CN114182039A - Primer group and kit for identifying ochre floribunda and application of primer group and kit - Google Patents

Primer group and kit for identifying ochre floribunda and application of primer group and kit Download PDF

Info

Publication number
CN114182039A
CN114182039A CN202111490147.XA CN202111490147A CN114182039A CN 114182039 A CN114182039 A CN 114182039A CN 202111490147 A CN202111490147 A CN 202111490147A CN 114182039 A CN114182039 A CN 114182039A
Authority
CN
China
Prior art keywords
primer
ochre
rhaponticum
seq
nucleotide sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111490147.XA
Other languages
Chinese (zh)
Other versions
CN114182039B (en
Inventor
田恩静
谢晓梅
高崇华
郑媛
段仁和
曹广乘
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jilin Agricultural University
Original Assignee
Jilin Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jilin Agricultural University filed Critical Jilin Agricultural University
Priority to CN202111490147.XA priority Critical patent/CN114182039B/en
Priority to ZA2022/01216A priority patent/ZA202201216B/en
Publication of CN114182039A publication Critical patent/CN114182039A/en
Application granted granted Critical
Publication of CN114182039B publication Critical patent/CN114182039B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the technical field of molecular identification, in particular to a primer group and a kit for identifying ochre rhaponticum (Gyromitra infula) and application thereof. The primer group provided by the invention can specifically amplify the nucleic acid of the ochre rhaponticum, and has no cross reaction with the nucleic acid of easily confused pompholyx rhynchophyllum, rhaponticum carthamoides, morchella esculentum, bellidiella pomonensis, fuscoporia verrucosa and crabapplia crassipes, and other large fungi such as lactobacillus succinogenes, pileus schizophyllum, amanitum conoides and lactobacillus mucosus, and has strong specificity, and the ochre rhaponticum can be identified by using the primer group. Furthermore, the identification method provided by the invention can finish the specificity identification of the ochre rhaponticum within 90 minutes by utilizing the primer group, the detection result can be directly observed by naked eyes, and the detection method has the advantages of simple operation, high sensitivity (detection limit of 1 ng/mu L), suitability for a substrate and field detection.

Description

Primer group and kit for identifying ochre floribunda and application of primer group and kit
Technical Field
The invention relates to the technical field of molecular identification, in particular to a primer group and a kit for identifying ochre rhaponticum carthamoides and application thereof.
Background
The poisonous mushrooms are large-scale fungi which can cause poisoning reaction and even death of people, animals and the like after being eaten, and substances with toxic action generated by the poisonous mushrooms are called mycopoxin. For different species of poisonous mushrooms, they contain multiple toxins, which can lead to different toxic symptoms. When the ochre bacillus (Gyromita infula) is eaten by mistake, hemolytic diseases can be caused, the early main symptoms are headache, diarrhea, nausea and vomiting, chills, abdominal pain, hepatosplenomegaly, fever and hemoglobinuria can occur for about two days, and in severe cases, the life can be lost due to acute renal failure. Since such mushrooms contain maleic acid and methyldiamine, erythrocytes can be dissolved and destroyed, thereby causing acute hemolysis. Once the poisoning event of the ochre rhaponticum occurs, the rapid detection and identification of the ochre rhaponticum can be particularly important and urgent for the investigation of the mushroom poisoning event and the rescue of a poisoning patient.
Traditional detection methods such as morphological identification method, HPLC method, PCR method and the like are not suitable for remote areas with underdeveloped economy, short knowledge of poisonous mushrooms and limited equipment conditions, so that a novel rapid detection method which is simple to operate, high in sensitivity, suitable for basic level and applicable to field is urgently needed for ochre floridum.
Disclosure of Invention
In order to solve the problems, the invention provides a primer group and a kit for identifying ochre rhaponticum carthamoides and application thereof. The primer group provided by the invention can specifically amplify the nucleic acid of the ochre rhaponticum, can be used for identifying the ochre rhaponticum, and has the advantages of simplicity in operation, high sensitivity, suitability for a base layer and capability of on-site detection.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides a primer group for identifying ochre rhaponticum (Gyromitra infula), which comprises the following components in percentage by weight: a forward outer primer F3, a reverse outer primer B3, a forward inner primer F2, a reverse inner primer B2, a forward inner primer F1c, a reverse inner primer B1c and a loop primer LB;
the nucleotide sequence of the forward outer primer F3 is shown as SEQ ID NO. 1;
the nucleotide sequence of the reverse outer primer B3 is shown as SEQ ID NO. 2;
the nucleotide sequence of the forward inner primer F2 is shown as SEQ ID NO. 3;
the nucleotide sequence of the reverse inner primer B2 is shown as SEQ ID NO. 4;
the nucleotide sequence of the forward inner primer F1c is shown as SEQ ID NO. 5;
the nucleotide sequence of the reverse inner primer B1c is shown in SEQ ID NO. 6;
the nucleotide sequence of the loop primer LB is shown in SEQ ID NO. 7.
The invention also provides a kit for identifying ochre rhaponticum, which comprises the primer group.
The invention also provides application of the primer group or the kit in identifying whether a sample to be detected contains ochre rhaponticum carthamoides.
The invention also provides a method for identifying whether a sample to be detected contains ochre rhaponticum carthamoides, which comprises the following steps:
performing LAMP reaction by using the kit by taking the genome DNA of a sample to be detected as a template;
if an amplification product is obtained, the sample to be detected contains ochre floribunda; if the amplification product is not obtained, the sample to be detected does not contain ochre rhaponticum.
Preferably, the method for judging the amplification product comprises a pH indication method;
when the pH indicator is phenol red, the identification result is as follows: if the reaction result is yellow, the sample to be detected contains ochre rhaponticum; and if the reaction result is pink or red, the sample to be detected does not contain ochre rhaponticum carthamoides.
Preferably, the LAMP is inverseThe system is 10 μ L, and comprises 5 μ L of 2 × LAMP premix, 3 μ L of primer mixture, 2 μ L of DNA template and the balance ddH2O。
Preferably, the concentration of different primers in the primer mixture is as follows:
the concentrations of the forward outer primer F3 and the reverse outer primer B3 were 0.6. mu. mol/L respectively;
the concentrations of the forward inner primer F2, the reverse inner primer B2, the forward inner primer F1c and the reverse inner primer B1c were 4.8. mu. mol/L, respectively;
the concentration of the loop primer LB was 2. mu. mol/L.
Preferably, the temperature of the LAMP reaction is 65 ℃; the LAMP reaction time is 60-90 min.
Has the advantages that:
the invention provides a primer group for identifying ochre rhaponticum, which comprises the following components: a forward outer primer F3, a reverse outer primer B3, a forward inner primer F2, a reverse inner primer B2, a forward inner primer F1c, a reverse inner primer B1c and a loop primer LB; the nucleotide sequence of the forward outer primer F3 is shown as SEQ ID NO. 1; the nucleotide sequence of the reverse outer primer B3 is shown as SEQ ID NO. 2; the nucleotide sequence of the forward inner primer F2 is shown as SEQ ID NO. 3; the nucleotide sequence of the reverse inner primer B2 is shown as SEQ ID NO. 4; the nucleotide sequence of the forward inner primer F1c is shown as SEQ ID NO. 5; the nucleotide sequence of the reverse inner primer B1c is shown in SEQ ID NO. 6; the nucleotide sequence of the loop primer LB is shown in SEQ ID NO. 7. The primer group provided by the invention can specifically amplify the nucleic acid of the yellow deer flower bacteria, and has no cross reaction with the nucleic acid of easily confused yellow pompholyx (Helvella crisppa), yellow deer flower bacteria (Gyromotrita gigas), thick pompholyx (Helvella macropus), Verpa bohemimica (Verpa), Fusarium oxysporum (Peziza basica) and Morchella esculenta (Morchella esculenta), and other large fungi such as Suillus succinogenes (Suillus placius), Schizocapsa (Inocybe rimosa), Amania virgineoides (Amanita virgineoides) and Suillus bovida (Suillus bovis), and the primer group has strong specificity, and the yellow deer flower bacteria can be identified by using the primer group.
Furthermore, the identification method provided by the invention can finish the specificity identification of the ochre rhaponticum within 90 minutes by utilizing the primer group, the detection result can be directly observed by naked eyes, and the detection method has the advantages of simple operation, high sensitivity (detection limit of 1 ng/mu L), suitability for a substrate and field detection.
Drawings
FIG. 1 shows the results of detection of different mushrooms with the primer set selected in example 1; wherein the samples from left to right are: tube No. 1: ochre rhaponticum; tube No. 2: pompholyx pomifera; tube No. 3: cervus elaphus; tube No. 4: boletus succinogenes; tube No. 5: a split-cap umbrella; tube No. 6: amanita tricornutus (lour.) Merr; tube No. 7: boletus viscosus; pipe number 0 is ddH2O；
FIG. 2 shows the results of detection of different mushrooms with the primer set selected in example 1; wherein the samples from left to right are: tube No. 1: ochre rhaponticum; tube No. 8: saddle fungus, Onychium stuartii; tube No. 9: bordetella undulata; tube No. 10: lachnum wartii; tube No. 11: morchella; pipe number 0 is ddH2O；
FIG. 3 shows the results of sensitivity measurements at different dilution concentrations; wherein the concentration of ochre floridum genome DNA of different tubes from left to right is respectively as follows: tube 110 ng/. mu.L; no.2 tube 1 ng/. mu.L; tube 3 0.1 ng/. mu.L; tube 4 0.01 ng/. mu.L; tube 5 at 1pg/μ L; tube 60.1 pg/μ L; no.7 tube 0.01pg/μ L; no. 8 tube 1fg/μ L; pipe number 0 is ddH2O；
FIG. 4 shows the reaction results of different Erythroseum and the mixture of Erythroseum; wherein from left to right are respectively number 1 tubes: digestion of ochre floridum samples after water cooking; tube No. 2: boiled 50 wt.% of Cornus ochraceus and 50 wt.% of Morchella esculenta; tube No. 3: boiled and digested 10 wt.% of yellow deer flower fungus and 90 wt.% of morel; tube No. 4: 1 wt.% of ochre rhaponticum and 99 wt.% of morel digested after water boiling; tube No. 0: ddH2O；
FIG. 5 is a result of detection of different mushrooms by the control LAMP primer set in comparative example 1; wherein the samples from left to right for different tubes are: tube No. 1': ochre rhaponticum; tube No. 2': pompholyx pomifera; tube No. 3': cervus elaphus; tube No. 4': boletus succinogenes; tube No. 0: ddH2O。
Detailed Description
The invention provides a primer group for identifying ochre rhaponticum, which comprises the following components: a forward outer primer F3, a reverse outer primer B3, a forward inner primer F2, a reverse inner primer B2, a forward inner primer F1c, a reverse inner primer B1c and a loop primer LB;
the nucleotide sequence of the forward outer primer F3 is shown in SEQ ID NO. 1: ACCATAATGTGCGCTGTCA, respectively;
the nucleotide sequence of the reverse outer primer B3 is shown as SEQ ID NO. 2: GACGCTGACGGGACTCT, respectively;
the nucleotide sequence of the forward inner primer F2 is shown in SEQ ID NO. 3: CACGAGTCATCACGCCTG, respectively;
the nucleotide sequence of the reverse inner primer B2 is shown in SEQ ID NO. 4: AACTCTATCCCGCCCCCG, respectively;
the nucleotide sequence of the forward inner primer F1c is shown in SEQ ID NO. 5: CACTCCGGGTGGCCTTTTGC, respectively;
the nucleotide sequence of the reverse inner primer B1c is shown in SEQ ID NO. 6: CCCCCGAAACAAAACTGTCGGG, respectively;
the nucleotide sequence of the loop primer LB is shown in SEQ ID NO. 7: GGGAGGGCTGCAGTGTCAG are provided.
The primer group obtained by screening can specifically amplify the nucleic acid of the ochre rhaponticum, and mushrooms similar to the shape of the primer group and common toxic and edible mushrooms, such as the nucleic acids of the pompholyx rugosus, the rhaponticum carthamoides, the boletus succinogenes, the pileus meretrix, the amanitum mucosae, the boletus mucosae, the belladonnanensis, the trichoderma harzianum and the morchella, have no cross reaction and strong specificity, and the ochre rhaponticum can be effectively identified by using the primer group.
The invention also provides a kit for identifying ochre rhaponticum, which comprises the primer group. The kit provided by the invention can effectively identify the ochre floribunda, and the action principle is the same as that of the ochre floribunda, so that the detailed description is omitted.
The invention also provides application of the primer group or the kit in identifying whether a sample to be detected contains ochre rhaponticum carthamoides. The principle of the identification effect of the present invention is the same as above, and is not described herein again.
The invention also provides a method for identifying whether a sample to be detected contains ochre rhaponticum carthamoides, which comprises the following steps:
performing LAMP reaction by using the kit by taking the genome DNA of a sample to be detected as a template;
if an amplification product is obtained, the sample to be detected contains ochre floribunda; if the amplification product is not obtained, the sample to be detected does not contain ochre rhaponticum. The identification of whether the sample to be detected contains ochre flos cervi is preferably carried out in the embodiments of the invention with a non-diagnosis purpose, and is only used for obtaining an intermediate value of whether the sample to be detected contains ochre flos cervi.
In the present invention, the method for determining the amplification product is preferably a pH indicator method;
when the pH indicator is phenol red, the identification result is as follows: if the reaction result is yellow, the sample to be detected contains ochre rhaponticum; and if the reaction result is pink or red, the sample to be detected does not contain ochre rhaponticum carthamoides. In the present invention, the method for determining the amplification product is not particularly limited, and in the examples, a pH indication method is preferably used as an example, but the present invention is not to be construed as being limited to the full scope thereof.
The invention preferably adopts a color development method to judge the result, and the color development method can be directly observed by naked eyes and can be used for on-site rapid detection.
In the present invention, the LAMP reaction system is preferably 10. mu.L, and includes 5. mu.L of 2 × LAMP premix, 3. mu.L of primer mixture, 2. mu.L of DNA template, and the balance ddH2O; the 2 × LAMP premix is preferably purchased from New England Biolabs, USA, and contains: 50mmol/L potassium chloride, 10mmol/L ammonium sulfate, 3mmol/L magnesium sulfate heptahydrate, Tween-200.1%, 100. mu. mol/L phenol red dye, 0.8. mu.L NTPs (10mmol/L), 0.1. mu.L Bst 2.0WarmStartTM DNA polymerase (8U/. mu.L).
In the present invention, the concentration of the different primers in the primer mixture is preferably:
the concentrations of the forward outer primer F3 and the reverse outer primer B3 were 0.6. mu. mol/L respectively;
the concentrations of the forward inner primer F2, the reverse inner primer B2, the forward inner primer F1c and the reverse inner primer B1c were 4.8. mu. mol/L, respectively;
the concentration of the loop primer LB was 2. mu. mol/L.
In the present invention, the temperature of the LAMP reaction is preferably 65 ℃; the LAMP reaction time is preferably 60-90 min, and more preferably 90 min.
The method provided by the invention has the characteristics of accuracy, sensitivity, rapidness, low cost and visualization, and can finish the specificity identification of the ochre rhaponticum within 90 minutes; it also has higher sensitivity, and the detection limit reaches 1 ng/muL; the detection result can be directly observed by naked eyes, and the method can be used for on-site rapid detection.
In order to further illustrate the present invention, a primer set, a kit and applications thereof for identifying ochre rhaponticum according to the present invention will be described in detail with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
LAMP primer design and screening
Firstly, 10 ochre florida ITS sequences (MZ567199.1, MG846961.1, MG846962.1, MG846960.1, MG846959.1, MG846958.1, MG846957.1, MG846956.1, MG846955.1 and MG846954.1) are downloaded from an NCBI GenBank database, and the interspecies conserved segment of the ochre florida is selected as a primer design region through homologous sequence alignment.
In order to ensure the specificity of the primers, the ochre flower fungus species and ITS sequences (Gyromithra esculenta with the ITS sequence of MZ567191.1, Gyromithra gigas with the ITS sequence of MH938663.1, Gyromithra ambigua with the ITS sequence of MT373905.1 and Gyromithra brunnea with the ITS sequence of MZ 667895.1) of 4 ochre flower fungus close-source species are subjected to multiple sequence alignment, and a specificity interval is searched as a primer binding site (taking MG846960.1 as an example, a selected primer design region is 1-171 sites).
Selecting the 4 kinds of ochre bacteria, namely, the proximal species of the ochre bacteria, the armillaria mellea, the lactobacillus succinogenes, the anomala schizophyllum, the amanita congolensis, the lactobacillus mucosae, the anaphalia crassipes, the morchella esculenta, the bordetella fortunei and the trichoderma wartii as background primer groups to design specific primer sequences, and obtaining the primer groups through screening: a forward outer primer F3, a reverse outer primer B3, a forward inner primer F2, a reverse inner primer B2, a forward inner primer F1c, a reverse inner primer B1c and a loop primer LB;
the nucleotide sequence of the forward outer primer F3 is shown as SEQ ID NO. 1;
the nucleotide sequence of the reverse outer primer B3 is shown as SEQ ID NO. 2;
the nucleotide sequence of the forward inner primer F2 is shown as SEQ ID NO. 3;
the nucleotide sequence of the reverse inner primer B2 is shown as SEQ ID NO. 4;
the nucleotide sequence of the forward inner primer F1c is shown as SEQ ID NO. 5;
the nucleotide sequence of the reverse inner primer B1c is shown in SEQ ID NO. 6;
the nucleotide sequence of the loop primer LB is shown in SEQ ID NO. 7.
Example 2
Specific detection of primer set
To examine the specificity of the primer set screened in example 1, a positive control (Erythroseum ochraceum), 10 negative controls (mushrooms with a morphology similar to that of Erythroseum ochraceum and common poisonous and edible mushrooms) and a blank control (ddH) were set2O), grouping and test results are shown in table 1. The extraction of DNA was carried out using DNA secure novel plant genome DNA extraction kit (TIANGEN, China).
The LAMP reaction system is 10 mu L, and comprises: mu.L LAMP premix (2X) [ from New England Biolabs, USA, containing: 50mmol/L potassium chloride, 10mmol/L ammonium sulfate, 3mmol/L magnesium sulfate heptahydrate, Tween-200.1%, 100. mu. mol/L phenol red dye, 0.8. mu.L NTPs (10mmol/L), 0.1. mu.L Bst 2.0WarmStartTM DNA polymerase (8U/. mu.L)]3 μ L of the primer mixture [ the concentrations of the forward outer primer F3 and the reverse outer primer B3 were 0.6 μmol/L, respectively; the concentrations of the forward inner primer F2, the reverse inner primer B2, the forward inner primer F1c and the reverse inner primer B1c were 4.8. mu. mol/L, respectively; the concentration of the loop primer LB was 2. mu. mol/L]2 μ L of DNA template with ddH2Make up to 10. mu.L of O. LAMP reaction is carried out in a PCR thermal cycler at a constant temperature of 65 ℃ for 90 min.
And after the reaction stage is finished, placing the reaction tube on white paper, and judging a reaction result according to the color of the reaction liquid in the reaction tube. If the reaction liquid in the reaction tube is yellow, the reaction liquid is judged to be positive, namely the sample to be detected contains ochre floribunda components; and if the reaction liquid in the reaction tube is pink or red, judging that the reaction liquid is negative, namely the sample to be detected does not contain ochre rhaponticum component. The results are shown in Table 1, FIG. 1 and FIG. 2.
TABLE 1 results of different groups and LAMP detection
Numbering Name of species Collection ground LAMP results
1 Ochre rhaponticum Heilongjiang, China +
2 Saddle fungus Guizhou, China —
3 Pyrola gigantea (L.) Kuntze Jilin, China —
4 Boletus Succinum (L.) pers Guizhou, China —
5 Split-cap umbrella Guizhou, China —
6 Amanita tricolor extract Yunnan, China —
7 Boletus viscosus Yunnan, China —
8 Saddle fungus Xinjiang, China —
9 Monascus Bodinieri Jilin, China —
10 Lachnum verrucosum Heilongjiang, China —
11 Morchella esculenta (L.) Kuntze Jilin, China —
0 ddH2O —
Note: "+" is positive and "-" is negative.
As can be seen from Table 1, FIG. 1 and FIG. 2, the primer set obtained by screening of the invention can specifically amplify the nucleic acid of the yellow deer flower fungus, and the mushroom similar to the mushroom and common toxic and edible mushrooms in shape, such as the yellow deer saddle fungus, the large deer flower fungus, the lactobacillus succinogenes, the cap fungus, the amanita congolensis, the milk cow liver fungus, the thick red horse saddle fungus, the bordetella bourauna, the brown fungus sclerotium and the morchella esculenta have no cross reaction and strong specificity, and the yellow deer flower fungus can be effectively identified by using the primer set.
Example 3
Example 1 sensitivity detection of LAMP primer set obtained by screening
DNA purity and concentration were measured by spectrophotometer, and 10-fold serial dilutions of genomic DNA of Eremothecium ochromosum from 10ng/μ L to 1fg/μ L were carried out for LAMP reaction (the reaction system and procedure were the same as in example 2), and the color of the reaction solution was observed after the reaction was completed, and the experimental results are shown in FIG. 3 and Table 2.
TABLE 2 LAMP primer set sensitivity detection results of ochre Luceromyces
Figure BDA0003398941670000071
Figure BDA0003398941670000081
Note: "+" is positive and "-" is negative.
As can be seen from FIG. 3 and Table 2, the reaction solution of tubes No.1 and No.2 is yellow, and it can be seen that the detection limit concentration of the primer set provided by the present invention is 1 ng/. mu.L, which is much lower than that of many conventional detection methods, and is sufficient to meet the actual detection requirement, and has higher sensitivity.
Example 4
Example 1 detection of suitability of LAMP primer set obtained by screening
It is contemplated that in practice, mushrooms are usually processed (e.g., cooked) in advance before being consumed, and in clinical practice, vomit or feces of a person suffering from mushroom poisoning is usually detected. Therefore, in order to verify the feasibility of the primer group obtained by screening in actual detection, the foamed mushroom sample is boiled and digested, and then LAMP detection is carried out, and the specific method is as follows:
firstly, foaming crocus ochraceus and morchella esculenta according to a mass ratio of 1: 1. 1: 9 and 1: 99 respectively mixing to obtain a mixture of ochre and floridum; decocting the mixture of Erythrochlamus Hemsl and Erythrochlamus Hemsl in water at 100 deg.C for 10 min; the mixture of the ochre rhaponticum and the ochre rhaponticum after being boiled in water is incubated in artificial gastric juice for 4h at 37 ℃ (the artificial gastric juice consists of 0.05g of potassium chloride, 0.42g of sodium chloride and 0.32g of pepsin, the volume is fixed by 100mL of water, then the pH is adjusted to 3.0 by 1mol/L of hydrochloric acid), DNA extraction and LAMP reaction are carried out (the specific method is the same as that in example 2), the color of the reaction solution after the reaction is finished is observed, and the result is shown in a figure 4 and a table 3.
TABLE 3 detection results of LAMP primer set applicability of ochre rhaponticum
Numbering Digested sample after poaching LAMP results
1 Ochre rhaponticum +
2 50% of yellow deer flower fungus and 50% of morchella esculenta +
3 10% of yellow deer flower fungus and 90% of morchella esculenta +
4 1% of yellow deer flower fungus and 99% of morchella esculenta +
0 ddH2O —
Note: "+" is positive and "-" is negative.
As can be seen from FIG. 4 and Table 3, all samples except the blank control reacted positively, indicating that the primer set selected in example 1 of the present invention can detect ochre bacillus from both single and mixed mushroom samples digested by water boiling (the content detectable by ochre bacillus is as low as 1 wt.%). Therefore, the primer group and the LAMP detection method provided by the invention have higher practicability and are suitable for basic level and field detection (the detection provided by the invention is for a non-diagnosis purpose and is only used for obtaining an intermediate value of whether the sample to be detected contains ochre rhaponticum).
Comparative example 1
In a similar manner to example 1, the primer sets obtained by screening are shown in Table 4.
Table 4 primer control group for LAMP detection of ochre Luhua bacteria
Primer and method for producing the same Sequence 5'-3' SEQ ID
G.mol-F3’ GTCCACCTGAAACACAACA SEQ ID NO.8
G.mol-F2’ CACCAAACTGCAGTCAGA SEQ ID NO.9
G.mol-F1c’ CCAAGAGATCCGTTGTTGAAAGTT SEQ ID NO.10
G.mol-B3’ TTCCCGCATCGATGAAGAACG SEQ ID NO.11
G.mol-B2’ ATGATTCACTGAATTCTGCAA SEQ ID NO.12
G.mol-B1c’ TGTGCGTTCAAAGATTCG SEQ ID NO.13
G.mol-LB’ GCGAAATGCGATAAGTAATGTGAA SEQ ID NO.14
The method of example 2 was repeated using the control LAMP primer set shown in Table 4, and DNAs of different species of mushrooms (ochronospora, pompholyx rhynchophyllus, rhaponticum carthamoides, and boletus succinogenes) were detected, and the results are shown in FIG. 5 and Table 5.
TABLE 5 different mushrooms and LAMP detection results
Numbering Name of species Collection ground LAMP results
1’ Ochre rhaponticum Heilongjiang, China +
2’ Saddle fungus Guizhou, China +
3’ Pyrola gigantea (L.) Kuntze Jilin, China +
4’ Boletus Succinum (L.) pers Guizhou, China —
0 ddH2O —
Note: "+" is positive and "-" is negative.
As can be seen from FIG. 5 and Table 5, the control LAMP primer group has poor specificity, and other non-target species except the Erythroseum ochraceum can be amplified (the reaction liquid in the tubes 1 ', 2 ' and 3' is yellow, and the samples to be detected are the Erythroseum ochraceum, the Anemarrhena rugosa and the Erythium giganteum respectively).
In conclusion, the LAMP primer group and the detection method for the ochre bacteria have the characteristics of accuracy, sensitivity, rapidness, low cost and visualization, and can finish the specific identification of the ochre bacteria within 90 minutes; it also has higher sensitivity, and the detection limit reaches 1 ng/muL; the detection result can be directly observed by naked eyes, and the method can be used for on-site rapid detection. The method can be applied to the prevention of mushroom poisoning and the rapid and accurate detection of whether toxic mushrooms in a poisoning event contain ochre rhaponticum carthamoides, and has important significance for targeted treatment and diagnosis after poisoning. Can be used for clinical treatment and forensic analysis.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence listing
<110> Jilin university of agriculture
<120> primer group and kit for identifying ochre rhaponticum and application thereof
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
accataatgt gcgctgtca 19
<210> 2
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gacgctgacg ggactct 17
<210> 3
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cacgagtcat cacgcctg 18
<210> 4
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aactctatcc cgcccccg 18
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cactccgggt ggccttttgc 20
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cccccgaaac aaaactgtcg gg 22
<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gggagggctg cagtgtcag 19
<210> 8
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gtccacctga aacacaaca 19
<210> 9
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
caccaaactg cagtcaga 18
<210> 10
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ccaagagatc cgttgttgaa agtt 24
<210> 11
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ttcccgcatc gatgaagaac g 21
<210> 12
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
atgattcact gaattctgca a 21
<210> 13
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
tgtgcgttca aagattcg 18
<210> 14
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
gcgaaatgcg ataagtaatg tgaa 24

Claims (8)

1. A primer set for identifying ochre rhaponticum (Gyromitra infula), which is characterized by comprising: a forward outer primer F3, a reverse outer primer B3, a forward inner primer F2, a reverse inner primer B2, a forward inner primer F1c, a reverse inner primer B1c and a loop primer LB;
the nucleotide sequence of the forward outer primer F3 is shown as SEQ ID NO. 1;
the nucleotide sequence of the reverse outer primer B3 is shown as SEQ ID NO. 2;
the nucleotide sequence of the forward inner primer F2 is shown as SEQ ID NO. 3;
the nucleotide sequence of the reverse inner primer B2 is shown as SEQ ID NO. 4;
the nucleotide sequence of the forward inner primer F1c is shown as SEQ ID NO. 5;
the nucleotide sequence of the reverse inner primer B1c is shown in SEQ ID NO. 6;
the nucleotide sequence of the loop primer LB is shown in SEQ ID NO. 7.
2. A kit for identifying ochre rhaponticum, which comprises the primer set of claim 1.
3. Use of the primer set of claim 1 or the kit of claim 2 for identifying whether a sample to be tested contains ochre rhaponticum.
4. A method for identifying whether a sample to be detected contains ochre rhaponticum, which is characterized by comprising the following steps:
performing LAMP reaction by using the genomic DNA of a sample to be tested as a template and using the kit according to any one of claims 2 to 3;
if an amplification product is obtained, the sample to be detected contains ochre floribunda; if the amplification product is not obtained, the sample to be detected does not contain ochre rhaponticum.
5. The method according to claim 4, wherein the method for determining the amplification product comprises a pH indicator method;
when the pH indicator is phenol red, the identification result is as follows: if the reaction result is yellow, the sample to be detected contains ochre rhaponticum; and if the reaction result is pink or red, the sample to be detected does not contain ochre rhaponticum carthamoides.
6. The method of claim 4, wherein the LAMP reaction system is 10 μ L, and comprises 5 μ L of 2 × LAMP premix, 3 μ L of primer mixture, 2 μ L of DNA template, and the balance ddH2O。
7. The method according to claim 6, wherein the concentration of different primers in the primer mixture is:
the concentrations of the forward outer primer F3 and the reverse outer primer B3 were 0.6. mu. mol/L respectively;
the concentrations of the forward inner primer F2, the reverse inner primer B2, the forward inner primer F1c and the reverse inner primer B1c were 4.8. mu. mol/L, respectively;
the concentration of the loop primer LB was 2. mu. mol/L.
8. The method of claim 4, wherein the temperature of the LAMP reaction is 65 ℃; the LAMP reaction time is 60-90 min.
CN202111490147.XA 2021-12-08 2021-12-08 Primer group and kit for identifying ocher deer fungus and application of primer group and kit Active CN114182039B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202111490147.XA CN114182039B (en) 2021-12-08 2021-12-08 Primer group and kit for identifying ocher deer fungus and application of primer group and kit
ZA2022/01216A ZA202201216B (en) 2021-12-08 2022-01-26 Primer set and kit for identifying gyromitra infula and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111490147.XA CN114182039B (en) 2021-12-08 2021-12-08 Primer group and kit for identifying ocher deer fungus and application of primer group and kit

Publications (2)

Publication Number Publication Date
CN114182039A true CN114182039A (en) 2022-03-15
CN114182039B CN114182039B (en) 2023-12-22

Family

ID=80603798

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111490147.XA Active CN114182039B (en) 2021-12-08 2021-12-08 Primer group and kit for identifying ocher deer fungus and application of primer group and kit

Country Status (2)

Country Link
CN (1) CN114182039B (en)
ZA (1) ZA202201216B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003037918A2 (en) * 2001-10-31 2003-05-08 Danisco A/S Pyranosone dehydratase from phanerochaete chrysosporium
CN106906293A (en) * 2017-03-31 2017-06-30 中国热带农业科学院环境与植物保护研究所 A kind of LAMP primer group for detecting the black top handle rest fungus of sugarcane and application
CN112852992A (en) * 2021-02-18 2021-05-28 中国农业科学院农业质量标准与检测技术研究所 Primer group, kit and method for identifying Pleurotus citrinopileatus based on loop-mediated isothermal amplification technology

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003037918A2 (en) * 2001-10-31 2003-05-08 Danisco A/S Pyranosone dehydratase from phanerochaete chrysosporium
CN106906293A (en) * 2017-03-31 2017-06-30 中国热带农业科学院环境与植物保护研究所 A kind of LAMP primer group for detecting the black top handle rest fungus of sugarcane and application
CN112852992A (en) * 2021-02-18 2021-05-28 中国农业科学院农业质量标准与检测技术研究所 Primer group, kit and method for identifying Pleurotus citrinopileatus based on loop-mediated isothermal amplification technology

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
XIAOMEI XIE等: "Identification of Gyromitra infula: A Rapid and Visual Method Based on Loop-Mediated Isothermal Amplification", FRONTIERS IN MICROBIOLOGY, vol. 13, pages 1 - 10 *

Also Published As

Publication number Publication date
ZA202201216B (en) 2022-03-30
CN114182039B (en) 2023-12-22

Similar Documents

Publication Publication Date Title
Debeaupuis et al. Genetic diversity among clinical and environmental isolates of Aspergillus fumigatus
CN112852992A (en) Primer group, kit and method for identifying Pleurotus citrinopileatus based on loop-mediated isothermal amplification technology
CN106916906A (en) A kind of Primer composition and its kit for detecting infectious diarrhea pathogen
CN106498087A (en) The dry powdered LAMP quick detection kits of C.perfringens and its using method
CN113999933A (en) Method for accurately detecting cryptococcus neoformans
CN114875174A (en) LAMP primer group, kit and detection method for rapidly identifying russula vinosa
CN103276103B (en) Kit with RT-LAMP nucleic acid test strips for detecting porcine epidemic diarrhea virus and applications of kit
CN106544444A (en) The dry powdered LAMP quick detection kits of streptococcus fecalis and its using method
Gao et al. Rapid identification of Amanita citrinoannulata poisoning using colorimetric and real-time fluorescence and loop-mediated isothermal amplification (LAMP) based on the nuclear ITS region
CN114182039A (en) Primer group and kit for identifying ochre floribunda and application of primer group and kit
CN109868329B (en) Screening, quarantine and identification method of colletotrichum specific primers
WO2023087787A1 (en) Dna barcode for screening floccularia luteovirens using content of total soluble amino acid as index
CN111850155A (en) Application of specific target primer in simultaneous and rapid identification of two pathogenic bacteria of strawberry infection
WO2023087784A1 (en) Dna barcode for screening floccularia luteovirens using content of total polyphenol as index
WO2023087788A1 (en) Dna bar code for screening total soluble protein content index of floccularia luteovirens
CN114292938A (en) SSR fingerprint identification method and construction method of stropharia rugoso-annulata strain
KR102318379B1 (en) Marker composition for rapid and simultaneous detecting Erwinia amylovora and Erwinia pyrifoliae
Liu et al. Loop-mediated isothermal amplification and PCR combined assay to detect and distinguish latent Colletotrichum spp. infection on strawberry
CN112048573B (en) RPA primer and kit for detecting cotton leaf curl virus, and detection method and application thereof
CN114517238A (en) SSR molecular marker and method for identifying tremella aurantialba ZJJE001 strain
Aveskamp Phylogeny and DNA-based identification in Phoma and related genera
CN110643691A (en) Method for monitoring salmonella
CN109609683A (en) A kind of LAMP detection primer detecting colletotrichum gloeosporioides Penz in olive tissue
CN111041117A (en) Araliaceae traditional Chinese medicine product identification kit and method
CN108504727A (en) The method that high throughput sequencing technologies detect white fungus and incense ashes bacterium proportioning in white fungus strain

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant