CN114231503A

CN114231503A - Chicken infectious bursal disease virus and serum 4 type avian adenovirus bivalent inactivated vaccine as well as preparation method and application thereof

Info

Publication number: CN114231503A
Application number: CN202111349642.9A
Authority: CN
Inventors: 潘青; 王笑梅; 高玉龙; 祁小乐; 崔红玉; 刘爱晶; 刘长军; 张艳萍; 李凯; 高立
Original assignee: Harbin Veterinary Research Institute of CAAS
Current assignee: Harbin Veterinary Research Institute of CAAS
Priority date: 2021-11-15
Filing date: 2021-11-15
Publication date: 2022-03-25

Abstract

The invention discloses a chicken infectious bursal disease virus and serum type 4 avian adenovirus bivalent inactivated vaccine, a preparation method and application thereof. On the basis of a reverse genetic vaccine strain rHN20 of avian adenovirus serotype 4, a VP2 gene of Infectious Bursal Disease Virus (IBDV) super-virulent is inserted into a natural nucleotide deletion site with the length of 1966-bp between open reading frames 42 and 43 of an FAdV-4 genome to obtain a recombinant avian adenovirus serotype 4 (FAdV-4) vaccine strain for expressing chicken infectious bursal disease virus (vIBDV) VP2 protein, which is named as rHN 20-vIBDV-VP 2. The vaccine strain is prepared into a bivalent inactivated vaccine, and immune protection experiments prove that SPF chickens inoculated with rHN20-vvIBDV-VP2 bivalent inactivated vaccine can completely resist the virus attack infection of FAdV-4 virulent strains and IBDV super-virulent strains, and prove that the rHN20-vvIBDV-VP2 bivalent inactivated vaccine has very good immunogenicity. The invention provides an effective technical means for preventing and treating the chicken hydropericardium-hepatitis syndrome and the chicken infectious bursal disease.

Description

Chicken infectious bursal disease virus and serum 4 type avian adenovirus bivalent inactivated vaccine as well as preparation method and application thereof

Technical Field

The invention relates to a recombinant serum 4-type avian adenovirus vaccine strain for expressing chicken infectious bursal disease virus (vvIBDV) VP2 protein, a construction method and application thereof, and an inactivated vaccine prepared from the vaccine strain. The invention belongs to the technical field of medicines.

Background

Avian adenoviruses (FAdVs) are widely prevalent all over the world, and epidemic strains mainly comprise serotypes FAdV-4, FAdV-11, FAdV-1, FAdV-8a, FAdV-8b and the like, so that serious economic loss is caused to the poultry breeding industry. FAdVs infection was first discovered in the ankara region of pakistan in 1987, and the disease was therefore also called "ankara" and was later reported in different countries and regions, china, japan, korea, india, the usa, canada, etc. FAdVs can be divided into 3 groups depending on the group-specific antigen: group I includes traditional adenoviruses obtained from chickens, turkeys, geese and other birds; group II is mainly adenovirus related to hemorrhagic enteritis and marble spleen disease of turkey; group III is primarily a class of viruses associated with egg drop syndrome virus. Group I adenoviruses can be further divided into 5 serotypes (A-E) according to molecular structure and 12 serotypes (1-7, 8a, 8b, 9-11) according to serotype. The pathogenicity of the avian adenovirus group I is greatly different, and pathogenic strains mainly cause pericardial effusion, inclusion body hepatitis, muscular stomach erosion and other symptoms; non-pathogenic strains can persistently infect and replicate in poultry bodies, and have the potential of developing vaccine vectors.

Since 06 months in 2015, chicken pericardial effusion-hepatitis syndrome (HHS) caused by highly pathogenic serum type 4 avian adenovirus (FAdV-4) infection is suddenly epidemic in China's provinces such as Jiangsu, Shandong, Heilongjiang, Hubei and the like, the death rate is up to 30% -100%, huge economic loss is caused to the poultry breeding industry in China, and huge threat and challenge are formed to the green and healthy breeding of poultry in China. FAdV-4 infected birds die acutely, with the peak of death concentrated within 1 week, and the dead birds develop typical pericardial effusion and inclusion body hepatitis symptoms. In addition, infection with FAdV-4 can lead to immunosuppression of the host, and the resulting immune failure, secondary infection, and mixed infection further exacerbate the harm of HHS. The infected hosts of the FAdV-4 are very wide, not only laying hens, broiler chickens and broiler breeders bred in a large scale but also ducks, geese and various wild birds can be infected, the diversity of the FAdV-4 infected hosts increases the potential risk of cross-host transmission, and the difficulty is increased for scientific prevention and control of the disease. In addition, FAdV-4 can be horizontally transmitted through respiratory tracts and the like and can also be vertically transmitted through chicken embryos, so that the production of the chicken embryo source veterinary vaccine is threatened, and part of human vaccines are also produced through the chicken embryos, so that the vaccine also has a certain potential threat to the public health safety of human beings.

Infectious Bursal Disease (IBD) is an acute, highly contagious disease caused by Infectious Bursal Disease Virus (IBDV). The disease was discovered in the region of ganburo, tera, usa in 1957 and is therefore also known as ganburo disease. The disease can cause the tissue damage and the immunosuppression of infected chickens, influence the growth and development, the production performance and the vaccine immune effect of sick chickens, lead the chickens to be easy to be complicated or secondary to other diseases, lead the death rate to be increased, lead the meat to be reduced and further cause serious economic loss. Up to now, IBDV has been classified by the world animal health Organization (OIE) as one of the important poultry diseases. IBDV can be classified into classical strains, antigen-variant strains and super virulent strains according to pathogenicity and antigen variation analysis. IBDV mainly infects young chickens of 3-8 weeks old, and the infected chickens mostly show acute morbidity, and the course of disease is short, and generally the chickens fail and die 2-3 days after infection, and the dead peak is reached 5-7 days after infection, and then the infected chickens are tolerant, generate antibodies in vivo, recover apparent health, but have immune suppression. The disease is mainly manifested as mental depression, anorexia, feather irregularity, white diarrhea, etc. Typical pathological anatomy symptoms can show large congestion of bursa of fabricius in early infection stage, purple black in severe cases, and bursa atrophy in later infection stage. Swollen kidney, bleeding from papilla of glandular stomach, and bleeding from banding in pectoralis and leg muscles. The pathological examination shows that the bursa of Fabricius has structural damage, the bursa of Fabricius has follicular and splenic perivascular bridge intrathecal B lymphocyte disintegration and necrosis, and bursa of Fabricius has heterophilic cell infiltration. IBDV is a capsuloless, unilamellar capsid, regular icosahedral virus with a diameter of between 55 and 60nm arranged in lattice form in infected cells. The virus belongs to the family of Birnaviridae, the genus Birnavirus. The viral genome consists of segment A, B, of which segment A (3.2kb) encodes mainly the structural proteins VP2, VP3, VP4 and the non-structural protein VP 5. VP2 is the IBDV-only capsid protein and is the main protective antigen.

The clinical susceptibility age of FAdV-4 and IBDV coincides, mixed infection occurs sometimes, and the disease is more serious. The development of effective multi-combination vaccines has important significance for the prevention and control of FAdV-4 and IBDV. The inventor constructs a recombinant virus rHN20-vvIBDV-VP2 for expressing IBDV super virulent strain HLJ-0504VP2 protein by using a vaccine candidate strain rHN20 transformed from a newly-developed highly pathogenic FAdV-4HLJFAd15 strain in China. The vaccine strain is prepared into an inactivated vaccine, and immune protection experiments prove that SPF chickens inoculated with rHN20-vvIBDV-VP2 inactivated vaccine can completely resist the virus attack infection of FAdV-4 virulent strains and IBDV super-virulent strains, and prove that rHN20-vvIBDV-VP2 inactivated vaccine has very good immunogenicity and can be used as vaccine candidate strains.

Disclosure of Invention

The invention aims to provide a recombinant serum 4-type avian adenovirus vaccine strain for expressing chicken infectious bursal disease virus super-virulent VP2 protein, and a construction method and application thereof.

The second purpose of the invention is to provide a chicken infectious bursal disease virus and serum type 4 avian adenovirus combined inactivated vaccine prepared from the vaccine strain.

In order to achieve the purpose, the invention adopts the following technical means:

the invention relates to a recombinant serum 4 type avian Adenovirus (FAdV-4) vaccine strain for expressing chicken infectious bursal disease virus super virulent virus (vvIBDV) VP2 protein, which Is obtained by replacing a Natural nucleotide Deletion site (Pan Q, Wang J, Gaoo Y, Cui H, Liu C, Qi X, Zhang Y, Wang Y, Wang X. the Natural Large Genomic Deletion Is Uncorrelated with the incorporated viral vector Pile C, Novel Genomic Fowle Adenov 4 Recentre introduced infectious bursal disease virus China, Virus, 2018, 10, 494, 9082, VP 0734 with reverse Adenovirus strain VP 0734, wherein the reverse Adenovirus strain Is obtained by inserting a Natural nucleotide Deletion site (Pan Q, Wang J, Gaoo Y, Cui H, Liu C, Qi X, Zhang Y, Wang Y, Wang X. the Natural Large Genomic Deletion Is unaged New infectious bursal disease virus introduced into the reverse Adenovirus strain of China) (VP 7) of the reverse Adenovirus strain Is a Natural infectious bursal viral Adenovirus strain of the avian infectious bursal disease virus, VP 4682, NO, NO. A vaccine strain Is obtained by replacing the reverse Adenovirus strain of the 1966-4 type avian infectious bursal virus of the reverse Adenovirus strain of the Escherichia coli, NO. 7, NO. A vaccine strain of the avian infectious bursal viral gene of China, NO. A vaccine strain of the infectious bursal virus of China Is obtained by the Escherichia coli, NO. A vaccine strain of the Escherichia coli, NO. 4 type Escherichia coli, NO. 4, the Escherichia coli, NO. A vaccine strain of the Escherichia coli, NO. 4, the Escherichia, the Escherichia coli, Escherichia The Hexon gene of strain ON1 was thus obtained.

Wherein, preferably, the infectious bursal disease virus super-virulent virus is infectious bursal disease virus super-virulent virus HLJ-0504, and the NCBI accession number of the infectious bursal disease virus super-virulent virus is GQ 451330.1.

Wherein, the preferable nucleotide sequence of the infectious bursal disease virus super virulent HLJ-0504VP2 gene is shown in SEQ ID NO. 1.

Preferably, the vaccine strain is constructed by the following method:

(1) construction of the vvIBDV-VP2 expression cassette plasmid (CMV-VP2)

Using infectious bursal disease virus super virulent HLJ-0504cDNA as a template, amplifying a VP2 gene coding region by using primers VP 2F: ttagtgaaccgtcagatccgctagcgccaccATGACAAACCTGCAAGATCAAACC and VP 2R: ctgattatgatctagagtcgcggccgctttaCCTTAAGGCCCGAATTATGTC, and recovering a PCR product; double enzyme digestion is carried out on pEGFP-N1 by using NheI and NotI restriction enzymes, and a larger fragment is recovered; carrying out recombinant connection on the PCR product and the large fragment of the vector subjected to enzyme digestion by using a Clonexpress II One Step Cloning Kit, transforming the large fragment into a DH5 alpha competence, coating a plate to obtain a recombinant plasmid, and naming the plasmid with correct sequencing as CMV-VP 2;

(2) construction of Fos-rHN20-vvIBDV-VP2 infectious cloned cosmids

The Fos-rHN20-vvIBDV-VP2 infectious clone cosmid was constructed using the Counter-Selection BAC Modification Kit as follows: firstly, electrically transferring Fos-rHN20 into DH10B competent cells, and screening positive clones by chloramphenicol antibiotics; then, the recombinase plasmid pRed E/T in the Counter-Selection BAC ModificationKit is electrotransferred into DH10B competent cells containing Fos-rHN20, and positive clones are screened by chloramphenicol and streptomycin; amplifying rpsl-neo expression cassettes with 50bp homology arms at two ends of a FAdV-4 natural deletion 1966-bp fragment by using primers 1966-rpslneo F and 1966-rpslneo R by using rpsl-neo expression cassette DNA in a Counter-Selection BAC Modification Kit as a template, directly transforming the recovered PCR product into DH10B competent cells induced by L-arabinose and containing Fos-rHN20 and pRed E/T, and screening positive clones by chloramphenicol, streptomycin and kanamycin antibiotic to obtain Fos-rHN 20-1966-rpneo; then in the same way, using CMV-VP2 plasmid as a template, using primers CMV-VP 2F and CMV-VP 2R to amplify the vvIBDVVP2 gene expression cassette, electrically transferring the PCR product into the DH10B competence which is induced by L-arabinose and contains Fos-rHN20-1966-rpslneo, and screening by streptomycin and chloramphenicol antibiotic to obtain positive clone which is named as Fos-rHN20-vvIBDV-VP 2; the primer sequences are as follows:

1966-rpslneo F：

AACATAAGAATCAGGGGTGGCCCGTATACTAATCCCGTCACTGACGACACGGCCTGGTGATGATGGCGGGATCG

1966-rpslneo R：

CACTCGAGAAGGAGCCTCTGAGCCGTACTCTATGCATTGCGTGATTGTGGTCAGAAGAACTCGTCAAGAAGGCG

CMV-VP2 F：

AACATAAGAATCAGGGGTGGCCCGTATACTAATCCCGTCACTGACGACACCGTTACATAACTTACGGTAAATGG

CMV-VP2 R：

CACTCGAGAAGGAGCCTCTGAGCCGTACTCTATGCATTGCGTGATTGTGGTAAGATACATTGATGAGTTTGGAC

(3) virus rescue

Extracting Fos-rHN20-vvIBDV-VP2 cosmid by using a QIAGEN plasmid extraction Kit, linearizing by using FseI restriction endonuclease, recovering DNA by alcohol precipitation, inoculating LMH cells to a 6-pore plate, transfecting the linearized Fos-rHN20-vvIBDV-VP2 by using a Transfection Reagent X-tremeGene HP DNA Transfection reaction Kit, replacing a fresh culture medium for 6h after Transfection, repeatedly freezing and thawing the 6-pore plate in a refrigerator at-80 ℃ for 3 times after 5d, centrifuging, and collecting supernatant, namely the obtained recombinant serum type 4 avian adenovirus (FAdV-4) vaccine strain for rescuing the protein of the avian infectious bursal disease virus (vvIBDV) VP2, which is named as rHN20-vvIBDV-VP 2.

Furthermore, the invention also provides application of the recombinant avian adenovirus serotype 4 (FAdV-4) vaccine strain for expressing the avian infectious bursal disease virus very virulent virus (vvIBDV) VP2 protein in preparation of medicaments for preventing and treating avian pericardial effusion-inclusion body hepatitis syndrome (HHS) and Infectious Bursal Disease (IBD) caused by infection of avian adenovirus serotype 4 (FAdV-4).

Wherein, preferably, the medicament is a vaccine. More preferably, the vaccine is an inactivated vaccine.

Still further, the invention provides a chicken infectious bursal disease virus and serum type 4 avian adenovirus combined inactivated vaccine, which contains the inactivated recombinant serum type 4 avian adenovirus (FAdV-4) vaccine strain expressing the chicken infectious bursal disease virus super-virulent virus (vvIBDV) VP2 protein.

Preferably, the inactivation is carried out by adding 0.1% v/v formaldehyde into virus liquid of recombinant avian adenovirus serotype 4 (FAdV-4) vaccine strain expressing chicken infectious bursal disease virus super virulent virus (vvIBDV) VP2 protein cultured in cells at 37 ℃ for 24h, and then inactivating according to the following ratio of white oil: and (3) uniformly mixing the inactivated virus solution in a volume ratio of 2:1, and emulsifying to prepare the oil adjuvant inactivated vaccine.

Preferably, the cell is Chicken liver cancer cell (Chicken Leghorn large HepatocellularCell, LMH).

Wherein, the final concentration of the virus in the inactivated bivalent vaccine is 1.0X 10⁷PFU/ml。

Compared with the prior art, the invention has the beneficial effects that:

the inventor constructs a recombinant virus rHN20-vvIBDV-VP2 for expressing IBDV super virulent strain HLJ-0504VP2 protein by using a vaccine candidate strain rHN20 transformed from a newly-prevalent highly pathogenic FAdV-4HLJFAd15 strain in China, and prepares a bivalent inactivated vaccine. Immune protection experiments prove that SPF chickens inoculated with rHN20-vvIBDV-VP2 bivalent inactivated vaccine can completely resist the virus attack infection of FAdV-4 virulent strains and IBDV ultra-virulent strains, and prove that rHN20-vvIBDV-VP2 bivalent inactivated vaccine has very good immunogenicity and can be used as a candidate vaccine.

Drawings

FIG. 1 is a schematic diagram of the cosmid construction of Fos-rHN20-vvIBDV-VP 2;

FIG. 2 shows the colony PCR identification of Fos-rHN20-vvIBDV-VP2 cosmid construct;

FIG. 3 shows rHN20-vvIBDV-VP2 recombinant virus lesions;

FIG. 4 shows the sequencing of the PCR product of the rHN20-vvIBDV-VP2 recombinant virus VP2 expression cassette;

FIG. 5 shows the indirect immunofluorescence assay for the expression of the rHN20-vvIBDV-VP2 recombinant virus VP2 protein;

FIG. 6 shows the results of a serum anti-FAdV-4 neutralizing antibody assay after chicken immunization with rHN20-vvIBDV-VP2 dual inactivated vaccine;

FIG. 7 is a graph showing the protective survival of chicken immunized with rHN20-vvIBDV-VP2 bigeminy inactivated vaccine against FAdV-4;

FIG. 8 shows the detection results of FAdV-4 virus residues in tissues 7 days after challenge of chicken immunization of rHN20-vvIBDV-VP2 dual inactivated vaccine;

FIG. 9 shows the results of a serum anti-IBDV neutralizing antibody assay after chicken immunization with rHN20-vvIBDV-VP2 dual inactivated vaccine;

FIG. 10 is a graph showing the protective survival of chicken after immunization with rHN20-vvIBDV-VP2 bigeminy inactivated vaccine against IBDV;

FIG. 11 shows the results of detection of IBDV residues in tissues 7 days after challenge with a chicken immunized rHN20-vvIBDV-VP2 bigeminal inactivated vaccine;

FIG. 12 shows the gross bursal disease after challenge for 7 days after immunization of chicken with rHN20-vvIBDV-VP2 dual inactivated vaccine;

FIG. 13 shows bursal disease BBIX 7 days after challenge of a chicken immunized rHN20-vvIBDV-VP2 bigeminy inactivated vaccine;

FIG. 14 shows bursal disease after 7 days of challenge after chicken immunization with rHN20-vvIBDV-VP2 dual inactivated vaccine.

Detailed Description

The present invention will be further described with reference to the following examples, but the present invention is not limited to the following examples. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Example 1 construction of recombinant serotype 4 avian adenovirus vaccine strain rHN20-vvIBDV-VP2 expressing the virulent VP2 protein of infectious bursal disease Virus

1. Materials and methods

1.1 viruses, plasmids, cells and strains

A rHN20 infectious cloned cosmid Fos-rHN20 obtained by replacing a new Fowl adenovirus serotype 4 (Fowl adenovarus 4, FAdV-4) HLJFAd15 strain (NCBI accession number: KU991797) Hexon gene with a Heoxn gene of an nonpathogenic strain ON1, a reverse genetic vaccine strain rHN20 of the Fowl adenovirus serotype 4 obtained after virus rescue and a construction method thereof are described in a patent application with the application number of 202011419903.5 and the invention name of rHN20, the construction method and the application thereof, this application was published in the patent publication on 23/3/2021, and is incorporated in its entirety into the present specification, the plasmid pEGFP-N1, Chicken liver cancer cells (Chicken egg Hepatocellular Cell, LMH) and DH10B competent strains were preserved by the avian immunosuppressive disease team of Harbin veterinary institute of Chinese academy of agricultural sciences (hereinafter referred to as the laboratory).

1.2 Primary reagents

CopyControl^TMThe Fosmid Library Production Kit was purchased from Epicentre Biotechnologies, Inc.; ZR BAC DNA miniprep Kit was purchased from ZYMO; Counter-Selection BAC Modification Kit was purchased from Gene Bridges; FseI, NheI and NotI restriction enzymes were purchased from NEB; PrimeSTARHS DNA polymerase from Dalibao bioengineering, Inc.; the gel recovery kit was purchased from AxyPrep; the plasmid extraction kit was purchased from QIAGEN. EDTA-pancreatin digestive juice, penicillin and streptomycin double antibody purchased from Haerbin national Biotechnology GmbH; DMEM/F12, Opti-MEM, FBS from gibico; the Transfection Reagent X-tremeneGene HP DNA Transfection Reagent Kit was purchased from Roche.

1.3 Synthesis of primers

The primers referred to in this example are synthesized by Jilin province, Kuumei, Biotech, Inc., as shown in Table 1.

TABLE 1 primers

1.4 construction of the vvIBDV-VP2 expression cassette plasmid (CMV-VP2)

The PCR product is recovered by amplifying the VP2 gene coding region by using primers VP 2F and VP 2R with Infectious Bursal Disease Virus (IBDV) super virulent HLJ-0504(NCBI accession number is GQ451330.1) cDNA as a template. pEGFP-N1 was double digested with NheI and NotI restriction enzymes, and the larger fragment was recovered. The PCR product and the digested vector large fragment were recombined and ligated with Clonexpress II One Step Cloning Kit, transformed into DH 5. alpha. competence, and plated to obtain recombinant plasmid. The correctly sequenced plasmid was designated CMV-VP 2.

Construction of the infectious cloned cosmid of 5 Fos-rHN20-vvIBDV-VP2

The Fos-rHN20-vvIBDV-VP2 infectious clone cosmid was constructed using the Counter-Selection BAC Modification Kit as follows: firstly, electrically transferring Fos-rHN20 into DH10B competent cells, and screening positive clones by chloramphenicol antibiotics; then, the recombinase plasmid pRed E/T in the Counter-Selection BAC Modification Kit is electrotransferred into DH10B competent cells containing Fos-rHN20, and positive clones are screened by chloramphenicol and streptomycin; amplifying rpsl-neo expression cassettes with 50bp homology arms at two ends of a FAdV-4 natural deletion 1966-bp fragment by using primers 1966-rpslneo F and 1966-rpslneo R by using rpsl-neo expression cassette DNA in a Counter-Selection BAC Modification Kit as a template, directly transforming the recovered PCR product into DH10B competent cells induced by L-arabinose and containing Fos-rHN20 and pRed E/T, and screening positive clones by chloramphenicol, streptomycin and kanamycin antibiotic to obtain Fos-rHN 20-1966-rpneo; in the same way, a CMV-VP2 plasmid is used as a template, primers CMV-VP 2F and CMV-VP 2R are used for amplifying a vvIBDVVP2 gene expression cassette, a PCR product is electrically transferred into a DH10B competence which is prepared by the positive cloning and contains Fos-rHN20-1966-rpslneo and is induced by L-arabinose, positive clones are obtained by streptomycin and chloramphenicol antibiotic screening, colony PCR identification is carried out by using Det-1966-F and Det-1966-R, fosmid sequencing is extracted to confirm the correctness, the name is Fos-rHN20-vvIBDV-VP2, and the construction schematic diagram is shown in figure 1.

1.6 Virus rescue

Extracting Fos-rHN20-vvIBDV-VP2 cosmid by using a QIAGEN plasmid extraction Kit, linearizing by using FseI restriction endonuclease, recovering DNA by alcohol precipitation, inoculating LMH cells to a 6-pore plate, transfecting linearized Fos-rHN20-vvIBDV-VP2 by using a Transfection Reagent X-tremeGene HP DNA Transfection reaction Kit, replacing a fresh culture medium for 6 hours after Transfection, repeatedly freezing and thawing the 6-pore plate in a refrigerator at-80 ℃ for 3 times after 5 days, centrifuging, and collecting supernatant, namely the rescued rHN20-vvIBDV-VP2 recombinant virus.

1.7 recombinant toxin identification

And taking the fifth generation recombinant virus, extracting DNA, and performing PCR amplification and sequencing by using primers Det-1966-F and Det-1966-R.

1.8 IFA identification of VP2 expression

The rescued rHN20-vvIBDV-VP2 recombinant virus was inoculated into LMH cells, the cell culture was aspirated after 48h, the cells were washed 3 times with PBS, fixed with 4% formaldehyde for 30min, and then incubated with a monoclonal antibody against IBDV VP2 (1: 200 dilution) for 1h at 37 ℃. The cells were subsequently washed 3 times with PBS and then incubated with fluorescein isothiocyanate-labeled goat anti-mouse antibody (1: 200) at 37 ℃ for 1 hour in the dark. Finally, the cells were washed 3 times and observed by a fluorescence microscope.

2. Results

2.1 construction of Fos-rHN20-vvIBDV-VP2 infectious clonal cosmid

Of the 5 clones picked, 1 cosmid Fos-rFAdV4-vvIBDV-VP2 (FIG. 2) was successfully constructed by PCR identification and sequencing identification.

2.2 rescue and identification of recombinant toxins

Transfection of LMH with linearized cosmid Fos-rHN20-vvIBDV-VP2 revealed a typical FAdV-4 lesion (FIG. 3) and was able to stably passage, successfully rescuing recombinant virus rHN20-vvIBDV-VP 2. After viral DNA extraction, PCR amplification was performed using Det-1966-F and Det-1966-R as primers and recombinant viral DNA as template, and the PCR products were sequenced, indicating successful insertion of the vvIBDV VP2 gene expression cassette (FIG. 4). IFA detection results show that the IBDVVP2 monoclonal antibody can recognize the virus and can detect green fluorescence (FIG. 5)

Example 2 preliminary evaluation of the immune Effect of avian infectious bursal disease Virus, avian adenovirus serotype 4 bivalent inactivated vaccine (rHN20-vvIBDV-VP2) on FAdV-4

1 materials and methods

1.1 Main reagents and consumables

The fetal bovine serum, DMEM and DMEM/F12 are Sigma products; EDTA-pancreatin digestive juice, penicillin two antibiotics for Harbin national biological science and technology products; the cell culture bottle and the cell culture plate are products of Thermo Scientific company; the DNA extraction kit is a product of Axygen company; the qPCR reagent is Takara product.

The primers used in this example were synthesized by Shanghai Jun corporation as shown in Table 2.

TABLE 2 fluorescent quantitative PCR primers and probes for detecting FAdV-4

Primer, Probe name	Sequence (5 '-3')
		qPCR-FAdV4F	CACTGCCACTGGGCTCTGT
qPCR-FAdV4R	GCAATGGCAATAAACCTCCAA
		qPCR-FAdV4probe	ROX-AGTCTGGAGAAGTCTGTGCAGCCTCCA-BHQ2
qPCR-OVOF	CAGTTCATTTCCGCCACC
		qPCR-OVOR	GCAGCCGTTGAGCCTTTT
qPCR-OVOprobe	FAM-TCTGTCGTGACATTTCGGGTGGG-TAMRA

1.2 cells and viruses

Chicken liver cancer cells (Chicken liver cancer cells, LMH), new serum type 4 avian adenovirus (Fowl adenovirus 4, FAdV-4) HLJFAd15 strain, and recombinant virus rFAdV4-EGFP which takes HLJFAd15 strain as a framework to express green fluorescent protein are stored by the poultry immunosuppressive disease team of Harbin veterinary institute of Chinese academy of agricultural sciences (hereinafter referred to as the laboratory).

A recombinant avian adenovirus serotype 4 vaccine candidate rHN20-vvIBDV-VP2 expressing the avian infectious bursal disease Virus, virulent VP2 protein, was constructed as in example 1.

1.3 test animals

Specific-pathogen-free (SPF) chickens were purchased from the laboratory animal center of Harbin veterinary institute, Chinese academy of agricultural sciences, and housed in negative pressure isolators at that center.

1.4 preparation of Virus and bivalent inactivated vaccine

LMH cells were cultured in a cell culture flask and, when the cells were confluent, rHN20-vvIBDV-VP2 was inoculated with serum-free medium at an MOI of 0.01. After adsorbing for 1h at 37 ℃, the cell culture medium was replaced with a cell maintenance medium (DMEM/F12 medium containing 2% fetal bovine serum), and the cells were further cultured in a 37 ℃ cell culture chamber, and the cytopathic effect (CPE) was observed day by day. And (3) after inoculation for 72h, repeatedly freezing and thawing the cells for three times, centrifuging 3300g for 5min, and collecting cell suspension to obtain the virus or vaccine. The detection shows that the product has no mycoplasma, bacteria and exogenous virus and is good in purity. Subpackaging and placing in a refrigerator at minus 80 ℃ for standby. 10 per ml of vaccine in DMEM/F12⁷Diluting virus solution with PFU virus, adding 0.1% v/v formaldehyde into the virus solution of rHN20-vvIBDV-VP2, inactivating at 37 deg.C for 24h, and inactivating according to the ratio of white oil: and (3) uniformly mixing the inactivated virus solution with the volume ratio of 2:1, and emulsifying to prepare the oil adjuvant bivalent inactivated vaccine.

1.5 animal test

Randomly dividing 33 SPF chickens 2 weeks old into 3 groups, 13 in

group

1, 10 in

group

2 and 10 in group 3, wherein group 1 13 is injected intramuscularly with immune dual inactivated vaccine at 0.3 ml/feather doseThe vaccine was used as an immunization group, 10 of group 2 was used as a challenge control group without any treatment, and 10 of group 3 was used as a healthy control group. Serum was isolated from chicken blood collected from the immunized group and the healthy control group 1 week after immunization, 2 weeks after immunization, and 3 weeks after immunization, respectively, and 10 were collected randomly from the immunized group and 3 were collected randomly from the healthy control group. After 3 weeks post-immunization blood was collected by HLJFAd15 at 2X 10³PFU/feather toxin-attacking immune group and toxin-attacking control group, healthy control did not do any treatment. After the challenge, the disease and death of the chickens were observed every day for 1 week. 4 days after challenge, 3 immune group chickens with livers, spleens and kidneys are immunized to detect the FAdV-4 virus copy number, 3 healthy control group chickens are taken as negative controls, and 3 challenge control group diseased and dead chickens are taken as positive controls.

1.5.1 detection of neutralizing antibodies

The neutralizing capacity of the immune chicken serum antibodies to FAdV-4 was tested on LMH cells. Inactivating the serum to be detected in 56 deg.C water bath for 30min, and filtering for sterilization. And (3) diluting the inactivated and sterilized serum to be detected by 2 times by using serum-free DMEM culture solution. rFAdV4-EGFP virus was diluted to 200TCID50 virus solution in DMEM/F12 medium containing 2% serum. The diluted 200 virus solutions of TCID50 and 2 times diluted serum are mixed in equal volumes respectively, and then the mixture is cultured in an incubator at 37 ℃ for 1h, and the mixture is gently shaken and uniformly mixed once every 15min during the culture period, so that virus particles are fully contacted with antibodies in the serum. The culture medium in the 96-well culture plate in which LMH cells were cultured was completely aspirated, the mixed serum and virus mixture was added to each well, 100. mu.l was added to each well, and the mixture was cultured in a 5% CO2 cell culture chamber at 37 ℃ for 6 days, and the neutralization titer of serum against FAdV-4 was calculated by detecting the neutralization of rFAdV4-EGFP by an inverted fluorescence microscope. And simultaneously setting negative and positive serum controls.

1.5.2 viral load detection

Taking the livers, spleens and kidneys of 3 chickens in the immune group 4 days after challenge, taking 3 chickens in the healthy control group as negative control, and taking the livers, spleens and kidneys of 3 chickens which are dead after disease attack in the challenge control group as positive control. DNA was extracted and the viral copy number in the livers, spleens and kidneys of each group of chickens was determined by fluorescent quantitative PCR. The FAdV-4hexon gene is used as an amplification sequence, and the host OVO gene is used as an internal reference to calculate the virus copy number.

2. Results

2.1 neutralizing antibody titer assay results

1 week after rHN20-vvIBDV-VP2 bivalent inactivated vaccine immunization, the immune group detected higher FAdV-4 serum antibodies; at 2 weeks post-immunization, all chickens had positive neutralizing antibodies and developed higher titers (FIG. 6).

2.2 protective results against toxic challenge

The challenge protection test results show that the immune rHN20-vvIBDV-VP2 bivalent inactivated vaccine can realize 100% death protection on FAdV-4 without obvious abnormality (figure 7).

2.3 tissue Virus residual detection

rHN20-vvIBDV-VP2 bivalent inactivated vaccine immunization group was similar to the healthy control group and significantly lower than the FAdV-4 virus copy number of the challenge control group (FIG. 8).

EXAMPLE 3 preliminary evaluation of the immune Effect of the Combined inactivated vaccine against avian infectious bursal disease Virus and avian adenovirus serotype 4 (rHN20-vvIBDV-VP2)

1 materials and methods

1.1 Main reagents and consumables

The fetal bovine serum, DMEM and DMEM/F12 are Sigma products; EDTA-pancreatin digestive juice, penicillin two antibiotics for Harbin national biological science and technology products; the cell culture bottle and the cell culture plate are products of Thermo Scientific company; RNA extraction kit, reverse transcription kit, qPCR kit are products of Takara company.

The primers used in this example were synthesized by Shanghai Jun corporation as shown in Table 3.

TABLE 3 fluorescent quantitative PCR primers and probes for detecting FAdV-4

1.2 cells and viruses

DF1 cells, chicken infectious bursal disease virus super virulent strain HLJ-0504 and chicken infectious bursal disease virus cell adaptive strain rGtHLJVP2, which are preserved by the poultry immunosuppressive disease team (hereinafter referred to as the laboratory) of Harbin veterinary institute of Chinese academy of agricultural sciences.

A recombinant avian adenovirus serotype 4 inactivated vaccine candidate strain rHN20-vvIBDV-VP2 expressing the virulent VP2 protein of infectious bursal disease virus was constructed as in example 1.

1.3 test animals

1.4 preparation of Virus and bivalent inactivated vaccine

1.5 animal test

Randomly dividing 33 SPF chickens with the age of 2 weeks into 3 groups, 13 in the 1 st group, 10 in the 2 nd group and 10 in the 3 rd group, wherein the 13 in the 1 st group is used as an immune group by intramuscular injection of immune bivalent inactivated vaccine according to the dose of 0.3 ml/feather, the 10 in the 2 nd group is used as an attack virus control group without any treatment, and the 10 th group is used as a challenge virus control groupGroup 3 and group 10 served only as healthy controls. Serum was isolated from chicken blood collected from the immunized group and the healthy control group 1 week after immunization, 2 weeks after immunization, and 3 weeks after immunization, respectively, and 10 were collected randomly from the immunized group and 3 were collected randomly from the healthy control group. After 3 weeks of blood collection after immunization, HLJ-0504 was pressed at 10⁵EID₅₀The feather attacking and toxin attacking immune group and the attacking and toxin attacking control group do not carry out any treatment on healthy controls. After the challenge, the disease and death of the chickens were observed every day for 1 week. 4 days after challenge, taking 3 immune groups of chicken spleen, kidney and bursa of Fabricius to detect IBDV virus copy number, taking 3 healthy control groups as negative control, and taking 3 challenge control groups as positive control for morbidity and mortality.

1.5.1 detection of neutralizing antibodies

The neutralizing capacity of immune chicken serum antibodies to rGtHLJVP2 was tested on DF1 cells. Inactivating the serum to be detected in 56 deg.C water bath for 30min, and filtering for sterilization. And (3) diluting the inactivated and sterilized serum to be detected by 2 times by using serum-free DMEM culture solution. The rGtHLJVP2 virus was diluted into 200TCID50 virus solution in DMEM medium containing 2% serum. The diluted 200 virus solutions of TCID50 and 2 times diluted serum are mixed in equal volumes respectively, and then the mixture is cultured in an incubator at 37 ℃ for 1h, and the mixture is gently shaken and uniformly mixed once every 15min during the culture period, so that virus particles are fully contacted with antibodies in the serum. The culture medium in the 96-well culture plate fed with DF1 cells was completely aspirated, the mixed serum and virus mixture was added to each well, 100. mu.l was added to each well, and the mixture was cultured in a 5% CO2 cell culture chamber at 37 ℃ for 4 days, and the virus was observed by microscope to detect the neutralization of rGtHLJVP2, and the neutralizing titer of serum against IBDV was calculated. And simultaneously setting negative and positive serum controls.

1.5.2 viral load detection

4 days after challenge, 3 chickens in the immune group are taken as spleen, kidney and bursa of fabricius, 3 chickens in the healthy control group are taken as negative control, and 3 chickens which are attacked and killed in the challenge control group are taken as positive control. The virus copy number in the spleen, kidney and bursa of Fabricius of each group of chickens was determined by fluorescent quantitative PCR. The FAdV-4VP5 gene is used as an amplification sequence, and the host 28S gene is used as an internal reference to calculate the virus copy number.

1.5.3 evaluation of Fall's Capsule injury protection

1 week after challenge, the surviving chickens of the immune group and the challenge control group were dissected and killed, Bursa of Fabricius was photographed, Body weight and Bursa weight were weighed, 5 healthy controls were dissected and killed as controls, and Bursa weight ratio (F/B) and Bursa Index (BBIX). F/B ═ (bursal weight/body weight) X1000; BBIX ═ test group chicken cyst ratio/blank control group chicken cyst ratio. The extent of bursal atrophy was evaluated according to BBIX and when IBBX was below 0.7, bursal atrophy was indicated. Meanwhile, a pathological section is prepared by fixing part of bursa of Fabricius with 10% formaldehyde solution for histopathological analysis.

2. Results

2.1 neutralizing antibody titer assay results

1 week after the rHN20-vvIBDV-VP2 bivalent inactivated vaccine immunization, the immunized group detected higher IBDV serum antibodies; 3 weeks after immunization, all chickens had positive neutralizing antibodies and had higher titers (FIG. 9).

2.2 protective results against toxic challenge

The challenge protection test results show that the immune rHN20-vvIBDV-VP2 bivalent inactivated vaccine can realize 100% death protection on vvIBDV without obvious abnormality (figure 10)

2.3 evaluation of bursal injury

rHN20-vvIBDV-VP2 bivalent inactivated vaccine immunization group was similar to the healthy control group, and significantly lower than the virus copy number of IBDV of the challenge control group (FIG. 11).

2.4 evaluation of bursal injury

The chicken bursa of Fabricius in the immunized group had no macroscopic damage and atrophy (FIG. 12), and as in the healthy control group, the BBIX values of the bursa of Fabricius in the rHN20-vvIBDV-VP2 bivalent inactivated vaccine immunized group were all greater than 0.7 (FIG. 13), and the immunized group had no pathological tissue changes (FIG. 14).

Sequence listing

<110> Harbin veterinary institute of Chinese academy of agricultural sciences (Harbin center of Chinese center of animal health and epidemiology)

<120> chicken infectious bursal disease virus and serum type 4 avian adenovirus bivalent inactivated vaccine and preparation method and application thereof

<130> klpi210588

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1356

<212> DNA

<213> HLJ-0504

<400> 1

atgacaaacc tgcaagatca aacccaacag attgttccgt tcatacggag ccttctgatg 60

ccaacaaccg gaccggcgtc cattccggac gacaccctag agaagcacac tctcaggtca 120

gagacctcga cctacaattt gactgtgggg gacacagggt cagggctaat tgtctttttc 180

cctggtttcc ctggctcaat tgtgggtgct cactacacac tgcagagcaa tgggaactac 240

aagttcgatc agatgctcct gactgcccag aacctaccgg ccagctacaa ctactgcagg 300

ctagtgagtc ggagtctcac agtgaggtca agcacactcc ctggtggcgt ttatgcatta 360

aacggaacca taaacgccgt gaccttccaa ggaagcctga gtgaactgac agatgttagc 420

tacaatgggt tgatgtctgc aacggccaac atcaacgaca agatcgggaa cgtcctagta 480

ggggaagggg taactgtcct cagcttaccc acatcatatg atctggggta tgtgagactc 540

ggtgacccca ttcccgctat agggcttgac ccaaagatgg tagcgacatg tgacagcagt 600

gacaggccca gagtctacac cataactgca gccaatgatt accaattctc atcacagtac 660

caagcaggtg gagtgacaat cacactgttc tcagcaaaca tcgatgccat cacaagcctc 720

agcatcgggg gagaacttgt gtttcaaaca agcgtccaag gccttatact gggcgctacc 780

atctacctta taggcttcga tgggactgcg gtaatcacca gagctgtggc cgcagacaat 840

gggctaacgg ccggcactga caaccttatg ccattcaata ttgtgattcc aaccagcgag 900

ataacccagc caatcacatc catcaaactg gagatagtta cctccaaaag tggtggtcag 960

gcgggggatc agatgtcatg gtcagcaagt gggagcctag cagtgacgat ccacggtggc 1020

aactatccag gggccctccg tcccgtcaca ctagtagcct acgaaagagt ggctacagga 1080

tctgtcgtta cggtcgccgg ggtgagcaac ttcgagctga tcccaaatcc tgaactagca 1140

aagaacctga tcacagaata cggccgattt gacccagggg ccatgaacta cacaaaattg 1200

atactgagtg agagggaccg tcttggcatc aagaccgtgt ggccaacaag ggagtacacc 1260

gactttcgcg agtacttcat ggaggtggcc gacctcaact ctcccctgaa gattgcagga 1320

gcatttggct tcaaagacat aattcgggcc ttaagg 1356

Claims

1. A recombinant fowl adenovirus serotype 4 (FAdV-4) vaccine strain for expressing chicken infectious bursal disease virus ultra-virulent virus (vvIBDV) VP2 protein is characterized in that the vaccine strain is obtained by inserting a VP2 gene of infectious bursal disease virus ultra-virulent virus between FAdV-4 genome open reading frames 42 and 43 at a natural nucleotide deletion site of 1966-bp ON the basis of a fowl adenovirus serotype 4 reverse genetic vaccine strain rHN20, wherein the FAdV-4 reverse genetic vaccine strain rHN20 is obtained by replacing a Hexon gene of a new strain HLAd 15 in China with a Hexon gene of a natural low virulent strain ON1 through a reverse genetic technology.

2. The recombinant avian adenovirus serotype 4 (FAdV-4) vaccine strain of claim 1 that expresses the infectious bursal disease virus very strong virus (vvIBDV) VP2 protein, wherein said infectious bursal disease virus very strong virus is infectious bursal disease virus very strong virus HLJ-0504 with NCBI accession No. GQ 451330.1.

3. The recombinant avian adenovirus serotype 4 (FAdV-4) vaccine strain of the expression of the infectious bursal disease virus very virulent virus (vvIBDV) VP2 protein of claim 1, wherein the nucleotide sequence of the infectious bursal disease virus very virulent HLJ-0504VP2 gene is represented by SEQ ID No. 1.

4. The recombinant avian adenovirus serotype 4 (FAdV-4) vaccine strain according to any one of claims 1 to 4 for expressing the infectious bursal disease virus hypervirulent virus (vvIBDV) VP2 protein, wherein said vaccine strain is constructed by the following method:

(1) construction of the vvIBDV-VP2 expression cassette plasmid (CMV-VP2)

(2) construction of Fos-rHN20-vvIBDV-VP2 infectious cloned cosmids

The Fos-rHN20-vvIBDV-VP2 infectious clone cosmid was constructed using the Counter-Selection BAC Modification Kit as follows: firstly, electrically transferring Fos-rHN20 into DH10B competent cells, and screening positive clones by chloramphenicol antibiotics; then, the recombinase plasmid pRed E/T in the Counter-Selection BAC Modification Kit is electrotransferred into DH10B competent cells containing Fos-rHN20, and positive clones are screened by chloramphenicol and streptomycin; amplifying rpsl-neo expression cassettes with 50bp homology arms at two ends of a FAdV-4 natural deletion 1966-bp fragment by using primers 1966-rpslneo F and 1966-rpslneo R by using rpsl-neo expression cassette DNA in a Counter-Selection BAC Modification Kit as a template, directly transforming the recovered PCR product into DH10B competent cells induced by L-arabinose and containing Fos-rHN20 and pRed E/T, and screening positive clones by chloramphenicol, streptomycin and kanamycin antibiotic to obtain Fos-rHN 20-1966-rpneo; then in the same way, using CMV-VP2 plasmid as a template, using primers CMV-VP 2F and CMV-VP 2R to amplify the vvIBDVVP2 gene expression cassette, electrically transferring the PCR product into the DH10B competence which is induced by L-arabinose and contains Fos-rHN20-1966-rpslneo, and screening by streptomycin and chloramphenicol antibiotic to obtain positive clone which is named as Fos-rHN20-vvIBDV-VP 2; the primer sequences are as follows:

1966-rpslneo F：

AACATAAGAATCAGGGGTGGCCCGTATACTAATCCCGTCACTGACGACACGGCCTGGTGATGATGGCGGGATCG

1966-rpslneo R：

CACTCGAGAAGGAGCCTCTGAGCCGTACTCTATGCATTGCGTGATTGTGGTCAGAAGAACTCGTCAAGAAGGCG

CMV-VP2 F：

AACATAAGAATCAGGGGTGGCCCGTATACTAATCCCGTCACTGACGACACCGTTACATAACTTACGGTAAATGG

CMV-VP2 R：

CACTCGAGAAGGAGCCTCTGAGCCGTACTCTATGCATTGCGTGATTGTGGTAAGATACATTGATGAGTTTGGAC

(3) virus rescue

5. Use of the recombinant avian adenovirus serotype 4 (FAdV-4) vaccine strain of any one of claims 1 to 4, which expresses the avian infectious bursal disease virus very virulent virus (vvIBDV) VP2 protein, in the preparation of a medicament for preventing and treating avian pericardial effusion-hepatitis syndrome (HHS) and Infectious Bursal Disease (IBD) caused by infection with avian adenovirus serotype 4 (FAdV-4).

6. The use according to claim 5, wherein the medicament is a vaccine, preferably wherein the vaccine is an inactivated vaccine.

7. A combined inactivated vaccine for chicken infectious bursal disease virus and avian adenovirus serotype 4, which is characterized by comprising the inactivated recombinant avian adenovirus serotype 4 (FAdV-4) vaccine strain expressing the avian infectious bursal disease virus super virulent virus (vvIBDV) VP2 protein of any one of claims 1 to 4.

8. The inactivated bivalent vaccine according to claim 7, wherein the inactivation is carried out by adding 0.1% v/v of formaldehyde into the virus solution of the recombinant avian adenovirus serotype 4 (FAdV-4) vaccine strain expressing the infectious bursal disease virus virulent virus (vvIBDV) VP2 protein according to any one of claims 1 to 4 cultured in cell culture at 37 ℃ for 24 hours, and the inactivation is carried out according to the following conditions: and (3) uniformly mixing the inactivated virus solution in a volume ratio of 2:1, and emulsifying to prepare the oil adjuvant inactivated vaccine.

9. The inactivated bivalent vaccine according to claim 8, wherein the cells are Chicken liver cancer cells (LMH).

10. The inactivated bivalent vaccine according to claim 7, wherein the inactivated vaccine is administered at a final concentration of 1.0 x 10 virus⁷PFU/ml。