CN114231536B - Application of kiwi transcription factor AcARF1 gene in gray mold resistance - Google Patents
Application of kiwi transcription factor AcARF1 gene in gray mold resistance Download PDFInfo
- Publication number
- CN114231536B CN114231536B CN202111515888.9A CN202111515888A CN114231536B CN 114231536 B CN114231536 B CN 114231536B CN 202111515888 A CN202111515888 A CN 202111515888A CN 114231536 B CN114231536 B CN 114231536B
- Authority
- CN
- China
- Prior art keywords
- gene
- acarf1
- kiwi
- leu
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Botany (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
An application of kiwi transcription factor AcARF1 gene in resisting gray mold of kiwi fruits, wherein the coding sequence of the gene is shown as a nucleotide sequence shown in SEQ ID No.1 or the nucleotide sequence shown in SEQ ID No.1 is subjected to substitution, deletion and/or addition of one or more nucleotides, and can code the nucleotide sequence of protein with the same function. According to the invention, after the transcription factor AcARF1 of the auxin pathway of plant hormone is inhibited and expressed, experiments prove that the inhibition expression of the AcARF1 gene can enhance the resistance of the kiwi fruit to botrytis cinerea, and the specific expression is that compared with a contrast after virus inoculation, the transgenic fruit obtained by the invention has the advantages of reduced morbidity symptom, reduced morbidity rate and reduced germ content, and provides an important gene bank and a new germplasm resource for the disease-resistant breeding of the kiwi fruit.
Description
Technical Field
The invention relates to the technical field of plant genetic engineering, in particular to application of a kiwi fruit transcription factor AcARF1 gene in resisting gray mold of fruits.
Background
Kiwi (Actinidia Chinensis) is rich in nutrition and is in good standing of 'fruit king' and the like. China is the origin and main production area of kiwi fruits, according to the statistics of the Food and Agriculture Organization (FAO) of the United nations, the cultivation area of kiwi fruits in China in 2018 reaches 16.8 ten thousand hectares, and the annual yield is about 203.5 ten thousand tons (http:// www.fao.org/faostat/en/# data/QC). However, kiwi fruit is susceptible to decay and spoilage by a variety of fungal pathogens. The gray mold caused by Botrytis cinerea (Botrytis cinerea) usually causes more than 30% loss to the kiwi fruit industry, and seriously threatens the healthy development of the kiwi fruit industry. At present, researches on the gray mold of the kiwi fruit are mainly focused on the aspects of application prevention and control, disease-resistant physiology, disease-resistant protein screening and the like. The molecular mechanism research of the resistance of kiwi fruits to gray mold is relatively slow at home and abroad, and the functions and the regulation mechanism of related genes for resisting gray mold are not reported at present.
Disclosure of Invention
The invention aims to provide a new application of kiwi fruit AcARF1 gene, which can remarkably enhance the resistance of kiwi fruit to botrytis cinerea by inhibiting the expression of the gene.
The purpose of the invention is realized by the following technical scheme:
an application of kiwi transcription factor AcARF1 gene in resisting gray mold of kiwi fruits, wherein the coding sequence of the gene is shown as a nucleotide sequence shown in SEQ ID No.1 or the nucleotide sequence shown in SEQ ID No.1 is subjected to substitution, deletion and/or addition of one or more nucleotides, and can code the nucleotide sequence of protein with the same function.
Wherein the sequence length of SEQ ID NO.1 is 1599bp; composition 436A;341C;385G;437T; the percentage is 27.3 percent of A;21.3% of C;24.1% G;27.3% T. Molecular weight (kDa) ssDNA (single stranded): 494.53dsDNA (double stranded): 985.71.
The invention clones kiwi fruit AcARF1 gene according to red-yang kiwi fruit genome database, and adopts virus-induced gene silencing (VIGS) technology to identify the function of the gene in gray mold resistance.
