CN114214204B

CN114214204B - Polyurethane degrading fungus strain and its separation method and use

Info

Publication number: CN114214204B
Application number: CN202111240865.1A
Authority: CN
Inventors: 骆祝华; 徐炜; 胡杰鸽; 杨帅
Original assignee: Third Institute of Oceanography MNR
Current assignee: Third Institute of Oceanography MNR
Priority date: 2021-10-25
Filing date: 2021-10-25
Publication date: 2023-08-08
Anticipated expiration: 2041-10-25
Also published as: CN114214204A

Abstract

The present invention relates to the field of environmental microbiology. Specifically, the invention relates to a salt-tolerant cladosporium (Cladosporium halotolerans) fungus strain of degradable polyurethane, which is obtained by separating and purifying east Pacific deep sea sediment obtained by 50-navigation science investigation of the ocean of China with the number 03 of sunny red. The fungus strain has polyurethane degradation capability, can generate degrading enzyme under the condition that only polyurethane is used as a sole carbon source, and can be used for degrading polyurethane microplastic in a water body environment.

Description

Polyurethane degrading fungus strain and its separation method and use

Technical Field

The present invention relates to the field of environmental microbiology. In particular, the invention relates to a fungus strain with polyurethane degradation activity, in particular to a fungus strain capable of effectively degrading polyurethane, and a separation method and application thereof.

Background

The microplastic is a new situation of ocean environment pollution at present, and the removal of the microplastic in the water body plays a key role in the aspect of ocean environment protection. The microplastic is used as a high molecular compound which is difficult to degrade, and is accumulated in the marine environment for a long time, so that the health of a marine ecosystem is seriously threatened. On the one hand, the microplastic is easy to be ingested by marine animals, and mechanical damage is further caused to the marine animals, such as blockage of esophagus, generation of false satiety and the like, and the growth and health of the marine animals are affected. Wherein, the low-nutrition-level marine organisms such as zooplankton and the like can more easily absorb the microplastic, and can cause the bioaccumulation effect through the transmission and the amplification of the food net. On the other hand, the microplastic can also release toxic substances such as plasticizer and the like to the ocean environment, has endocrine disrupting toxicity and influences the reproduction and development of marine organisms. In addition, the microplastic can also enrich high-concentration persistent organic pollutants and heavy metals, become carriers of toxic chemicals in seawater, generate biological amplification effect and generate ecological toxicology effect on marine organisms. In summary, the microplastic is a new situation of current ocean environment pollution, and the removal of the microplastic in the water body can play a key role in the aspect of marine ecological protection.

Polyurethane is one of the most common microplastics, and biodegradation of polyurethane is a very effective and attractive method of removing polyurethane from water. Therefore, a fungus capable of degrading polyurethane microplastic with high efficiency and no secondary pollution is expected, and a technical scheme capable of efficiently treating polyurethane microplastic pollutants in the ocean environment is developed and designed based on the fungus, so that a novel method and a novel process for biologically degrading polyurethane are realized.

Disclosure of Invention

The invention aims to provide a fungus strain with polyurethane degradation activity. More specifically, the present invention provides a strain of fungus useful for treating aqueous environments, particularly aqueous environments containing polyurethane such as marine environments.

The inventor cultivates the deep sea sediment of the east Pacific ocean, which is obtained by 50-voyage scientific investigation of the ocean in Yanggong No. 03, in an enrichment culture medium which takes polyurethane as a unique carbon source, then separates, purifies and identifies the sediment to obtain a salt-tolerant cladosporium (Cladosporium halotolerans CH) strain, and discovers that the strain has polyurethane degradation activity and can degrade polyurethane microplastic contained in a water environment. During degradation, dissolution became clear from cloudiness. Thus, the present invention has been completed.

Thus, in a first aspect, the present invention provides a strain of a fungus, which is a salt tolerant cladosporium (Cladosporium halotolerans CH), deposited on month 02 of 2021(Hubei)Province and saving(Wuhan)Eight routes in mountain area of city flood(Wuhan)Chinese typical of universityThe culture collection center has a collection registration number of CCTCC NO: m2021967.

In a second aspect, the present invention provides the use of a fungal strain for degrading polyurethane.

In a third aspect, the present invention provides a method of degrading polyurethane, the method comprising: contacting the fungus strain according to the first aspect of the invention with polyurethane in a water environment under reaction conditions suitable for reaction with polyurethane in the water environment.

In a fourth aspect, the present invention provides a method of obtaining a salt tolerant cladosporium (Cladosporium halotolerans CH) fungal strain having polyurethane degrading activity comprising: samples containing salt-tolerant cladosporium are incubated in enrichment medium with polyurethane as sole carbon source until hyphae are observed for enrichment.

In a fifth aspect, the present invention provides a method for identifying a fungal strain, the method comprising:

-extracting DNA of the fungal strain to be identified;

the amplified sequences obtained were sequenced using primers ITS4 (SEQ ID NO: 2) and ITS5 (SEQ ID NO: 3) and amplification by PCR technique; and

-sequence alignment of the sequenced sequence with the ITS sequence (SEQ ID NO: 1) of the fungal strain salt-tolerant cladosporium (Cladosporium halotolerans CH) of claim 1 to determine whether the fungal strain is the fungal strain salt-tolerant cladosporium of claim 1; the sequence alignment is based on 100% similarity.

In summary, the invention provides a salt-tolerant cladosporium fungus strain which has the advantages of high growth and proliferation speed, easy culture, low production cost and biological degradation polyurethane activity. The fungus strain can continuously degrade polyurethane microplastic contained in water body environment containing polyurethane, such as marine environment and industrial wastewater, thereby providing a treatment method of polyurethane pollutant with high degradation efficiency, environmental protection, no secondary pollution, low cost and easy operation. Therefore, the salt-tolerant cladosporium fungus strain can realize the efficient degradation of polyurethane in an environmental water sample, and provides a new solution for the pollution problem of polyurethane waste microplastic which is increasingly serious in a water body environment.

Drawings

The technical solutions and benefits of the present invention will become apparent to those skilled in the art having the benefit of the following detailed description and the accompanying drawings.

FIG. 1 is a colony morphology characteristic of the Cladosporium halotoleransCH strain according to the present invention in the early, middle and late stages thereof.

FIG. 2 is a diagram showing the morphological characteristics of a Cladosporium halotoleransCH strain under a microscope, the upper diagram showing a photograph of only mycelium, and the lower diagram showing a photograph of mycelium with spores according to the present invention.

FIG. 3 is a graph showing the change in OD600 values of Cladosporium halotoleransCH strain according to the present invention at different temperatures in a medium containing polyurethane as a sole carbon source.

FIG. 4 is a graph showing the change in OD600 values of Cladosporium halotoleransCH strain according to the present invention at different pH values in a medium containing polyurethane as a sole carbon source.

Detailed Description

The present invention will be described in detail below. It is to be understood that the following description is intended to illustrate the invention by way of example only, and is not intended to limit the scope of the invention as defined by the appended claims. And, it is understood by those skilled in the art that the technical scheme of the present invention can be modified without departing from the spirit and gist of the present invention.

The invention adopts the fungus which can degrade the polyurethane microplastic to develop and design a fungus strain which can effectively treat the polyurethane microplastic pollutant in the ocean environment, can realize the rapid starting and stable operation of a novel method and a novel process for biologically degrading the polyurethane, can not only improve the degradation efficiency and improve the degradation effect, but also be expected to overcome the secondary pollution problem existing in the traditional treatment method, realize a more environment-friendly microplastic degradation method, and provide a possible solution for solving the pollution problem of the polyurethane microplastic to the ecological environment which is increasingly serious.

As described above, the present inventors have obtained a salt-tolerant cladosporium (Cladosporium halotolerans CH) strain by culturing the deep sea sediment of eastern pacific in an enrichment medium having polyurethane as a sole carbon source, followed by isolation, purification and identification, and have found that the strain has biological activity of polyurethane degradation, and can degrade a water solution containing polyurethane. During degradation, the solution became clear from cloudiness.

In summary, the invention provides a fungus strain with polyurethane degradation activity, which can continuously degrade polyurethane microplastic contained in water environment such as marine environment and industrial wastewater, thereby providing a new solution to the pollution problem of polyurethane waste microplastic which is increasingly serious in water environment.

In a first aspect, the present invention provides a strain of fungus, which is a salt tolerant cladosporium (Cladosporium halotolerans CH), deposited on month 02 of 2021(Hubei)Province and saving(Wuhan)Eight routes in mountain area of city flood(Wuhan)China center for type culture Collection, university, with accession number CCTCC NO: m2021967.

As described above and below, the strain was obtained using the deep sea sediment and enrichment medium of the east Pacific obtained from the 50-vomica science survey of Yanghong No. 03 China. Specifically, the deep sea sediment of the east Pacific ocean is used for culturing in an enrichment culture medium with polyurethane as the sole carbon source for a period of time, for example, 20-25 days, until obvious hyphae grow, namely, enrichment is completed. The enriched fungi are then isolated, purified and identified, thereby obtaining the deposited strain.

In a second aspect, there is provided the use of a fungal strain according to the first aspect for degrading polyurethane.

As demonstrated in the examples section herein, the present inventors found that the fungus strain of the present invention successfully hydrolyzes ester bonds in polyurethane when further culturing the isolated and purified salt-tolerant cladosporium in a liquid medium having polyurethane as the sole carbon source. That is, the fungus obtained in the above manner can be used for degrading polyurethane.

As used herein, the term "degrading polyurethane" refers to hydrolyzing the ester bonds in the polyurethane.

In a specific embodiment, the polyurethane is a polyurethane microplastic. As used herein, the term "microplastic" refers to plastic particles of very small particle size as well as textile fibers. At present, plastic fibers, particles or films with the particle size smaller than 5mm are generally considered as microplastic, and in fact, many microplastic can reach the micrometer or even nanometer level, are invisible to naked eyes, and are therefore also visually compared with 'PM 2.5' in the ocean.

In a specific embodiment, the polyurethane is from a water environment such as a marine environment or wastewater.

In a further specific embodiment, the polyurethane is from industrial wastewater.

In a further specific embodiment, the polyurethane is a polyurethane microplastic having a particle size of less than 5 mm.

In a third aspect, the present invention relates to a method of degrading polyurethane, the method comprising: contacting the fungus strain according to the first aspect with polyurethane in a water environment under reaction conditions suitable for reaction with polyurethane in the water environment.

In a specific embodiment, the reaction conditions include a temperature of 20 ℃ to 28 ℃, such as 21 ℃, 22 ℃, 23 ℃, 24 ℃,25 ℃, 26 ℃, or 27 ℃ in a water environment containing polyurethane; and a pH of 5.5 to 6.5, for example 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4. In another preferred embodiment, the temperature may be 28 ℃. In another preferred embodiment, the pH is 6.0.

In a preferred embodiment, the polyurethane-containing aqueous environment is a marine environment or wastewater, such as industrial wastewater.

In a further specific embodiment, the polyurethane is a polyurethane microplastic.

In a specific embodiment, the enrichment may be performed one or more times, e.g., two, three times.

In a further specific embodiment, the enrichment medium 1L may comprise: 7g/L K ₂ HPO ₄ ；2g/L KH ₂ PO ₄ ；1g/L(NH ₄ ) ₂ SO ₄ ；0.1g/L MgSO ₄ ·7H ₂ O；0.001g/L ZnSO ₄ ·7H ₂ O；0.0001g/L CuSO ₄ ·5H ₂ O；0.01g/L FeSO ₄ ·7H ₂ O；0.002g/L MnSO ₄ ·7H ₂ O;0.3% polyurethane; the balance being distilled water.

In a preferred embodiment, the formulated enrichment medium is also subjected to a sterilization step, which is well known to the person skilled in the art, for example by autoclaving at high temperature. More preferably, the formulated enrichment medium is subjected to sterilization, cooling, and then antibiotic addition to inhibit bacterial growth during the enrichment process. The antibiotic is preferably ampicillin, chloramphenicol or a combination thereof. In the enrichment medium, the concentration of the added antibiotic is 100. Mu.g/mL.

In one embodiment, the method further comprises: culturing the enriched fungus in a separation medium suitable for separating salt tolerant cladosporium; and culturing the colonies separated in the separation medium in the purification medium.

The isolation medium is an oligotrophic fungal medium, which may be, for example, potato Dextrose Agar (PDA), brie agar (CDA), malt Extract Agar (MEA), yeast maltose agar (YM) or Sand Dextrose Agar (SDA). The total nutrient composition of each fungal medium can be as shown in table 1 below.

TABLE 1 Total nutrient Components of fungal Medium

In a preferred embodiment, the isolation medium is an oligotrophic PDA medium or SDA medium.

In this context, "total nutrient" refers to all nutrients contained in a medium commonly used in the art, such as an oxo brand CMA dry powder formulation commercially available from Thermo Fisher Scientific, and the nutrient contained in the resulting CMA medium is formulated according to the proportions shown in the commercial specification. The term "oligotrophic" refers to a method of reducing the concentration of a nutrient component in a medium to a concentration lower than that of a total nutrient fungal medium, for example, by dilution or the like, relative to the total nutrient component contained in a medium conventionally used in the art.

In a preferred embodiment, the isolation medium contains 10% to 50%, preferably 15% to 40%, such as 20%, 25%, 30% or 35%, more preferably 20% nutrition of the total nutrient medium. This is to simulate the marine environment, stimulating the growth of fungi that survive in an oligotrophic environment for a long period of time.

In one embodiment, the conditions of the culture in the isolation medium may include: the temperature is 24 ℃ to 28 ℃ under the condition that polyurethane is the sole carbon source, the pH value of the separation medium is 6.0 to 6.5, and the separation medium is cultured for 20 days to 25 days.

In a preferred embodiment, the conditions of the culture in the isolation medium may include: the temperature is 28 ℃ under the condition that polyurethane is the sole carbon source, the pH of the separation medium is 6.0, and the culture is carried out for 20 to 25 days.

In a preferred embodiment, the culturing in the isolation medium may be repeated one or more times, for example 2, 3, 4 or 5 times, preferably 2 to 3 times, until significant hyphae grow out. The culture in the isolation medium is preferably repeated 2 times.

In one embodiment, the method further cultures the colonies isolated in the isolation medium in a purification medium.

In a specific embodiment, the purification medium is a total nutrient fungal medium selected from, for example, PDA, CDA, MEA, YM or SDA.

In a preferred embodiment, the purification medium is a total nutrient PDA medium.

In a preferred embodiment, the purification step may be repeated one or more times, for example 2, 3, 4 or 5 times, preferably 2 to 3 times, until colonies containing the villous strain are obtained.

After enrichment, separation and purification, 1 salt-tolerant cladosporium strain with good polyurethane degradation effect is obtained. The bacterial colony morphological characteristics of the salt-tolerant cladosporium strain on a solid plate culture medium are shown in figure 1: the early colony is round, loose in texture, white in velvet shape, the central part of the middle colony is green, the edges are white, the velvet shape is green, the central part of the later colony is dark green and wider, and the outer ring is green and narrower. Fig. 2 shows the morphological characteristics of the strain under a microscope, from which it can be seen that: hypha of the strain (upper diagram of fig. 2) is developed, branched and colorless; conidiophores (lower panel of fig. 2) were shorter or slightly curved in peduncles.

-extracting DNA of the fungal strain to be identified;

amplification by PCR technique using primers ITS4 (SEQ ID NO: 2) and ITS5 (SEQ ID NO: 3), sequencing the amplified sequences; and

In summary, the invention provides a new solution to the problem of pollution of increasingly serious polyurethane waste microplastic in water environment, namely, the application of the salt-tolerant cladosporium fungus strain which has the advantages of high growth and proliferation speed, easy culture, low production cost and biological degradation polyurethane activity. The fungus strain can continuously degrade polyurethane microplastic contained in water body environment containing polyurethane, such as marine environment and industrial wastewater, thereby providing a treatment method of polyurethane pollutant with high degradation efficiency, environmental protection, no secondary pollution, low cost and easy operation.

Hereinafter, the present invention will be described in more detail in connection with exemplary embodiments. However, the exemplary embodiments disclosed herein are for illustrative purposes only and should not be considered as limiting the scope of the invention.

EXAMPLE 1 isolation and purification of Strain

Preparing enrichment culture solution (with polyurethane as the sole carbon source). 1L of the formulated enrichment medium comprises: 7g K ₂ HPO ₄ ；2g KH ₂ PO ₄ ；1g(NH ₄ ) ₂ SO ₄ ；0.1MgSO ₄ ·7H ₂ O；0.001g ZnSO ₄ ·7H ₂ O；0.0001g CuSO ₄ ·5H ₂ O；0.01g FeSO ₄ ·7H ₂ O；0.002g MnSO ₄ ·7H ₂ O;0.3% polyurethane. Make up to 1L with distilled water. The pH was adjusted to 6.0. After the prepared culture broth was sterilized and cooled, ampicillin and chloramphenicol (for inhibiting the growth of bacteria in the sample) were added to a final concentration of 100. Mu.g/mL, and mixed uniformly to prepare an enriched culture broth.

And (5) enrichment culture. Diluting the sample of the deep sea deposit of the east Pacific ocean 10 ^-1 Then 1mL of the diluted sample is sucked and is injected into the enrichment culture solution, and shake culture is carried out under the conditions of 28 ℃ and sufficient oxygen. When obvious hypha grows, 1mL of the culture solution with the hypha is extracted and is put into a new enrichment culture medium, and secondary enrichment culture is performed again under the same conditions. The enrichment culture requires about 20 to 25 days in total, and at this time, obvious hyphae grow out, i.e., enrichment is completed.

And (5) separating and purifying. A 20% nutrient PDA isolation medium (potato dextrose agar medium) was prepared containing 200.0g potato, 20.0g dextrose and 15.0g agar powder. The isolation medium also contained 100. Mu.g/mL ampicillin and chloramphenicol. Absorbing NO-containing substances of secondary enrichment culture ₃ ^- Is coated on 20% nutrient solutionAnd (3) uniformly coating the liquid on a culture medium flat plate, culturing at 25 ℃ until obvious bacterial colonies grow out, and picking bacterial colony hyphae to inoculate in a PDA culture medium to obtain pure fungi.

EXAMPLE 2 biological identification of fungi

The biological identification of fungi mainly comprises the following steps of: corn meal agar medium (CMA, see table 1 above) was first prepared and the plates were inverted with the prepared medium, with minimal thickness at the time of inversion. A loop of colonies was picked up with the inoculating loop and streaked in a "letter" shape on the medium. Two rectangular media were cut out with a scalpel in the streaked media, and were removed, covered with a cover slip, and incubated in an incubator at 25℃for 7 days. The dishes were placed on an inverted microscope (Olympus IX 51), representative colonies were found, and photographs were taken.

FIG. 1 shows the colony characteristics of the salt tolerant Acremonium strain of the invention on solid plate medium: the early colony is round, loose in texture, white in velvet shape, the central part of the middle colony is green, the edges are white, the velvet shape is green, the central part of the later colony is dark green and wider, and the outer ring is green and narrower. Fig. 2 further shows the morphological characteristics of the strain under a microscope, from which it can be seen that: hypha of the strain (upper diagram of fig. 2) is developed, branched and colorless; conidiophores (lower panel of fig. 2) were shorter or slightly curved in peduncles.

Example 3 analysis of Gene sequences

For the fungus which has obtained pure breed, the mycelium is scraped off and FastDNA is used ^TM SPIN Kit for Soil the kit extracts the DNA of the strain. The extracted DNA was amplified on a thermal cycler for the ITS sequences of the genome by primers for ITS4 (SEQ ID NO:2:5 '-TCCGTAGGTGAACCTGCGG-3') and ITS5 (SEQ ID NO:3:5 '-TCCTCCGCTTATTGATAGC-3'), the sequences being approximately 600bp in length. The PCR product of amplified ITS sequence (SEQ ID NO: 1) entrusts Shanghai Megaku sequencing company to perform 26S rDNA-ITS region gene sequence analysis, and after sequencing, the ITS sequence of fungi is subjected to BioEdit software to remove redundant sequence, and the peak is reservedAnd (3) comparing the sequences of the tidier parts by Blast analysis on the ITS sequences of the fungi, and determining the species status of the fungi according to the sequence similarity of 98-100 percent as a standard. The strain was identified as a salt-tolerant cladosporium (Cladosporium halotolerans) of the genus salt-tolerant cladosporium in combination with the morphology and microscopic mycelium structure observed in example 2 below.

The sequence of SEQ ID NO. 1 is as follows: GGAAGTAAAAAGTCGTAACAAGG TCTCCGTAGGTGAACCTGCGGAGGGATCATTACAAGTTGACCCCGGCCCTCGGGCCGGGATGTTCACAACCCTTTGTTGTCCGACTCTG TTGCCTCCGGGGCGACCCTGCCTCCGGGCGGGGGCCCCGGGTGGACATTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAATTTAATT AATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATT CAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTC GCTTGGTATTGGGCGACGCGGTCCGCCGCGCGCCTCAAATCGACC GGCTGGGTCTTTCGTCCCCTCAGCGTTGTGGAAACTATTCGCTAA AGGGTGCCGCGGGAGGCCACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA TCAATAA

Example 4 detection of the ability of Acremonium saliicum to degrade polyurethane at different temperatures

Preparing a culture medium with polyurethane as a sole carbon source: each 1L of distilled water contains 7. 7g K ₂ HPO ₄ 、 2g KH ₂ PO ₄ 、1g(NH ₄ ) ₂ SO ₄ ；0.1g MgSO ₄ ·7H ₂ O、0.001g ZnSO ₄ ·7H ₂ O、0.0001g CuSO ₄ ·5H ₂ O、0.01g FeSO ₄ ·7H ₂ O、0.002g MnSO ₄ ·7H ₂ O, 0.3% polyurethane, and pH was adjusted to 6.0 with 50% hydrochloric acid. The culture solution is filled in triangular bottles, 100ml of culture solution is packed in each bottle, and after packing, the culture solution is sterilized (antibiotics are added into the culture medium to prevent bacteria from growing).

The sterilized medium is then inoculated with fungi, after which the flask is sealed. Respectively placing into environments (three shake flasks are arranged at each temperature gradient) at 4 ℃, 10 ℃, 20 ℃, 28 ℃ and 35 ℃ for shake culture at 120r/min for 4 days, taking out 1mL of the uniformly mixed bacterial liquid from the triangular flask every day from day 0 to day 4, and measuring the OD600 absorbance of the bacterial liquid in an EP tube by an enzyme-labeled instrument, wherein the results are shown in the table 2 below. The degradation ability of the strain to polyurethane was judged by plotting the change in OD600 value and comparing it with the OD600 value of a blank medium (day 0), and the results are shown in FIG. 3. As can be seen from table 2 and fig. 3, the strain of the present invention can effectively degrade polyurethane under the condition that polyurethane is the only carbon source and has a strong polyurethane degradation ability, wherein the degradation effect of polyurethane is higher than that of the lower temperature culture groups of 4 ℃ and 10 ℃ and 35 ℃ at high temperature under the culture conditions of 20 ℃ and 28 ℃, and the degradation effect is found to be the best under the culture conditions of 28 ℃.

TABLE 2 polyurethane degradation curves of salt-tolerant Acremonium at different temperatures

Example 5 detection of the ability of Acremonium salt tolerance to degrade polyurethane at different pH values

Preparing a culture medium with polyurethane as a sole carbon source: every 1. 1L H ₂ O contains 7. 7g K ₂ HPO ₄ ；2g KH ₂ PO ₄ ；1g(NH ₄ ) ₂ SO ₄ ；0.1MgSO ₄ ·7H ₂ O；0.001g ZnSO ₄ ·7H ₂ O；0.0001g CuSO ₄ ·5H ₂ O；0.01g FeSO ₄ ·7H ₂ O；0.002g MnSO ₄ ·7H ₂ O;0.3% polyurethane, the pH of the medium was adjusted to 5.5, 6.0, 6.5, 7.0, 7.5 (three shake flasks per pH gradient) with 50% hydrochloric acid and 1M NaOH, respectively. The culture solution is filled in triangular bottles, 100ml of culture solution is packed in each bottle, and after packing, the culture solution is sterilized and antibiotics are added to prevent bacteria from growing.

Then, fungi were inoculated in the sterilized medium, the triangular flask was sealed, and shake-cultured at 120r/min in an environment of 28℃for 4 days, 1mL of the homogenized bacterial solution was taken out of the triangular flask every day from day 0 to day 4, and the absorbance of the bacterial solution was measured by an ELISA reader in an EP tube, and the results are shown in Table 3 below. The degradation ability of the strain to polyurethane was determined by plotting the change in OD600 value and comparing it with the OD600 value of a blank medium (day 0), and the results are shown in FIG. 4. As can be seen from Table 3 and FIG. 4, the strain of the present invention can effectively degrade polyurethane under the condition that polyurethane is the only carbon source and has a strong polyurethane degrading ability, wherein the polyurethane degrading effect is better than other groups under the culture conditions of pH 6.0 and pH 6.5, and the degrading effect is best under the condition of pH 6.0.

TABLE 3 polyurethane degradation curves for Cladosporium halotolerans at different pH' s

Sequence listing

<110> institute of natural resources third sea

<120> polyurethane degrading fungus strain, its separation method and use

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 570

<212> DNA

<213> salt-tolerant Cladosporium (Cladosporium halotolerans)

<400> 1

ggaagtaaaa agtcgtaaca aggtctccgt aggtgaacct gcggagggat cattacaagt 60

tgaccccggc cctcgggccg ggatgttcac aaccctttgt tgtccgactc tgttgcctcc 120

ggggcgaccc tgcctccggg cgggggcccc gggtggacat ttcaaactct tgcgtaactt 180

tgcagtctga gtaaatttaa ttaataaatt aaaactttca acaacggatc tcttggttct 240

ggcatcgatg aagaacgcag cgaaatgcga taagtaatgt gaattgcaga attcagtgaa 300

tcatcgaatc tttgaacgca cattgcgccc cctggtattc cggggggcat gcctgttcga 360

gcgtcatttc accactcaag cctcgcttgg tattgggcga cgcggtccgc cgcgcgcctc 420

aaatcgaccg gctgggtctt tcgtcccctc agcgttgtgg aaactattcg ctaaagggtg 480

ccgcgggagg ccacgccgta aaacaacccc atttctaagg ttgacctcgg atcaggtagg 540

gatacccgct gaacttaagc atatcaataa 570

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tccgtaggtg aacctgcgg 19

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tcctccgctt attgatagc 19

Claims

1. A fungus strain, which is a salt-tolerant cladosporium (Cladosporium halotolerans), and which is deposited at the China center for type culture collection, accession number cctccc M2021967, of the university of wuhan in the mountain area of wuhan, martial arts, hubei province, on day 08, 02.

2. Use of the fungal strain of claim 1 for degrading polyurethane.

3. Use according to claim 2, wherein the polyurethane is a polyurethane from a water environment.

4. The use of claim 3, wherein the aquatic environment is a marine environment or wastewater.

5. The use according to claim 4, wherein the waste water is industrial waste water.

6. Use according to claim 2 or 3, wherein the polyurethane is a polyurethane microplastic having a particle size of less than 5 mm.

7. A method of degrading polyurethane, the method comprising: contacting the fungal strain of claim 1 with polyurethane in a water environment under reaction conditions suitable for reaction with polyurethane in the water environment.

8. The method of claim 7, wherein the reaction conditions comprise a temperature of 20 ℃ to 28 ℃ and a pH of 5.5 to 6.5 in a water environment containing polyurethane.

9. The method of claim 8, wherein the reaction conditions comprise a temperature of 28 ℃ and a pH of 6.0 in the polyurethane-containing wastewater.

10. The method of claim 7 or 8, wherein the polyurethane-containing aqueous environment is a polyurethane-containing marine environment or wastewater.

11. The method of claim 10, wherein the wastewater is industrial wastewater.

12. The method of any of claims 7-9, wherein the polyurethane is a polyurethane microplastic having a particle size of less than 5 mm.

13. A method for identifying a fungal strain, the method comprising:

-extracting DNA of the fungal strain to be identified;

-sequencing the amplified sequence obtained by amplifying with the PCR technique using the primers ITS4 of the sequence shown in SEQ ID NO. 2 and ITS5 of the sequence shown in SEQ ID NO. 3; and

-sequence alignment of said sequenced sequence with the ITS sequence shown in SEQ ID No. 1 of the fungal strain salt-tolerant cladosporium (Cladosporium halotolerans) of claim 1 to determine whether said fungal strain is a fungal strain salt-tolerant cladosporium of claim 1; the sequence alignment is based on 100% similarity.