CN114214204A

CN114214204A - Polyurethane degrading fungus strain and its separation method and use

Info

Publication number: CN114214204A
Application number: CN202111240865.1A
Authority: CN
Inventors: 骆祝华; 徐炜; 胡杰鸽; 杨帅
Original assignee: Third Institute of Oceanography MNR
Current assignee: Third Institute of Oceanography MNR
Priority date: 2021-10-25
Filing date: 2021-10-25
Publication date: 2022-03-22
Anticipated expiration: 2041-10-25
Also published as: CN114214204B

Abstract

The present invention relates to the field of environmental microbiology. Specifically, the invention relates to a Cladosporium halotolerans (Cladosporium halotolerans) fungus strain capable of degrading polyurethane, which is obtained by separating and purifying deep sea sediments in the east Pacific ocean obtained by inspection of 50 voyage science in the Hongdong No. 03 China. The fungus strain has the capability of degrading polyurethane, can generate degrading enzyme under the condition that only polyurethane is used as a unique carbon source, and can be used for degrading polyurethane micro-plastic in a water body environment.

Description

Polyurethane degrading fungus strain and its separation method and use

Technical Field

The present invention relates to the field of environmental microbiology. Specifically, the invention relates to a fungus strain with polyurethane degradation activity, in particular to a fungus strain capable of effectively degrading polyurethane, and an isolation method and application thereof.

Background

The micro plastic is a new potential of ocean environmental pollution at present, and plays a key role in removing the micro plastic in the water body in the aspect of ocean environmental protection. As a high molecular compound which is difficult to degrade, the micro plastic is accumulated in the marine environment for a long time, and the health of a marine ecosystem is seriously threatened. On one hand, the micro plastic is easy to be ingested by marine animals, and further mechanical damage is caused to the marine animals, such as blockage of esophagus, generation of false satiety and the like, and the growth and health of the marine animals are influenced. Wherein low-nutrition marine organisms such as zooplankton and the like can absorb micro-plastics more easily, and the micro-plastics are transmitted and amplified through a food net to cause the biological accumulation effect. On the other hand, the micro plastic can also release toxic substances such as plasticizer and the like to the marine environment, has endocrine disrupting toxicity and influences the reproduction and development of marine organisms. In addition, the micro plastic can also enrich high-concentration persistent organic pollutants and heavy metals, become carriers of toxic chemical substances in seawater, generate biological amplification effect and generate ecological toxicological effect on marine organisms. In conclusion, the micro-plastics are the new potential of the current ocean environmental pollution, and the removal of the micro-plastics in the water body can play a key role in the aspect of ocean ecological protection.

Polyurethane is the most common one of the micro-plastics, and biodegradation of polyurethane is a very effective and interesting method for removing polyurethane from water bodies. Therefore, fungi capable of degrading polyurethane micro-plastics efficiently without secondary pollution is desired, and a technical scheme capable of efficiently treating polyurethane micro-plastic pollutants in the ocean environment is developed and designed based on the fungi, so that a novel method and a novel process for biologically degrading polyurethane are realized.

Disclosure of Invention

The invention aims to provide a fungus strain with polyurethane degrading activity. More particularly, the present invention provides a fungal strain useful for treating aqueous environments, particularly aqueous environments containing polyurethane, such as marine environments.

The inventor cultures the deep sea sediments of the east Pacific ocean obtained by 50 voyage scientific investigation of Yanghong No. 03 China ocean in an enrichment medium taking polyurethane as a unique carbon source, and then separates, purifies and identifies to obtain the Cladosporium halophilans CH strain, and finds that the strain has polyurethane degrading activity and can degrade the polyurethane micro-plastics in the water environment. During degradation, the dissolution changes from cloudy to clear. Thus, the present invention has been completed.

Accordingly, in a first aspect, the present invention provides a strain of fungus, wherein the fungus is Cladosporium halophilans CH, and the strain is deposited at the china type culture collection center of eight wuhan university in the flood mountainous area of wuhan city, north hu by 2021 year 08-02, with the deposition registration number being CCTCC NO: m2021967.

In a second aspect, the present invention provides the use of a fungal strain for degrading a polyurethane.

In a third aspect, the present invention provides a method of degrading a polyurethane, the method comprising: the fungal strain according to the first aspect of the present invention is contacted with a polyurethane in an aqueous environment under reaction conditions suitable for reacting with the polyurethane in the aqueous environment.

In a fourth aspect, the present invention provides a method for obtaining a strain of Cladosporium halophilans CH having polyurethane degrading activity, comprising: and (3) incubating the sample containing the cladosporium halophilum in an enrichment culture medium taking polyurethane as a unique carbon source until hyphae are observed for enrichment.

In a fifth aspect, the present invention provides a method for identifying a fungal strain, the method comprising:

-extracting the DNA of the fungal strain to be identified;

-using primers ITS4(SEQ ID NO:2) and ITS5(SEQ ID NO:3) and amplifying by PCR technique, sequencing the resulting amplified sequence; and

-comparing the sequence with the ITS sequence (SEQ ID NO:1) of the fungal strain Cladosporium halodurans CH of claim 1 to determine whether the fungal strain is Cladosporium halodurans of claim 1; the sequence alignment is based on 100% similarity.

In conclusion, the invention provides the cladosporium halophilum fungus strain which has the advantages of high growth and proliferation speed, easy culture, low production cost and biodegradable polyurethane activity. The fungus strain can continuously degrade polyurethane micro-plastics contained in water body environments containing polyurethane, such as marine environments and industrial wastewater, thereby providing a polyurethane pollutant treatment method which has the advantages of high degradation efficiency, environmental protection, no secondary pollution, low cost and easy operation. Therefore, the cladosporium halophila fungus strain can realize efficient degradation of polyurethane in an environmental water sample, and provides a new solution for the increasingly serious pollution problem of polyurethane waste micro-plastics in a water body environment.

Drawings

The technical solutions and benefits of the present invention will become apparent to those skilled in the art upon a reading of the following detailed description and a review of the associated drawings.

FIG. 1 is the colonial morphological characteristics of the Cladosporium haloleransCH strain according to the invention in its early, middle and late stages.

FIG. 2 is a microscopic morphological feature of Cladosporium haloleransCH strain according to the present invention, the upper image is a photograph of only hyphae, and the lower image is a photograph of hyphae with spores.

FIG. 3 is a graph showing the change in OD600 value of Cladosporium halotoleranscH strain according to the present invention at various temperatures in a medium containing polyurethane as a sole carbon source.

FIG. 4 is a graph showing the change in OD600 values of Cladosporium halotoleranscH strain according to the present invention in a medium containing polyurethane as a sole carbon source at various pHs.

Detailed Description

The present invention is described in detail below. It is to be understood that the following description is intended to illustrate the present invention by way of example only and is not intended to limit the scope of the invention, which is defined by the appended claims. Also, those skilled in the art will appreciate that modifications can be made to the disclosed embodiments without departing from the spirit and scope of the invention.

The invention adopts a fungus capable of degrading polyurethane micro-plastics to develop and design a fungus strain capable of effectively treating polyurethane micro-plastics pollutants in the ocean environment, can realize the quick start and stable operation of a novel method and a novel process for biologically degrading polyurethane, can improve the degradation efficiency and the degradation effect, is expected to overcome the problem of secondary pollution in the traditional treatment method, realizes a more environment-friendly micro-plastics degradation method, and provides a possible solution for solving the increasingly serious problem of pollution of polyurethane micro-plastics to the ecological environment.

As described above, the present inventors obtained a Cladosporium halodurans (Cladosporium halolerans CH) strain by culturing the deep sea sediments of the Topacific ocean in an enrichment medium using polyurethane as a sole carbon source, followed by separation, purification and identification, and found that the strain has a biological activity of degrading polyurethane and can degrade an aqueous solution containing polyurethane. During degradation, the solution turns clear from cloudy.

In conclusion, the invention provides a fungus strain with polyurethane degrading activity, which can continuously degrade polyurethane micro-plastics contained in water body environment such as marine environment and industrial wastewater, thereby providing a new solution for the increasingly serious pollution problem of the polyurethane waste micro-plastics in the water body environment.

In a first aspect, the invention provides a fungus strain, wherein the fungus is Cladosporium halophilans CH, and the strain is preserved in China center for type culture Collection of eight Wuhan university in flood mountainous area, Wuhan City, Hubei province at 08-02 th 2021, with the preservation registration number of CCTCC NO: m2021967.

This strain was obtained using the deep sea sediments of the east pacific ocean and enrichment medium obtained from 50 voyage scientific investigations of the chinese atlantic, yang hong 03, as described above and below. Specifically, the deep sea sediment of the east Pacific ocean is used for being cultured in an enrichment medium which takes polyurethane as a sole carbon source for a period of time, such as 20-25 days, until obvious hyphae grow out, and the enrichment is finished. The enriched fungi are subsequently isolated, purified and characterized, whereby the above-mentioned deposited strains are obtained.

In a second aspect, there is provided the use of a fungal strain according to the first aspect for degrading polyurethane.

As demonstrated in the examples section herein, the inventors found that when the isolated and purified cladosporium halodurans was further cultured in a liquid medium containing polyurethane as the sole carbon source, the fungal strain of the invention was found to successfully hydrolyze the ester bonds in polyurethane. That is, the fungus obtained in the above manner can be used to degrade polyurethane.

As used herein, the term "degraded polyurethane" refers to ester linkages in hydrolyzed polyurethanes.

In a specific embodiment, the polyurethane is a polyurethane micro-plastic. As used herein, the term "microplastic" refers to plastic particles of very small particle size as well as textile fibers. Plastic fibers, particles or films with a particle size of less than 5mm are currently generally considered to be micro-plastics, and in fact many micro-plastics can be on the order of microns or even nanometers and are invisible to the naked eye, and thus are also visually compared to "PM 2.5" in the ocean.

In a particular embodiment, the polyurethane is from an aquatic environment such as a marine environment or wastewater.

In a further specific embodiment, the polyurethane is from industrial wastewater.

In a further specific embodiment, the polyurethane is a polyurethane micro plastic having a particle size of less than 5 mm.

In a third aspect, the present invention relates to a method of degrading a polyurethane, the method comprising: contacting the fungal strain according to the first aspect with a polyurethane in an aqueous environment under reaction conditions suitable for reacting with the polyurethane in the aqueous environment.

In a particular embodiment, the reaction conditions include a temperature in the range of 20 ℃ to 28 ℃, for example 21 ℃, 22 ℃, 23 ℃, 24 ℃, 25 ℃, 26 ℃ or 27 ℃ in an aqueous environment containing the polyurethane; and a pH of 5.5 to 6.5, e.g. 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4. In another preferred embodiment, the temperature may be 28 ℃. In another preferred embodiment, the pH is 6.0.

In a preferred embodiment, the aqueous environment containing polyurethane is a marine environment or wastewater, such as industrial wastewater.

In a further specific embodiment, the polyurethane is a polyurethane micro-plastic.

In a particular embodiment, the enrichment may be performed one or more times, such as two, three times.

In a further specific embodiment, the enrichment medium 1L may comprise: 7g/L K₂HPO₄；2g/L KH₂PO₄；1g/L(NH₄)₂SO₄；0.1g/L MgSO₄·7H₂O；0.001g/L ZnSO₄·7H₂O；0.0001g/L CuSO₄·5H₂O；0.01g/L FeSO₄·7H₂O；0.002g/L MnSO₄·7H₂O; 0.3% polyurethane; and the balance of distilled water.

In a preferred embodiment, the formulated enrichment medium is further subjected to a sterilization step, which is well known to the person skilled in the art, for example by autoclaving. More preferably, the formulated enrichment medium is sterilized, cooled, and then supplemented with antibiotics to inhibit bacterial growth during the enrichment process. The antibiotic is preferably ampicillin, chloramphenicol, or a combination thereof. In the enrichment medium, the concentration of the antibiotic added was 100. mu.g/mL.

In one embodiment, the method further comprises: culturing the enriched fungus in an isolation medium suitable for isolating cladosporium halodurans; and culturing the colony separated in the separation medium in a purification medium.

The isolation medium is an oligotrophic fungal culture medium, which may be, for example, potato dextrose agar medium (PDA), chequer's medium (CDA), malt extract agar Medium (MEA), yeast maltose agar medium (YM), or saxaglucose agar medium (SDA). The total nutrient composition of each fungal culture can be as shown in table 1 below.

TABLE 1 Total nutrient composition of fungal culture Medium

In a preferred embodiment, the isolation medium is an oligotrophic PDA medium or SDA medium.

As used herein, "total nutrient" refers to all nutrients contained in a medium that is conventional in the art, such as, for example, the nutrients contained in a CMA medium prepared in the proportions indicated in the specifications of the commercial product, as a dry powder preparation of Oxoid brand CMA commercially available from Thermo Fisher Scientific corporation. "oligotrophic" is a culture medium that contains less than all of the nutrients normally used in the art, for example, by dilution or the like, the concentration of the nutrient in the culture medium being lower than the concentration of a fully nutritious fungal culture medium.

In a preferred embodiment, the isolation medium contains 10% to 50%, preferably 15% to 40%, such as 20%, 25%, 30% or 35%, more preferably 20% of the total nutrient medium. This is to simulate the marine environment and stimulate the growth of fungi that survive in oligotrophic environments for long periods.

In one embodiment, the conditions for culturing in the isolation medium may include: under the condition that polyurethane is used as a sole carbon source, the temperature is 24-28 ℃, the pH value of the separation culture medium is 6.0-6.5, and the culture is carried out for 20-25 days.

In a preferred embodiment, the conditions for culturing in the isolation medium may include: under the condition that polyurethane is used as a sole carbon source, the temperature is 28 ℃, the pH value of the separation culture medium is 6.0, and the culture is carried out for 20 days to 25 days.

In a preferred embodiment, the culturing in the isolation medium may be repeated one or more times, for example 2, 3, 4 or 5 times, preferably 2 to 3 times, until there is significant hyphal growth. The cultivation in the isolation medium is preferably repeated 2 times.

In one embodiment, the method further comprises culturing the colonies isolated in the isolation medium in a purification medium.

In a specific embodiment, the purification medium is a whole nutrient fungal culture selected from, for example, PDA, CDA, MEA, YM or SDA.

In a preferred embodiment, the purification medium is a fully nutrient PDA medium.

In a preferred embodiment, the purification step may be repeated one or more times, for example 2, 3, 4 or 5 times, preferably 2 to 3 times, until colonies containing the villous strain are obtained.

After enrichment, separation and purification, 1 salt-tolerant cladosporium strain with better degradation effect on polyurethane is obtained. The colony morphology characteristics of the salt-tolerant cladosporium strain on the solid plate culture medium are shown in figure 1: early bacterial colony is circular, and the texture is loose, white fine hair form, and middle stage bacterial colony central part is green, and the edge is white, and fine hair form, later stage bacterial colony central part are green, and the center circle is dark green and broad, and the outer lane is green and narrower. FIG. 2 shows the morphological characteristics of the bacterial cells of this strain under a microscope, and it can be seen from this figure that: the strain has developed hypha (upper diagram of FIG. 2), branched and colorless; conidiophores (lower panel of FIG. 2) have shorter or slightly curved peduncles.

-extracting the DNA of the fungal strain to be identified;

-sequencing the resulting amplified sequence using primers ITS4(SEQ ID NO:2) and ITS5(SEQ ID NO:3) and using PCR amplification; and

In conclusion, the invention provides a new solution for the increasingly serious pollution problem of the polyurethane waste micro-plastic in the water environment, namely, the salt-tolerant cladosporium fungus strain which has the advantages of high growth and proliferation speed, easy culture, low production cost and biodegradation activity is used. The fungus strain can continuously degrade polyurethane micro-plastics contained in water body environments containing polyurethane, such as marine environments and industrial wastewater, thereby providing a polyurethane pollutant treatment method which has the advantages of high degradation efficiency, environmental protection, no secondary pollution, low cost and easy operation.

Hereinafter, the present invention will be described in more detail with reference to exemplary embodiments. However, the exemplary embodiments disclosed herein are for illustrative purposes only and should not be taken as illustrating the scope of the present invention.

Example 1 Strain isolation and purification

Preparing an enrichment culture solution (polyurethane is used as a sole carbon source). 1L of the formulated enrichment medium included: 7g K₂HPO₄；2g KH₂PO₄；1g(NH₄)₂SO₄；0.1MgSO₄·7H₂O；0.001g ZnSO₄·7H₂O；0.0001g CuSO₄·5H₂O；0.01g FeSO₄·7H₂O；0.002g MnSO₄·7H₂O; 0.3% of polyurethane. Make up to 1L with distilled water. The pH was adjusted to 6.0. The prepared culture solution is sterilized and added with 100 mug/m of final concentration after coolingAmpicillin and chloramphenicol (for inhibiting the growth of bacteria in the sample) were mixed well to make an enriched culture.

And (5) enrichment culture. Diluting 10 a sample of a deep sea sediment from the east Pacific ocean^-1Then, 1mL of the diluted sample was aspirated and injected into the enrichment medium, and shake-cultured at 28 ℃ under a sufficient oxygen atmosphere. When the growth of hyphae is obvious, 1mL of the culture solution with hyphae is extracted and injected into a new enrichment medium, and secondary enrichment culture is carried out again under the same conditions. The enrichment culture takes about 20 to 25 days in total, and obvious hyphae grow out, namely the enrichment is completed.

And (5) separating and purifying. A20% nutrient PDA isolation medium (potato dextrose agar medium) was prepared which contained 200.0g of potato, 20.0g of glucose and 15.0g of agar powder. The isolation medium also contained 100. mu.g/mL ampicillin and chloramphenicol. Absorbing NO-containing matter of secondary enrichment culture₃ ^-The enriched culture solution is coated on a culture medium plate with 20% of nutrition, then the liquid on the plate is uniformly coated, when obvious bacterial colonies grow out after the culture is carried out at 25 ℃, hyphae of each bacterial colony are selected and inoculated in a PDA culture medium, and pure fungi are obtained.

Example 2 biological identification of fungi

The biological identification of the fungus mainly identifies the microstructure of the hypha of the fungus, and comprises the following specific steps: corn meal agar medium (CMA, see table 1 above) was first prepared and the plate was inverted with this prepared medium as thin as possible when inverted. A loop of the colony was picked with an inoculating loop and streaked in a zigzag pattern on the medium. Two rectangular culture mediums were cut out of the scribed culture mediums with a scalpel, taken out, put on a cover glass, and cultured in an incubator at 25 ℃ for 7 days. Representative colonies were found by placing the plates in an inverted microscope (Olympus IX51) and pictures were taken.

FIG. 1 shows the colonial characteristics exhibited by the cladosporium halotolerant strain of the invention on solid plate medium: early bacterial colony is circular, and the texture is loose, white fine hair form, and middle stage bacterial colony central part is green, and the edge is white, and fine hair form, later stage bacterial colony central part are green, and the center circle is dark green and broad, and the outer lane is green and narrower. FIG. 2 further shows the morphological characteristics of the bacterial cells of the strain under the microscope, and it can be seen from the figure that: the strain has developed hypha (upper diagram of FIG. 2), branched and colorless; conidiophores (lower panel of FIG. 2) have shorter or slightly curved peduncles.

Example 3 Gene sequence analysis

The pure fungus is subjected to hyphae scraping, and FastDNA is used^TMThe SPIN Kit for Soil Kit extracts the DNA of the strain. The extracted DNA was used to amplify the ITS sequences of the genome, which were approximately 600bp in length, on a thermal cycler using primers for ITS4(SEQ ID NO: 2: 5'-TCCGTAGGTGAACCTGCGG-3') and ITS5(SEQ ID NO: 3: 5'-TCCTCCGCTTATTGATAGC-3'). The PCR product of the amplified ITS sequence (SEQ ID NO:1) is entrusted to Shanghai Meiji sequencing company to carry out 26S rDNA-ITS region gene sequence analysis, after the sequencing is successful, redundant sequences of the ITS sequence of the fungus are removed by using BioEdit software, sequences of parts with regular wave crests are reserved, then Blast analysis comparison is carried out on the ITS sequence of the fungus, and the fungal species position is determined according to the standard of 98-100% of sequence similarity. The strain was identified as Cladosporium halophila (Cladosporium halotolerans) of the genus Cladosporium, combining the morphology and microscopic hyphal structure observed in example 2 below.

The sequence of SEQ ID NO 1 is as follows: GGAAGTAAAAAGTCGTAACAAGG TCTCCGTAGGTGAACCTGCGGAGGGATCATTACAAGTTGACCCC GGCCCTCGGGCCGGGATGTTCACAACCCTTTGTTGTCCGACTCTG TTGCCTCCGGGGCGACCCTGCCTCCGGGCGGGGGCCCCGGGTGG ACATTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAATTTAATT AATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGA TGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATT CAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATT CCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTC GCTTGGTATTGGGCGACGCGGTCCGCCGCGCGCCTCAAATCGACC GGCTGGGTCTTTCGTCCCCTCAGCGTTGTGGAAACTATTCGCTAA AGGGTGCCGCGGGAGGCCACGCCGTAAAACAACCCCATTTCTAA GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA TCAATAA

Example 4 detection of degradation ability of Cladosporium halodurans on polyurethane at different temperatures

Preparing a culture medium with polyurethane as a unique carbon source: the distilled water per 1L contains 7g K₂HPO₄、 2g KH₂PO₄、1g(NH₄)₂SO₄；0.1g MgSO₄·7H₂O、0.001g ZnSO₄·7H₂O、0.0001g CuSO₄·5H₂O、0.01g FeSO₄·7H₂O、0.002g MnSO₄·7H₂O, 0.3% polyurethane, pH adjusted to 6.0 with 50% hydrochloric acid. The above culture solution is filled into triangular flasks, 100ml of the culture solution is filled into each flask, and the flasks are sterilized after filling (antibiotic is added into the culture medium to prevent bacterial growth).

The culture medium after sterilization was then inoculated with fungi, after which the flasks were sealed. The cells were shake-cultured at 120r/min for 4 days in an environment of 4 ℃, 10 ℃, 20 ℃, 28 ℃ and 35 ℃ (three shake flasks were provided for each temperature gradient), 1mL of the mixed bacterial solution was taken out of the triangular flask every day from day 0 to day 4 and then placed in an EP tube, and OD600 absorbance was measured by an enzyme-labeling instrument, and the results are shown in Table 2 below. The change curve was made based on the change in OD600 value, and this was compared with the OD600 value of the blank medium (day 0), whereby the degradation ability of the bacterial species for polyurethane was judged, and the results are shown in FIG. 3. As can be seen from Table 2 and FIG. 3, the strain of the present invention can effectively degrade polyurethane under the condition that polyurethane is the sole carbon source and has a strong polyurethane degradation ability, wherein the degradation effect of polyurethane under the culture conditions of 20 ℃ and 28 ℃ is higher than that of the culture group of lower temperature of 4 ℃ and 10 ℃ and higher temperature of 35 ℃, and the degradation effect under the culture condition of 28 ℃ is found to be the best.

TABLE 2 polyurethane degradation curves of cladosporium halophilum at different temperatures

Example 5 detection of degradation ability of cladosporium halophilum to polyurethane at different pH

Preparing a culture medium with polyurethane as a unique carbon source: each 1L H₂O contains 7g K₂HPO₄；2g KH₂PO₄；1g(NH₄)₂SO₄；0.1MgSO₄·7H₂O；0.001g ZnSO₄·7H₂O；0.0001g CuSO₄·5H₂O；0.01g FeSO₄·7H₂O；0.002g MnSO₄·7H₂O; 0.3% polyurethane, the pH of the medium was adjusted to 5.5, 6.0, 6.5, 7.0, 7.5 with 50% hydrochloric acid and 1M NaOH (three flasks per pH gradient), respectively. Packaging the above culture solution in triangular flask, subpackaging each flask with 100ml culture solution, sterilizing after subpackaging, and adding antibiotic to prevent bacteria growth.

Then, the sterilized culture medium was inoculated with fungi, the flask was sealed, and the flask was placed in an environment of 28 ℃ and cultured with shaking at 120r/min for 4 days, and from day 0 to day 4, 1mL of the mixed bacterial solution was taken out of the flask every day and measured for OD600 absorbance by a microplate reader in an EP tube, and the results are shown in table 3 below. The degradation ability of the strain to polyurethane was judged by plotting the change in OD600 value and comparing it with that of the blank medium (day 0), and the results are shown in FIG. 4. As can be seen from Table 3 and FIG. 4, the strain of the present invention can effectively degrade polyurethane under the condition that polyurethane is the sole carbon source and has a strong ability to degrade polyurethane, wherein the polyurethane degradation effect is better than that of other groups under the culture conditions of pH 6.0 and 6.5, and the degradation effect is the best under the condition of pH 6.0.

TABLE 3 degradation curves for Cladosporium halotolerans polyurethanes at different pH' s

Sequence listing

<110> third Marine institute of Natural resources department

<120> polyurethane degrading fungus strain and its separation method and use

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 570

<212> DNA

<213> Cladosporium halodurans (Cladosporium halodurans)

<400> 1

ggaagtaaaa agtcgtaaca aggtctccgt aggtgaacct gcggagggat cattacaagt 60

tgaccccggc cctcgggccg ggatgttcac aaccctttgt tgtccgactc tgttgcctcc 120

ggggcgaccc tgcctccggg cgggggcccc gggtggacat ttcaaactct tgcgtaactt 180

tgcagtctga gtaaatttaa ttaataaatt aaaactttca acaacggatc tcttggttct 240

ggcatcgatg aagaacgcag cgaaatgcga taagtaatgt gaattgcaga attcagtgaa 300

tcatcgaatc tttgaacgca cattgcgccc cctggtattc cggggggcat gcctgttcga 360

gcgtcatttc accactcaag cctcgcttgg tattgggcga cgcggtccgc cgcgcgcctc 420

aaatcgaccg gctgggtctt tcgtcccctc agcgttgtgg aaactattcg ctaaagggtg 480

ccgcgggagg ccacgccgta aaacaacccc atttctaagg ttgacctcgg atcaggtagg 540

gatacccgct gaacttaagc atatcaataa 570

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tccgtaggtg aacctgcgg 19

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tcctccgctt attgatagc 19

Claims

1. A fungus strain, wherein the fungus is Cladosporium halophilans CH, the strain is preserved in the China center for type culture collection of eight Wuhan university in the flood mountainous area of Wuhan City, Hubei province at 2021, 08 and 02 months, and the preservation registration number is CCTCC NO: m2021967.

2. Use of the fungal strain of claim 1 for degrading polyurethane.

3. Use according to claim 2, wherein the polyurethane is a polyurethane from an aqueous environment, such as a marine environment, or waste water, such as industrial waste water, such as a polyurethane micro plastic with a particle size of less than 5 mm.

4. A method of degrading a polyurethane, the method comprising: contacting the fungal strain of claim 1 with a polyurethane in an aqueous environment under reaction conditions suitable for reacting with the polyurethane in the aqueous environment.

5. The method according to claim 4, wherein the reaction conditions comprise a temperature of 20 ℃ to 28 ℃, preferably 28 ℃, and a pH of 5.5 to 6.5, preferably 6.0, in an aqueous environment containing polyurethane, preferably wastewater containing polyurethane.

6. A method according to claim 4 or 5, wherein the aqueous environment containing polyurethane is a marine environment containing polyurethane or a waste water such as an industrial waste water.

7. A method according to claim 4 or 5, wherein the polyurethane is a polyurethane micro-plastic having a particle size of less than 5 mm.

8. A method for obtaining a Cladosporium halophilans CH fungal strain with polyurethane degrading activity comprising: incubating a sample containing cladosporium halodurans in an enrichment medium using polyurethane as a unique carbon source until hyphae are observed for enrichment; preferably, the enrichment may be performed one or more times, e.g. two, three times;

specifically, the enrichment medium 1L comprises: 7g/L K₂HPO₄；2g/L KH₂PO₄；1g/L(NH₄)₂SO₄；0.1g/L MgSO₄·7H₂O；0.001g/L ZnSO₄·7H₂O；0.0001g/L CuSO₄·5H₂O；0.01g/L FeSO₄·7H₂O；0.002g/L MnSO₄·7H₂O; 0.3% polyurethane; and the balance of distilled water;

preferably, the method further comprises: culturing the enriched fungus in an isolation medium suitable for isolating cladosporium halodurans; and culturing the colony separated from the separation culture medium in a purification culture medium; the isolation medium is, for example, an oligotrophic fungal medium; the purification medium is, for example, a total nutrient fungal medium; the fungal culture medium is, for example, potato dextrose agar medium PDA, Cnah's medium CDA, malt extract agar medium MEA, yeast maltose agar medium YM or Sasa's dextrose agar medium SDA.

9. A method for identifying a fungal strain, the method comprising:

-extracting the DNA of the fungal strain to be identified;

-comparing the sequence with the ITS sequence (SEQ ID NO:1) of the fungal strain Cladosporium halodurans (Cladosporium halotolerans) of claim 1 to determine whether the fungal strain is Cladosporium halodurans of claim 1; the sequence alignment is based on 100% similarity.