The protein coded by the gene is applied to resisting gray mold of kiwi fruits, and the amino acid sequence is shown as SEQ ID NO.2 or the amino acid sequence shown as SEQ ID NO.2 is subjected to substitution, deletion and/or addition of one or more amino acids, and can express the amino acid sequence of the protein with the same function.
The invention also provides an engineering bacterium containing the kiwi transcription factor AcARF1 gene.
The invention has the following beneficial effects:
according to the invention, after the transcription factor AcARF1 of the auxin pathway of plant hormone is inhibited and expressed, experiments prove that the inhibition expression of the AcARF1 gene can enhance the resistance of the kiwi fruit to botrytis cinerea, and the specific expression is that compared with a contrast after virus inoculation, the transgenic fruit obtained by the invention has the advantages of reduced morbidity symptom, reduced morbidity rate and reduced germ content, and provides an important gene bank and a new germplasm resource for the disease-resistant breeding of the kiwi fruit.
Drawings
FIG. 1: the expression level of the AcARF1 gene in a control group after the kiwi fruit is infected by the transgenic agrobacterium tumefaciens is disclosed.
FIG. 2 is a schematic diagram: and (3) inhibiting the expression of AcARF1 and the phenotype observation that the kiwi fruits in the control group are infected by botrytis cinerea.
FIG. 3: and (4) carrying out statistics on the lesion area of kiwi fruits which are inhibited from expressing AcARF1 and a control group and infected by botrytis cinerea for 3 days and 6 days.
FIG. 4 is a schematic view of: inhibiting the Actinidia chinensis expressing AcARF1 and a control group from being infected by botrytis cinerea for 3 days and 6 days to change POD activity.
FIG. 5 is a schematic view of: inhibit SOD activity change of Actinidia chinensis expressing AcARF1 and a control group after being infected by Botrytis cinerea for 3 days and 6 days.
FIG. 6: inhibiting the expression of AcARF1 and kiwi fruits of a control group from being infected by botrytis cinerea for 3 days and 6 days, and changing the total phenol content.
Detailed Description
The following description of the embodiments of the present invention is provided to facilitate understanding of the present invention by those skilled in the art, but the present invention is not limited to the scope of the embodiments.
The vectors, the kiwi fruit variety 'Hongyang' kiwi fruit and various reagents related in the following examples are all sold in the market, and the kiwi fruit botrytis cinerea strain is provided by China agricultural microbial strain preservation management center (ACCC CAASF-122).
Example 1 obtaining of Actinidia transcription factor AcARF1 Gene
Total RNA from Kiwi fruit was extracted using RNAasso Plus Kits (Takara, japan), cDNA was synthesized by reverse transcription using TransScript All-in-One First-Strand cDNA Synthesis Supermix for qPCR (One-Step gDNA Removal) Kit (TransGen, china), and total RNA was extracted using Takara isoplus Kit. Adding liquid nitrogen into folium Actinidiae chinensis, grinding into powder, placing into 1.5ml centrifuge tube of RNase-free, adding 1ml fruittrate (Takara) reagent, reversing, mixing, centrifuging at 4 deg.C X12000 g for 5min, transferring 600 μ l supernatant into new tube, adding 600 μ l RNAioso Plus, standing for 5min, centrifuging at 4 deg.C X12000 g for 5min. Transferring the supernatant to a containerTransferring into a new tube, adding 300 μ l chloroform, reversing, mixing, standing for 5min, centrifuging at 4 deg.C for 12000g for 15min. Transferring the supernatant to a new centrifuge tube, adding 600. Mu.l of isopropanol, mixing uniformly, standing for 10min, and centrifuging at 4 ℃ for 12000g for 10min. The supernatant was discarded, and the precipitate was washed with 1ml of 75% ethanol at 4 ℃ and 7500g for 5min, and the supernatant was discarded and air-dried. Add 30. Mu.l RNase-free ddH 2 And dissolving the precipitate by using O. The resulting RNA was subjected to agarose gel electrophoresis and image analysis in a gel imaging system. Total RNA is used as an experimental template, and a full-scale gold TransScript OneStep gDNA Removal and cDNA Synthesis SuperMix kit is adopted to synthesize a reverse transcription product. Mu.l of 2 × ES Reaction Mix, 5. Mu.l of Total RNA, 2. Mu.l of RNase-free Water, 1. Mu.l of gDNA Remover, 1. Mu.l of EasyScript @ RT/RI Enzyme, 1. Mu.l of Oligo (dT) were added to a 1.5ml centrifuge tube in this order, incubated at 42 ℃ for 30min and then at 85 ℃ for 5s to terminate the Reaction. Storing in a refrigerator at-20 deg.C.
PCR amplification was performed using the following primer sequences:
an upstream primer: atgattacgtttagattaccgaagat (SEQ ID NO. 3)
A downstream primer: caatccccacacaattattcc (SEQ ID NO. 4)
The amplified product is connected to a cloning vector pMD-19T simple vector (TransGen, china), escherichia coli Top10 is transformed, positive clones are screened for sequencing verification, the nucleotide sequence is shown as SEQ ID NO.1, the obtained gene is translated into an amino acid sequence by using ORF Finder software, and the amino acid sequence is shown as SEQ ID NO. 2.
The nucleotide sequence shown in SEQ ID NO.1 is AcARF1 sequence information (CDS) of the red kiwi fruit. The sequence length is 1599bp. Consists of the following components: 436A;341C;385G;437T. The percentage is 27.3 percent of A;21.3% C;24.1% G;27.3% T. Molecular weight (kDa) ssDNA (single stranded): 494.53dsDNA (double stranded): 985.71.
The coding amino acid sequence information shown in SEQ ID NO. 2: translation of DNAMAN1 (1-1599) general codeTotal amino acid number:532, MW =59449; max ORF starts at AA pos 1 (may be DNA pos 1) for 532AA (1596 bases), MW =59449ORIGIN.
Example 2 genetic transformation of the AcARF1 Gene
1. Construction of an expression vector:
cloning of gene interference fragments by PCR: PCR amplification was performed using a Phanta Super-Fidelity DNA Polymerase kit using kiwi cDNA as a template. The PCR reaction system and the reaction procedure are shown in Table 1 and Table 2, respectively, and after completion of the PCR reaction, the agarose gel electrophoresis was performed and the analysis was performed by observation in a gel imaging system. And cutting and recovering the correctly amplified band, detecting by agarose gel electrophoresis, and storing the recovered fragment at-20 ℃. The electrophoresis detection strip is single, the gel cutting recovers a target gene fragment, the fragment length is 395bp, and as shown in a SEQ ID NO.7 sequence, the following primers are adopted:
upstream primer ccatccatccatcttcacc (SEQ ID NO. 5)
The downstream primer acgggggaaattgtatccctc (SEQ ID NO. 6).
TABLE 1 PCR reaction System
| Name (R) | Amount of the |
| cDNA | 2μl |
| 5×SF Buffer | 5μl |
| ZoCCoAOMT-Ford (short primer) | 1μl |
| ZoCCoAOMT-Rev (short primer) | 1μl |
| 10Mm dNTPMix | 0.5μl |
| Phanta Super-Fidelity DNA Polymerase | 0.5μl |
| ddH 2 O | 15μl |
| Total Volume | 25μl |
TABLE 2 PCR reaction conditions
The gene fragment shown in SEQ ID NO.7 of the AcARF1 is connected to a cloning vector pMD-19B (all-type gold), an AcARF1 gene fragment recovered by double digestion of XbaI/BamHI and a pTRV2 vector, the gene fragment and a vector skeleton are purified and recovered, after the enzyme ligation of T4DNA ligase, escherichia coli DH5 alpha is transformed, a Kana resistance plate is coated, PCR detection is carried out on resistant colonies, PCR positive bacteria samples are selected from the resistant colonies, plasmids are extracted, and universal primers on the vector are adopted: RV-XIAYOU (5 'aacctaaaacttcagacacgg 3') (SEQ ID NO. 8) for sequencing. The sequencing result is consistent with the reference sequence. The constructed AcARF1-pTRV2 vector and pTRV1 were ligated in the same manner as described in 1:1 proportion of the mixture to transform agrobacterium GV301.
2. Analysis of disease resistance
130 days of the agrobacterium GV301 is transformed and pollinated instantly by an injection mode, and then the size of the kiwi fruit is uniform, no damage is caused, and no plant diseases and insect pests are generated in a near-mature state of 'red sun' kiwi fruit. The material was then drawn around the injection hole at a fixed time each day and stored in a-80 ℃ freezer. The expression level of AcARF1 is detected by adopting qRT-PCR technology, and the gene expression level is obviously reduced after 7 days (figure 1). Subsequently, 10. Mu.L of Botrytis cinerea (104-106/mL) spore suspension and sterile water are adopted to infect the transgenic groups and the control group of kiwi fruits respectively. The statistics of the phenotypic observation (figure 2) and the lesion area (figure 3) show that the two groups of kiwi fruits have obvious difference in rot degree when the botrytis cinerea is infected for 3 days; large-area rot occurs around the kiwi fruit wound of the control group at 6 days, and relatively slight rot symptoms are shown at the fruit wound with silent AcARF 1. Further detecting the content changes of defensive enzyme and resistant substance of the transgenic and control group kiwi fruits in the botrytis cinerea infection process (figure 4-6). Measuring peroxidase POD activity by guaiacol method, and taking optical density increase of 470nm per minute as 1 enzyme activity unit; measuring the activity of superoxide dismutase (SOD) by adopting a Nitrobluetetrazolium (NBT) photochemical reduction method, wherein the enzyme dosage for inhibiting 50% of NBT photochemical reduction is 1 enzyme activity unit; the total phenol content was determined by the forskol method. The results show that the POD, SOD and total phenol contents are increased after AcARF1 is silenced and are obviously increased 3 days after the botrytis cinerea is infected. These results show that botrytis cinerea infection can induce the increase of the POD, SOD enzyme activity and total phenol content of kiwi fruits, and the increase of related physiological indexes of AcARF1 silence expression fruits infected by botrytis cinerea is more obvious.
Sequence listing
<110> Chongqing literature and literature college
<120> application of kiwi fruit transcription factor AcARF1 gene in gray mold resistance
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1599
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgattacgt ttatagattc gaaagataaa attagggaaa ctgagaaacg cttagattct 60
caattatggc atgcctgtgc cggtagtatg gtgcaaatgc caccggtgag ttgtaaggtg 120
ttctacttcc cccaggggca tgctgagcat gcatgtggaa atgttgattt taggaattgc 180
cctagggttc cttcttatat agcttgtcgg gtttctgcta tcaaattcat ggctgattct 240
gagactgatg agaccctcct tgcaaaggat gttcatggag aaacttggaa attccgtcat 300
atttataggg gaacaccgag gcgtcatctt ttgacgacag ggtggagcac ttttgtgaac 360
cacaagaagc ttgttgcggg ggattcaatt gtgttcttga gggctgaaaa tggggatctt 420
tgcattggaa tccgacgggc gaagacggga attggagctg gtggtggaag ttcgatggga 480
agggagaaag tgaagcctga atcggttatc gaagctgtga cactggcagc caatggacat 540
ccatttgagg ttgtttacta tcctcgagct agtactccag aattctgtgt gaaggcctca 600
cttgtgaaag cagcattgca aatccgttgg tgcgcgggca taagattcag gatgcccttt 660
gaaactgagg attcttcgcc tataagttgg ttcatgggaa ccatatcttc cgttcaggtt 720
gccgatcctg ttcgctggcc tgcttcgcct tggagacttc tccaggtgac atgggatgag 780
cctaatttgc ttcaaaatat caaacatgta aacccatggc tggtggaatt ggtgtcaaac 840
gtgccatcca tccatctttc accattttca ccaccgcgga agaagttgag actaccacaa 900
cacccagatt tccctctcga tggtcaactt ccaataccga cattttcctg caacctcctt 960
gggcccacca gccccctcag ttgtcttctc gacaatgctc ctgctggcat gcagggagcc 1020
aggcatgctc aatatggttt atctttgaca gatctccacc tcaataaact gcactcaggt 1080
tttgagaata attcttgctt gctaagtatt gggaattcta ccgacactcc aaagaaacta 1140
gacaatggaa aacgattgca atttgtgctt tttggtcaac caattctaac tgagcaacag 1200
atcaacctca gctgctccga ggatacaatt tcccccgttg gtactggaaa taagaactac 1260
tcatcctgtg aagggcttca atggtataaa gaaaatcaac aagaaacaca gtccagaatg 1320
gaaactggtc attgtaaggt cttcagggac tcggaggacg tgggtcgtac tctcgatctt 1380
tctgcgctcc gttcttatga agaattgtac agaaagctag caaacatgtt tggcgttgaa 1440
caaaccgaaa tgcttaacca tgtgctctac tgggatgcaa ctgattctat caagcagatc 1500
ggagatgaac cattcagtga ttttatgaaa acagcaaaaa gattgacaat tctaacagac 1560
ttaagcagca acaatatagg aatgttgagt ggggattga 1599
<210> 2
<211> 532
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Ile Thr Phe Ile Asp Ser Lys Asp Lys Ile Arg Glu Thr Glu Lys
1 5 10 15
Arg Leu Asp Ser Gln Leu Trp His Ala Cys Ala Gly Ser Met Val Gln
20 25 30
Met Pro Pro Val Ser Cys Lys Val Phe Tyr Phe Pro Gln Gly His Ala
35 40 45
Glu His Ala Cys Gly Asn Val Asp Phe Arg Asn Cys Pro Arg Val Pro
50 55 60
Ser Tyr Ile Ala Cys Arg Val Ser Ala Ile Lys Phe Met Ala Asp Ser
65 70 75 80
Glu Thr Asp Glu Thr Leu Leu Ala Lys Asp Val His Gly Glu Thr Trp
85 90 95
Lys Phe Arg His Ile Tyr Arg Gly Thr Pro Arg Arg His Leu Leu Thr
100 105 110
Thr Gly Trp Ser Thr Phe Val Asn His Lys Lys Leu Val Ala Gly Asp
115 120 125
Ser Ile Val Phe Leu Arg Ala Glu Asn Gly Asp Leu Cys Ile Gly Ile
130 135 140
Arg Arg Ala Lys Thr Gly Ile Gly Ala Gly Gly Gly Ser Ser Met Gly
145 150 155 160
Arg Glu Lys Val Lys Pro Glu Ser Val Ile Glu Ala Val Thr Leu Ala
165 170 175
Ala Asn Gly His Pro Phe Glu Val Val Tyr Tyr Pro Arg Ala Ser Thr
180 185 190
Pro Glu Phe Cys Val Lys Ala Ser Leu Val Lys Ala Ala Leu Gln Ile
195 200 205
Arg Trp Cys Ala Gly Ile Arg Phe Arg Met Pro Phe Glu Thr Glu Asp
210 215 220
Ser Ser Pro Ile Ser Trp Phe Met Gly Thr Ile Ser Ser Val Gln Val
225 230 235 240
Ala Asp Pro Val Arg Trp Pro Ala Ser Pro Trp Arg Leu Leu Gln Val
245 250 255
Thr Trp Asp Glu Pro Asn Leu Leu Gln Asn Ile Lys His Val Asn Pro
260 265 270
Trp Leu Val Glu Leu Val Ser Asn Val Pro Ser Ile His Leu Ser Pro
275 280 285
Phe Ser Pro Pro Arg Lys Lys Leu Arg Leu Pro Gln His Pro Asp Phe
290 295 300
Pro Leu Asp Gly Gln Leu Pro Ile Pro Thr Phe Ser Cys Asn Leu Leu
305 310 315 320
Gly Pro Thr Ser Pro Leu Ser Cys Leu Leu Asp Asn Ala Pro Ala Gly
325 330 335
Met Gln Gly Ala Arg His Ala Gln Tyr Gly Leu Ser Leu Thr Asp Leu
340 345 350
His Leu Asn Lys Leu His Ser Gly Phe Glu Asn Asn Ser Cys Leu Leu
355 360 365
Ser Ile Gly Asn Ser Thr Asp Thr Pro Lys Lys Leu Asp Asn Gly Lys
370 375 380
Arg Leu Gln Phe Val Leu Phe Gly Gln Pro Ile Leu Thr Glu Gln Gln
385 390 395 400
Ile Asn Leu Ser Cys Ser Glu Asp Thr Ile Ser Pro Val Gly Thr Gly
405 410 415
Asn Lys Asn Tyr Ser Ser Cys Glu Gly Leu Gln Trp Tyr Lys Glu Asn
420 425 430
Gln Gln Glu Thr Gln Ser Arg Met Glu Thr Gly His Cys Lys Val Phe
435 440 445
Arg Asp Ser Glu Asp Val Gly Arg Thr Leu Asp Leu Ser Ala Leu Arg
450 455 460
Ser Tyr Glu Glu Leu Tyr Arg Lys Leu Ala Asn Met Phe Gly Val Glu
465 470 475 480
Gln Thr Glu Met Leu Asn His Val Leu Tyr Trp Asp Ala Thr Asp Ser
485 490 495
Ile Lys Gln Ile Gly Asp Glu Pro Phe Ser Asp Phe Met Lys Thr Ala
500 505 510
Lys Arg Leu Thr Ile Leu Thr Asp Leu Ser Ser Asn Asn Ile Gly Met
515 520 525
Leu Ser Gly Asp
530
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atgattacgt ttatagattc gaaagat 27
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
acgggggaaa ttgtatcctc 20
<210> 7
<211> 395
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ccatccatcc atctttcacc attttcacca ccgcggaaga agttgagact accacaacac 60
ccagatttcc ctctcgatgg tcaacttcca ataccgacat tttcctgcaa cctccttggg 120
cccaccagcc ccctcagttg tcttctcgac aatgctcctg ctggcatgca gggagccagg 180
catgctcaat atggtttatc tttgacagat ctccacctca ataaactgca ctcaggtttt 240
gagaataatt cttgcttgct aagtattggg aattctaccg acactccaaa gaaactagac 300
aatggaaaac gattgcaatt tgtgcttttt ggtcaaccaa ttctaactga gcaacagatc 360
aacctcagct gctccgagga tacaatttcc cccgt 395
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
Claims (2)
1. An application of a kiwi fruit transcription factor AcARF1 gene in gray mold resistance of kiwi fruits, wherein a coding sequence of the gene is shown as SEQ ID No.1, and the resistance of kiwi fruits to gray mold is enhanced by inhibiting and expressing the AcARF1 gene.
2. An engineering bacterium containing kiwi transcription factor AcARF1 gene, which is characterized in that: the coding sequence of the gene is shown in SEQ ID NO. 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111515888.9A CN114231536B (en) | 2021-12-13 | 2021-12-13 | Application of kiwi transcription factor AcARF1 gene in gray mold resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111515888.9A CN114231536B (en) | 2021-12-13 | 2021-12-13 | Application of kiwi transcription factor AcARF1 gene in gray mold resistance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114231536A CN114231536A (en) | 2022-03-25 |
| CN114231536B true CN114231536B (en) | 2023-04-11 |
Family
ID=80755143
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111515888.9A Active CN114231536B (en) | 2021-12-13 | 2021-12-13 | Application of kiwi transcription factor AcARF1 gene in gray mold resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114231536B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114671933B (en) * | 2022-05-26 | 2022-08-05 | 西北农林科技大学深圳研究院 | NAC transcription factor and application thereof in disease resistance regulation of kiwi fruits |
| CN115976050A (en) * | 2022-11-16 | 2023-04-18 | 西北农林科技大学 | Kiwi fruit infectious disease gene and applicable VIGS silencing system construction |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110791505B (en) * | 2019-11-19 | 2020-12-01 | 安徽农业大学 | Kiwi fruit canker resistance gene AcLac35 and application thereof |
| CN113604490B (en) * | 2021-08-12 | 2023-10-31 | 安徽农业大学 | Kiwi fruit canker susceptibility gene AcBXL1 and application thereof |
-
2021
- 2021-12-13 CN CN202111515888.9A patent/CN114231536B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114231536A (en) | 2022-03-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114231536B (en) | Application of kiwi transcription factor AcARF1 gene in gray mold resistance | |
| Bézier et al. | Study of defense-related gene expression in grapevine leaves and berries infected with Botrytis cinerea | |
| CN106244599B (en) | A kind of 1 family gene PnPR1-2 of Radix Notoginseng pathogenesis-related proteins and application | |
| Huang et al. | Genome-wide identification and expression analysis of the apple ASR gene family in response to Alternaria alternata f. sp. mali | |
| CN103194457B (en) | Lilium regale germin-like protein gene LrGLP2 and application thereof | |
| CN101736024A (en) | Thaumatin-like protein gene PpTLP from pyrus pyrifolia nakai with antifungal activity and application | |
| CN116970054A (en) | Ulcer disease-inducing transcription factor AcWRKY76 and application thereof | |
| CN106754994B (en) | Fusarium graminearum glucan synthase gene GLS and application thereof | |
| CN104878019A (en) | Yangbi walnut germin-like protein gene JsGLP1 and application thereof | |
| CN110656118A (en) | Geranium strictipes inulin degrading enzyme gene Tk1-FEH and application thereof | |
| CN103937819B (en) | A kind of lilium regale wilson glutathione S-transferase gene LrGSTL1 and application thereof | |
| Bagnoli et al. | Molecular cloning, characterisation and expression of two catalase genes from peach | |
| CN107267525B (en) | Application of panax notoginseng polygalacturonase inhibitor protein gene PnPGIP | |
| CN111635905B (en) | Jujube witches broom phytoplasma effector gene Zaofeng6 and application | |
| CN111808832B (en) | Gene of cation transfer ATP enzyme of rhizoctonia solani, fragment Rscta thereof and application | |
| CN104131014B (en) | Lilium regale wilson class sprouts the application of fibroin gene LrGLP1 | |
| CN115125257A (en) | Application of rice A9IP2 gene in improving rice blast resistance | |
| CN110894502B (en) | Tomato SlCYP90B3 gene and application thereof | |
| CN108164589A (en) | One kind is from cotton plant fungal disease resistance Protein G hGLP2 and its encoding gene and application | |
| CN110564702B (en) | Chilo suppressalis growth and development related protein ND, coding gene, dsRNA interference sequence and application thereof | |
| CN114525298A (en) | Application of soybean protein GmFVE in plant salt tolerance regulation | |
| AU2021101115A4 (en) | SOD protein gene sequence of Prunus pedunculatacv.Wulate and application | |
| CN104878027A (en) | Juglans sigillata Dode ribonuclease gene JsRNase and application thereof | |
| CN111560056A (en) | Wheat stripe rust resistance related protein TaERF8 and coding gene and application thereof | |
| CN109295068A (en) | A kind of Radix Notoginseng class sweet protein gene PnTLP2 and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |