccggctacct gcccattcga 3240
ccaccaagcg aaacatcgca tcgagcgagc acgtactcgg atggaagccg gtcttgtcga 3300
tcaggatgat ctggacgaag agcatcaggg gctcgcgcca gccgaactgt tcgccaggct 3360
caaggcgcgc atgcccgacg gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc 3420
gaatatcatg gtggaaaatg gccgcttttc tggattcatc gactgtggcc ggctgggtgt 3480
ggcggaccgc tatcaggaca tagcgttggc tacccgtgat attgctgaag agcttggcgg 3540
cgaatgggct gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat 3600
cgccttctat cgccttcttg acgagttctt ctgagcggga ctctggggtt cgaaatgacc 3660
gaccaagcga cgcccaacct gccatcacga gatttcgatt ccaccgccgc cttctatgaa 3720
aggttgggct tcggaatcgt tttccgggac gccggctgga tgatcctcca gcgcggggat 3780
ctcatgctgg agttcttcgc ccaccccaac ttgtttattg cagcttataa tggttacaaa 3840
taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca ttctagttgt 3900
ggtttgtcca aactcatcaa tgtatcttat catgtctgta taccgtcgac ctctagctag 3960
agcttggcgt aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt 4020
ccacacaaca tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc 4080
taactcacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc 4140
cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct 4200
tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca 4260
gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac 4320
atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt 4380
ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg 4440
cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 4500
tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc 4560
gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc 4620
aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac 4680
tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt 4740
aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 4800
aactacggct acactagaag aacagtattt ggtatctgcg ctctgctgaa gccagttacc 4860
ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtttt 4920
tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc 4980
ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg 5040
agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca 5100
atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca 5160
cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag 5220
ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac 5280
ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc 5340
agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct 5400
agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc 5460
gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg 5520
cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc 5580
gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat 5640
tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag 5700
tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat 5760
aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg 5820
cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca 5880
cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga 5940
aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc 6000
ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag cggatacata 6060
tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg 6120
ccacctgacg tc 6132
<210> 7
<211> 7779
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 7
gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900
gtttaaactt aagcttggta cccaccatgc caaagaagaa gcggaaggtc agtatgccgg 960
ataatcggca gccgaggaac cggcagccga ggatccgctc cgggaacgag cctcgttccg 1020
cgcccgccat ggaaccggat ggtcgcggtg cctgggccca cagtcgcgcc gcgctcgacc 1080
gcctggagaa gctgctgcgc tgctcgcgtt gtactaacat tctgagagag cctgtgtgtt 1140
taggaggatg tgagcacatc ttctgtagta attgtgtaag tgactgcatt ggaactggat 1200
gtccagtgtg ttacaccccg gcctggatac aagacttgaa gataaataga caactggaca 1260
gcatgattca actttgtagt aagcttcgaa atttgctaca tgacaatgag ctgtcagatt 1320
tgaaagaaga taaacctagg aaaagtttgt ttaatgatgc aggaaacaag aagaattcaa 1380
ttaaaatgtg gtttagccct cgaagtaaga aagtcagata tgttgtgagt aaagcttcag 1440
tgcaaaccca gcctgcaata aaaaaagatg caagtgctca gcaagactca tatgaatttg 1500
tttccccaag tcctcctgca gatgtttctg agagggctaa aaaggcttct gcaagatctg 1560
gaaaaaagca aaaaaagaaa actttagctg aaatcaacca aaaatggaat ttagaggcag 1620
aaaaagaaga tggtgaattt gactccaaag aggaatctaa gcaaaagctg gtatccttct 1680
gtagccaacc atctgttatc tccagtcctc agataaatgg tgaaatagac ttactagcaa 1740
gtggctcctt gacagaatct gaatgttttg gaagtttaac tgaagtctct ttaccattgg 1800
ctgagcaaat agagtctcca gacactaaga gcaggaatga agtagtgact cctgagaagg 1860
tctgcaaaaa ttatcttaca tctaagaaat ctttgccatt agaaaataat ggaaaacgtg 1920
gccatcacaa tagactttcc agtcccattt ctaagagatg tagaaccagc attctgagca 1980
ccagtggaga ttttgttaag caaacggtgc cctcagaaaa tataccattg cctgaatgtt 2040
cttcaccacc ttcatgcaaa cgtaaagttg gtggtacatc agggaggaaa aacagtaaca 2100
tgtccgatga attcattagt ctttcaccag gtacaccacc ttctacatta agtagttcaa 2160
gttacaggcg agtgatgtct agtccctcag caatgaagct gttgcccaat atggctgtga 2220
aaagaaatca tagaggagag actttgctcc atattgcttc tattaagggc gacatacctt 2280
ctgttgaata ccttttacaa aatggaagtg atccaaatgt taaagaccat gctggatgga 2340
caccattgca tgaagcttgc aatcatgggc acctgaaggt agtggaatta ttgctccagc 2400
ataaggcatt ggtgaacacc accgggtatc aaaatgactc accacttcac gatgcagcca 2460
agaatgggca tgtggatata gtcaagctgt tactttccta tggagcctcc agaaatgctg 2520
ttaatatatt tggtctgcgg cctgtcgatt atacagatga tgaaagtatg aaatcgctat 2580
tgctgctacc agagaagaat gaatcatcct cagctagcca ctgctcagta atgaacactg 2640
ggcagcgtag ggatggacct cttgtactta taggcagtgg gctgtcttca gaacaacaga 2700
aaatgctcag tgagcttgca gtaattctta aggctaaaaa atatactgag tttgacagta 2760
cagtaactca tgttgttgtt cctggtgatg cagttcaaag taccttgaag tgtatgcttg 2820
ggattctcaa tggatgctgg attctaaaat ttgaatgggt aaaagcatgt ctacgaagaa 2880
aagtatgtga acaggaagaa aagtatgaaa ttcctgaagg tccacgcaga agcaggctca 2940
acagagaaca gctgttgcca aagctgtttg atggatgcta cttctatttg tggggaacct 3000
tcaaacacca tccaaaggac aaccttatta agctcgtcac tgcaggtggg ggccagatcc 3060
tcagtagaaa gcccaagcca gacagtgacg tgactcagac catcaataca gtcgcatacc 3120
atgcgagacc cgattctgat cagcgcttct gcacacagta tatcatctat gaagatttgt 3180
gtaattatca cccagagagg gttcggcagg gcaaagtctg gaaggctcct tcgagctggt 3240
ttatagactg tgtgatgtcc tttgagttgc ttcctcttga cagcaagcga cctgccgcca 3300
caaagaaggc tggacaggct aagaagaaga aatgactcga gtctagaggg cccgtttaaa 3360
cccgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc 3420
ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 3480
aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 3540
acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 3600
tggcttctga ggcggaaaga accagctggg gctctagggg gtatccccac gcgccctgta 3660
gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca 3720
gcgccctagc gcccgctcct ttcgctttct tcccttcctt tctcgccacg ttcgccggct 3780
ttccccgtca agctctaaat cgggggctcc ctttagggtt ccgatttagt gctttacggc 3840
acctcgaccc caaaaaactt gattagggtg atggttcacg tagtgggcca tcgccctgat 3900
agacggtttt tcgccctttg acgttggagt ccacgttctt taatagtgga ctcttgttcc 3960
aaactggaac aacactcaac cctatctcgg tctattcttt tgatttataa gggattttgc 4020
cgatttcggc ctattggtta aaaaatgagc tgatttaaca aaaatttaac gcgaattaat 4080
tctgtggaat gtgtgtcagt tagggtgtgg aaagtcccca ggctccccag caggcagaag 4140
tatgcaaagc atgcatctca attagtcagc aaccaggtgt ggaaagtccc caggctcccc 4200
agcaggcaga agtatgcaaa gcatgcatct caattagtca gcaaccatag tcccgcccct 4260
aactccgccc atcccgcccc taactccgcc cagttccgcc cattctccgc cccatggctg 4320
actaattttt tttatttatg cagaggccga ggccgcctct gcctctgagc tattccagaa 4380
gtagtgagga ggcttttttg gaggcctagg cttttgcaaa aagctcccgg gagcttgtat 4440
atccattttc ggatctgatc aagagacagg atgaggatcg tttcgcatga ttgaacaaga 4500
tggattgcac gcaggttctc cggccgcttg ggtggagagg ctattcggct atgactgggc 4560
acaacagaca atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc 4620
ggttcttttt gtcaagaccg acctgtccgg tgccctgaat gaactgcagg acgaggcagc 4680
gcggctatcg tggctggcca cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac 4740
tgaagcggga agggactggc tgctattggg cgaagtgccg gggcaggatc tcctgtcatc 4800
tcaccttgct cctgccgaga aagtatccat catggctgat gcaatgcggc ggctgcatac 4860
gcttgatccg gctacctgcc cattcgacca ccaagcgaaa catcgcatcg agcgagcacg 4920
tactcggatg gaagccggtc ttgtcgatca ggatgatctg gacgaagagc atcaggggct 4980
cgcgccagcc gaactgttcg ccaggctcaa ggcgcgcatg cccgacggcg aggatctcgt 5040
cgtgacccat ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg 5100
attcatcgac tgtggccggc tgggtgtggc ggaccgctat caggacatag cgttggctac 5160
ccgtgatatt gctgaagagc ttggcggcga atgggctgac cgcttcctcg tgctttacgg 5220
tatcgccgct cccgattcgc agcgcatcgc cttctatcgc cttcttgacg agttcttctg 5280
agcgggactc tggggttcga aatgaccgac caagcgacgc ccaacctgcc atcacgagat 5340
ttcgattcca ccgccgcctt ctatgaaagg ttgggcttcg gaatcgtttt ccgggacgcc 5400
ggctggatga tcctccagcg cggggatctc atgctggagt tcttcgccca ccccaacttg 5460
tttattgcag cttataatgg ttacaaataa agcaatagca tcacaaattt cacaaataaa 5520
gcattttttt cactgcattc tagttgtggt ttgtccaaac tcatcaatgt atcttatcat 5580
gtctgtatac cgtcgacctc tagctagagc ttggcgtaat catggtcata gctgtttcct 5640
gtgtgaaatt gttatccgct cacaattcca cacaacatac gagccggaag cataaagtgt 5700
aaagcctggg gtgcctaatg agtgagctaa ctcacattaa ttgcgttgcg ctcactgccc 5760
gctttccagt cgggaaacct gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg 5820
agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 5880
gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 5940
gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 6000
cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 6060
aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 6120
tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 6180
ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 6240
ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 6300
cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 6360
ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 6420
gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac agtatttggt 6480
atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 6540
aaacaaacca ccgctggtag cggttttttt gtttgcaagc agcagattac gcgcagaaaa 6600
aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa 6660
aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt 6720
ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac 6780
agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc 6840
atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt accatctggc 6900
cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata 6960
aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc 7020
cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc 7080
aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca 7140
ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa 7200
gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca 7260
ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt 7320
tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt 7380
tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg 7440
ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga 7500
tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc 7560
agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg 7620
acacggaaat gttgaatact catactcttc ctttttcaat attattgaag catttatcag 7680
ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg 7740
gttccgcgca catttccccg aaaagtgcca cctgacgtc 7779
<210> 8
<211> 24
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 8
aaacaagttc agcgtgtccg gcta 24
<210> 9
<211> 24
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 9
aaaatagccg gacacgctga actt 24
<210> 10
<211> 49
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 10
tataggcagt gggctgtctt cagaaatgga caagaagtac agcatcggc 49
<210> 11
<211> 56
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 11
taacgcgttc acttatcgtc atcgtctttg taatcgtcgc ctcccagctg agacag 56
<210> 12
<211> 29
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 12
gttctagaat gccaaagaag aagcggaag 29
<210> 13
<211> 49
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 13
gccgatgctg tacttcttgt ccatttctga agacagccca ctgcctata 49
<210> 14
<211> 10119
<212> DNA
<213> Artificial Sequence(2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 14
gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900
gtttaaactt aagcttggta cccaccatgc caaagaagaa gcggaaggtc agtatgccgg 960
ataatcggca gccgaggaac cggcagccga ggatccgcaa acctaggaaa agtttgttta 1020
atgatgcagg aaacaagaag aattcaatta aaatgtggtt tagccctcga agtaagaaag 1080
tcagatatgt tgtgagtaaa gcttcagtgc aaacccagcc tgcaataaaa aaagatccag 1140
agaagaatga atcatcctca gctagccact gctcagtaat gaacactggg cagcgtaggg 1200
atggacctct tgtacttata ggcagtgggc tgtcttcaga aatggacaag aagtacagca 1260
tcggcctgga catcggcacc aactctgtgg gctgggccgt gatcaccgac gagtacaagg 1320
tgcccagcaa gaaattcaag gtgctgggca acaccgaccg gcacagcatc aagaagaacc 1380
tgatcggagc cctgctgttc gacagcggcg aaacagccga ggccacccgg ctgaagagaa 1440
ccgccagaag aagatacacc agacggaaga accggatctg ctatctgcaa gagatcttca 1500
gcaacgagat ggccaaggtg gacgacagct tcttccacag actggaagag tccttcctgg 1560
tggaagagga taagaagcac gagcggcacc ccatcttcgg caacatcgtg gacgaggtgg 1620
cctaccacga gaagtacccc accatctacc acctgagaaa gaaactggtg gacagcaccg 1680
acaaggccga cctgcggctg atctatctgg ccctggccca catgatcaag ttccggggcc 1740
acttcctgat cgagggcgac ctgaaccccg acaacagcga cgtggacaag ctgttcatcc 1800
agctggtgca gacctacaac cagctgttcg aggaaaaccc catcaacgcc agcggcgtgg 1860
acgccaaggc catcctgtct gccagactga gcaagagcag acggctggaa aatctgatcg 1920
cccagctgcc cggcgagaag aagaatggcc tgttcggaaa cctgattgcc ctgagcctgg 1980
gcctgacccc caacttcaag agcaacttcg acctggccga ggatgccaaa ctgcagctga 2040
gcaaggacac ctacgacgac gacctggaca acctgctggc ccagatcggc gaccagtacg 2100
ccgacctgtt tctggccgcc aagaacctgt ccgacgccat cctgctgagc gacatcctga 2160
gagtgaacac cgagatcacc aaggcccccc tgagcgcctc tatgatcaag agatacgacg 2220
agcaccacca ggacctgacc ctgctgaaag ctctcgtgcg gcagcagctg cctgagaagt 2280
acaaagagat tttcttcgac cagagcaaga acggctacgc cggctacatt gacggcggag 2340
ccagccagga agagttctac aagttcatca agcccatcct ggaaaagatg gacggcaccg 2400
aggaactgct cgtgaagctg aacagagagg acctgctgcg gaagcagcgg accttcgaca 2460
acggcagcat cccccaccag atccacctgg gagagctgca cgccattctg cggcggcagg 2520
aagattttta cccattcctg aaggacaacc gggaaaagat cgagaagatc ctgaccttcc 2580
gcatccccta ctacgtgggc cctctggcca ggggaaacag cagattcgcc tggatgacca 2640
gaaagagcga ggaaaccatc accccctgga acttcgagga agtggtggac aagggcgctt 2700
ccgcccagag cttcatcgag cggatgacca acttcgataa gaacctgccc aacgagaagg 2760
tgctgcccaa gcacagcctg ctgtacgagt acttcaccgt gtataacgag ctgaccaaag 2820
tgaaatacgt gaccgaggga atgagaaagc ccgccttcct gagcggcgag cagaaaaagg 2880
ccatcgtgga cctgctgttc aagaccaacc ggaaagtgac cgtgaagcag ctgaaagagg 2940
actacttcaa gaaaatcgag tgcttcgact ccgtggaaat ctccggcgtg gaagatcggt 3000
tcaacgcctc cctgggcaca taccacgatc tgctgaaaat tatcaaggac aaggacttcc 3060
tggacaatga ggaaaacgag gacattctgg aagatatcgt gctgaccctg acactgtttg 3120
aggacagaga gatgatcgag gaacggctga aaacctatgc ccacctgttc gacgacaaag 3180
tgatgaagca gctgaagcgg cggagataca ccggctgggg caggctgagc cggaagctga 3240
tcaacggcat ccgggacaag cagtccggca agacaatcct ggatttcctg aagtccgacg 3300
gcttcgccaa cagaaacttc atgcagctga tccacgacga cagcctgacc tttaaagagg 3360
acatccagaa agcccaggtg tccggccagg gcgatagcct gcacgagcac attgccaatc 3420
tggccggcag ccccgccatt aagaagggca tcctgcagac agtgaaggtg gtggacgagc 3480
tcgtgaaagt gatgggccgg cacaagcccg agaacatcgt gatcgaaatg gccagagaga 3540
accagaccac ccagaaggga cagaagaaca gccgcgagag aatgaagcgg atcgaagagg 3600
gcatcaaaga gctgggcagc cagatcctga aagaacaccc cgtggaaaac acccagctgc 3660
agaacgagaa gctgtacctg tactacctgc agaatgggcg ggatatgtac gtggaccagg 3720
aactggacat caaccggctg tccgactacg atgtggacca tatcgtgcct cagagctttc 3780
tgaaggacga ctccatcgac aacaaggtgc tgaccagaag cgacaagaac cggggcaaga 3840
gcgacaacgt gccctccgaa gaggtcgtga agaagatgaa gaactactgg cggcagctgc 3900
tgaacgccaa gctgattacc cagagaaagt tcgacaatct gaccaaggcc gagagaggcg 3960
gcctgagcga actggataag gccggcttca tcaagagaca gctggtggaa acccggcaga 4020
tcacaaagca cgtggcacag atcctggact cccggatgaa cactaagtac gacgagaatg 4080
acaagctgat ccgggaagtg aaagtgatca ccctgaagtc caagctggtg tccgatttcc 4140
ggaaggattt ccagttttac aaagtgcgcg agatcaacaa ctaccaccac gcccacgacg 4200
cctacctgaa cgccgtcgtg ggaaccgccc tgatcaaaaa gtaccctaag ctggaaagcg 4260
agttcgtgta cggcgactac aaggtgtacg acgtgcggaa gatgatcgcc aagagcgagc 4320
aggaaatcgg caaggctacc gccaagtact tcttctacag caacatcatg aactttttca 4380
agaccgagat taccctggcc aacggcgaga tccggaagcg gcctctgatc gagacaaacg 4440
gcgaaaccgg ggagatcgtg tgggataagg gccgggattt tgccaccgtg cggaaagtgc 4500
tgagcatgcc ccaagtgaat atcgtgaaaa agaccgaggt gcagacaggc ggcttcagca 4560
aagagtctat cctgcccaag aggaacagcg ataagctgat cgccagaaag aaggactggg 4620
accctaagaa gtacggcggc ttcgacagcc ccaccgtggc ctattctgtg ctggtggtgg 4680
ccaaagtgga aaagggcaag tccaagaaac tgaagagtgt gaaagagctg ctggggatca 4740
ccatcatgga aagaagcagc ttcgagaaga atcccatcga ctttctggaa gccaagggct 4800
acaaagaagt gaaaaaggac ctgatcatca agctgcctaa gtactccctg ttcgagctgg 4860
aaaacggccg gaagagaatg ctggcctctg ccggcgaact gcagaaggga aacgaactgg 4920
ccctgccctc caaatatgtg aacttcctgt acctggccag ccactatgag aagctgaagg 4980
gctcccccga ggataatgag cagaaacagc tgtttgtgga acagcacaag cactacctgg 5040
acgagatcat cgagcagatc agcgagttct ccaagagagt gatcctggcc gacgctaatc 5100
tggacaaagt gctgtccgcc tacaacaagc accgggataa gcccatcaga gagcaggccg 5160
agaatatcat ccacctgttt accctgacca atctgggagc ccctgccgcc ttcaagtact 5220
ttgacaccac catcgaccgg aagaggtaca ccagcaccaa agaggtgctg gacgccaccc 5280
tgatccacca gagcatcacc ggcctgtacg agacacggat cgacctgtct cagctgggag 5340
gcgacgatta caaggatgac gacgataagt gagaattcgc acatacatga ggatcaccca 5400
tgtctgcagc tcgagtctag aaaacatgag gatcacccat gtctgcagta ttcccgggtt 5460
cattagatcc taaggtacct aattgcctag aaaacatgag gatcacccat gtctgcagct 5520
cgagtctaga aaacatgagg atcacccatg tctgcagtat tcccgggttc attagatcct 5580
aaggtaccta attgcctaga aaacatgagg atcacccatg tctgcagctc gagtctagaa 5640
aacatgagga tcacccatgt gtgcaccttg tcgacctcga gtctagaggg cccgtttaaa 5700
cccgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc 5760
ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 5820
aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 5880
acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 5940
tggcttctga ggcggaaaga accagctggg gctctagggg gtatccccac gcgccctgta 6000
gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca 6060
gcgccctagc gcccgctcct ttcgctttct tcccttcctt tctcgccacg ttcgccggct 6120
ttccccgtca agctctaaat cgggggctcc ctttagggtt ccgatttagt gctttacggc 6180
acctcgaccc caaaaaactt gattagggtg atggttcacg tagtgggcca tcgccctgat 6240
agacggtttt tcgccctttg acgttggagt ccacgttctt taatagtgga ctcttgttcc 6300
aaactggaac aacactcaac cctatctcgg tctattcttt tgatttataa gggattttgc 6360
cgatttcggc ctattggtta aaaaatgagc tgatttaaca aaaatttaac gcgaattaat 6420
tctgtggaat gtgtgtcagt tagggtgtgg aaagtcccca ggctccccag caggcagaag 6480
tatgcaaagc atgcatctca attagtcagc aaccaggtgt ggaaagtccc caggctcccc 6540
agcaggcaga agtatgcaaa gcatgcatct caattagtca gcaaccatag tcccgcccct 6600
aactccgccc atcccgcccc taactccgcc cagttccgcc cattctccgc cccatggctg 6660
actaattttt tttatttatg cagaggccga ggccgcctct gcctctgagc tattccagaa 6720
gtagtgagga ggcttttttg gaggcctagg cttttgcaaa aagctcccgg gagcttgtat 6780
atccattttc ggatctgatc aagagacagg atgaggatcg tttcgcatga ttgaacaaga 6840
tggattgcac gcaggttctc cggccgcttg ggtggagagg ctattcggct atgactgggc 6900
acaacagaca atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc 6960
ggttcttttt gtcaagaccg acctgtccgg tgccctgaat gaactgcagg acgaggcagc 7020
gcggctatcg tggctggcca cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac 7080
tgaagcggga agggactggc tgctattggg cgaagtgccg gggcaggatc tcctgtcatc 7140
tcaccttgct cctgccgaga aagtatccat catggctgat gcaatgcggc ggctgcatac 7200
gcttgatccg gctacctgcc cattcgacca ccaagcgaaa catcgcatcg agcgagcacg 7260
tactcggatg gaagccggtc ttgtcgatca ggatgatctg gacgaagagc atcaggggct 7320
cgcgccagcc gaactgttcg ccaggctcaa ggcgcgcatg cccgacggcg aggatctcgt 7380
cgtgacccat ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg 7440
attcatcgac tgtggccggc tgggtgtggc ggaccgctat caggacatag cgttggctac 7500
ccgtgatatt gctgaagagc ttggcggcga atgggctgac cgcttcctcg tgctttacgg 7560
tatcgccgct cccgattcgc agcgcatcgc cttctatcgc cttcttgacg agttcttctg 7620
agcgggactc tggggttcga aatgaccgac caagcgacgc ccaacctgcc atcacgagat 7680
ttcgattcca ccgccgcctt ctatgaaagg ttgggcttcg gaatcgtttt ccgggacgcc 7740
ggctggatga tcctccagcg cggggatctc atgctggagt tcttcgccca ccccaacttg 7800
tttattgcag cttataatgg ttacaaataa agcaatagca tcacaaattt cacaaataaa 7860
gcattttttt cactgcattc tagttgtggt ttgtccaaac tcatcaatgt atcttatcat 7920
gtctgtatac cgtcgacctc tagctagagc ttggcgtaat catggtcata gctgtttcct 7980
gtgtgaaatt gttatccgct cacaattcca cacaacatac gagccggaag cataaagtgt 8040
aaagcctggg gtgcctaatg agtgagctaa ctcacattaa ttgcgttgcg ctcactgccc 8100
gctttccagt cgggaaacct gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg 8160
agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 8220
gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 8280
gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 8340
cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 8400
aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 8460
tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 8520
ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 8580
ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 8640
cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 8700
ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 8760
gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac agtatttggt 8820
atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 8880
aaacaaacca ccgctggtag cggttttttt gtttgcaagc agcagattac gcgcagaaaa 8940
aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa 9000
aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt 9060
ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac 9120
agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc 9180
atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt accatctggc 9240
cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata 9300
aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc 9360
cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc 9420
aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca 9480
ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa 9540
gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca 9600
ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt 9660
tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt 9720
tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg 9780
ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga 9840
tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc 9900
agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg 9960
acacggaaat gttgaatact catactcttc ctttttcaat attattgaag catttatcag 10020
ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg 10080
gttccgcgca catttccccg aaaagtgcca cctgacgtc 10119

Claims (10)

1. An accessory protein for improving DNA repair efficiency is characterized in that the nucleotide sequence of the accessory protein is shown as SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3.
2. An expression plasmid comprising the helper protein of claim 1.
3. The expression plasmid of claim 2, wherein the nucleotide sequence of the expression plasmid is set forth as SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6.
4. A gene editing vector for increasing the efficiency of DNA repair comprising the helper protein of claim 1, a DNA editing protein, and a delivery vector.
5. The gene editing vector of claim 4, wherein the DNA editing protein comprises a Cas9 protein, a CasX protein, a Cas Φ protein, a Cas12 protein, a Cas14 protein.
6. The gene editing vector of claim 5, wherein the accessory protein is fused to the carbon terminus or nitrogen terminus of the DNA editing protein.
7. The gene editing vector of claim 6, wherein the delivery vector comprises a viroid vector, a Lentivirus, an adenovirus vector AAV, a retropmscv virus, a pCMV cloning vector, and an integration-defective viroid vector.
8. The gene editing vector of claim 7, wherein the integration defective viroid vector system comprises psPAX2-D64V-NC-MS2, pCMV-BRID-Cas9-6XMS2 plasmid.
9. Use of the accessory protein of claim 1, the expression plasmid of claim 2 or 3, or the gene editing vector of any one of claims 4 to 8 for the preparation of a product for increasing DNA repair efficiency.
10. Use according to claim 9, wherein the DNA repair is by homologous recombination.
CN202111562790.9A 2021-12-20 2021-12-20 Auxiliary protein for improving DNA repair efficiency, gene editing vector and application thereof Active CN114231568B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111562790.9A CN114231568B (en) 2021-12-20 2021-12-20 Auxiliary protein for improving DNA repair efficiency, gene editing vector and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111562790.9A CN114231568B (en) 2021-12-20 2021-12-20 Auxiliary protein for improving DNA repair efficiency, gene editing vector and application thereof

Publications (2)

Publication Number Publication Date
CN114231568A true CN114231568A (en) 2022-03-25
CN114231568B CN114231568B (en) 2023-08-04

Family

ID=80759369

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111562790.9A Active CN114231568B (en) 2021-12-20 2021-12-20 Auxiliary protein for improving DNA repair efficiency, gene editing vector and application thereof

Country Status (1)

Country Link
CN (1) CN114231568B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160160291A1 (en) * 2014-11-17 2016-06-09 Beth Israel Deaconess Medical Center, Inc. Compositions and methods for characterizing a dna repair variant polypeptide
WO2020041172A1 (en) * 2018-08-21 2020-02-27 The Jackson Laboratory Methods and compositions for recruiting dna repair proteins
CN111630175A (en) * 2018-01-22 2020-09-04 庆尚大学校产学协力团 Method for improving gene editing efficiency in plants based on homologous recombination

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160160291A1 (en) * 2014-11-17 2016-06-09 Beth Israel Deaconess Medical Center, Inc. Compositions and methods for characterizing a dna repair variant polypeptide
CN111630175A (en) * 2018-01-22 2020-09-04 庆尚大学校产学协力团 Method for improving gene editing efficiency in plants based on homologous recombination
WO2020041172A1 (en) * 2018-08-21 2020-02-27 The Jackson Laboratory Methods and compositions for recruiting dna repair proteins

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
JOSE E. MEZA等: "Mapping the Functional Domains of BRCA1——INTERACTION OF THE RING FINGER DOMAINS OF BRCA1 AND BARD1", THE JOURNAL OF BIOLOGICAL CHEMISTRY *
LINCHANG DAI等: "Structural insight into BRCA1-BARD1 complex recruitment to damaged chromatin", MOLECULAR CELL *
TECK-CHOON AYI等: "Conservation of function and primary structure in the BRCA1-associated RING domain (BARD1) protein", ONCOGENE *

Also Published As

Publication number Publication date
CN114231568B (en) 2023-08-04

Similar Documents

Publication Publication Date Title
KR101599062B1 (en) A host cell comprising a vector for production of proteins requiring gamma-carboxylation
CA2464239C (en) Psma antibodies and protein multimers
CA2612762C (en) Psma antibody-drug conjugates
US20040161776A1 (en) PSMA formulations and uses thereof
CN110511286B (en) RNA base editing molecule
CN102649947A (en) Cell strain for measuring bioactivity of GLP-1 and functional analogue thereof and application of cell strain
KR20030092051A (en) Nucleic acid vaccines for prevention of flaviviurs infection
CN106456574A (en) Honey bee mite disruptive compounds and methods of application
KR101201020B1 (en) Method for producing gamma-carboxylated proteins
US20040235011A1 (en) Production of multimeric proteins
KR102584628B1 (en) An engineered multicomponent system for the identification and characterization of T-cell receptors, T-cell antigens, and their functional interactions.
CN114616000A (en) Carrier compositions and methods for their use in treating lysosomal storage disorders
JP2023025182A (en) Engineered multicomponent systems for identification and characterization of t cell receptors and t cell antigens
CN113631033A (en) Treatment of diseases associated with ENPP1 or ENPP3 deficiency
KR20210137499A (en) Genome-Editing Birds
CN114231568B (en) Auxiliary protein for improving DNA repair efficiency, gene editing vector and application thereof
US6468754B1 (en) Vector and method for targeted replacement and disruption of an integrated DNA sequence
CN110714027A (en) Expression plasmid, cell strain for packaging second-generation adenovirus and application thereof
CN111057715A (en) Reverse genetic operation system for rescuing swine seneca virus based on double promoters and establishment method thereof
CN111690687B (en) Method and application for promoting skeletal muscle development
CN110423736B (en) Base editing tool, application thereof and method for editing wide-window and non-sequence preference bases in eukaryotic cells
CN112778425B (en) Preparation method of RNA gene editing system for reducing off-target effect
CN113862352B (en) Product for detecting liver cancer or prognosis of liver cancer based on PRSS35 pathway and liver cancer therapeutic agent based on PRSS35 pathway
US20230295668A1 (en) Methods and compositions for integration of a dna construct
CN113652412A (en) Method for preparing restriction enzyme products

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant