CN114164210A

CN114164210A - Long-chain non-coding RNA for regulating protooncogene MYB and application thereof

Info

Publication number: CN114164210A
Application number: CN202110956348.8A
Authority: CN
Inventors: 韩兵社; 张俊芳; 王玉成; 李梦佳; 张泽辉
Original assignee: Shanghai Ocean University
Current assignee: Shanghai Ocean University
Priority date: 2021-08-19
Filing date: 2021-08-19
Publication date: 2022-03-11
Anticipated expiration: 2041-08-19
Also published as: CN114164210B

Abstract

The invention relates to molecular biology, in particular to a long-chain non-coding RNA for regulating and controlling a protooncogene MYB and a cDNA thereof. The long-chain non-coding RNA or the cDNA thereof can regulate the expression of MYB genes and can be used as a tumor molecular marker or a target spot of a medicament; can also regulate the proliferation of leukemia cells, and can be used as a marker for leukemia detection and a target point for treatment. The invention also discloses a recombinant vector and application thereof.

Description

Long-chain non-coding RNA for regulating protooncogene MYB and application thereof

Technical Field

The invention relates to the fields of molecular biology and medicine, in particular to a long-chain non-coding RNA for regulating a protooncogene MYB.

Background

MYB is a proto-oncogene widely present in eukaryotes and highly conserved evolutionarily, and its main biological effect is to regulate cell proliferation and differentiation. Many studies have shown that MYB is highly expressed in leukemia, can be used as a transcription factor to regulate the processes of proliferation, differentiation, invasion and the like of cancer cells, and is a driving factor for the generation of leukemia. Thus, MYB plays an important role in the detection and treatment of leukemia.

At present, the treatment of leukemia mainly comprises chemotherapy and bone marrow transplantation, the chemotherapy has great side effect and easy clinical relapse, the bone marrow transplantation cost is higher, the bone marrow source is less, and the total survival rate of leukemia is still lower. Therefore, there is a clinical need to find early and sensitive therapeutic targets and to explore effective therapeutic approaches to better reduce the mortality of leukemia. Long non-coding RNA (lncRNA) refers to a class of RNA whose transcript length is greater than 200 nucleotides and which does not have a protein coding function. Studies have shown that lncRNA can regulate gene expression at epigenetic, transcriptional, and post-transcriptional levels. Furthermore, lncRNA is involved in a variety of important life regulation processes, including genomic imprinting, chromatin modification, RNA metabolism, protein functional activity, and chromatin remodeling. And it is proved that lncRNA is closely related to the occurrence and development of human diseases and is involved in the occurrence and development processes of various tumors, but the research of lncRNA in leukemia is still in the initial stage.

It has been found that a remote regulatory element plays a very important role in MYB expression regulation, and a DNA sequence in an upstream region of MYB can form DNA-loop with a MYB promoter and recruit transcription factors Hoxa9, PU.1, structural proteins CTCF and cohesin and the like to remotely regulate the transcription of MYB genes. The lncRNA can regulate the processes of cell proliferation, apoptosis and the like through a plurality of mechanisms in the occurrence and development processes of leukemia, and plays a role in promoting cancer or inhibiting cancer. In recent years, although research on lncRNA has been rapidly advanced, the functions of most of lncRNA are still unclear, and the invention finds the transcription-generated lncRNA at the position of 96k region at the upstream of MYB, and the effect of the lncRNA on MYB genes and the influence of the lncRNA on leukemia are not researched.

Disclosure of Invention

Aiming at the defects and shortcomings of the existing leukemia detection and treatment, the invention provides a long-chain non-coding RNAMYB-96KS for regulating a protooncogene MYB and using the same for regulating the expression of the MYB and the proliferation of tumor cells, particularly leukemia cells.

The long-chain non-coding RNA full-length sequence can be obtained by RACE technology, and the steps comprise:

(1) obtaining total RNA as a template to synthesize RACE first strand cDNA; preferably, total RNA is obtained from K562 cells;

(2) taking RACE first strand cDNA as a template to perform a first round of RACE-PCR; the adopted primers are universal primer UPM and 5 '-end or3' -end gene specific primer;

the 5 '-end gene specific primer (5' RACE-GSP) sequence of the first round RACE-PCR is: 5'-gtgcctttaaggcaccctgcatacatgat-3':

the 3 '-end gene specific primer (3' RACE-GSP) sequence of the first round of RACE-PCR is as follows: 5'-gtattgcagacttgggaactcacctcatg-3', respectively;

(3) taking the first round of RACE-PCR products as a template, and carrying out second round of RACE-PCR to obtain a cD NA sequence; the adopted primers are universal primer UPM and 5 '-end or3' -end gene specific primer;

the 5 '-end gene specific primer 5' RACE-NGSP sequence of the second round RACE-PCR is as follows: 5'-g cctgttttccccattacatgaggtgagt-3', respectively;

the 3 '-end gene specific primer 3' RACE-NGSP sequence of the second round RACE-PCR is as follows: 5'-c gcctcagtctctcaaagtaatccttcag-3' are provided.

The sequence is located on the sixth chromosome of human through sequencing identification.

In step (1), total RNA is obtained from leukemia cells, preferably leukemia cell line K562. The sequence of the long non-coding RNA can be obtained by the above method.

The technical scheme of the invention is as follows:

a long-chain non-coding RNA (MYB-96KS) for regulating a protooncogene MYB, the cDNA sequence of which comprises a sequence shown as SEQ ID NO. 1; preferably, the cDNA sequence is shown in SEQ ID NO. 1.

A cDNA for regulating and controlling a long-chain non-coding RNA of a protooncogene MYB, the sequence of which comprises a sequence shown as SEQ ID NO. 1; preferably, the sequence is shown in SEQ ID NO. 1.

The long-chain non-coding RNA is transcribed and generated by a 96kb region at the upstream of MYB, and can regulate and control the expression of protooncogene MYB, particularly the expression of MYB gene in leukemia cells; meanwhile, the kit can also regulate the proliferation of leukemia cells, can be used as a target for detecting and treating tumors, particularly leukemia, and can be used as a biomarker of tumors, particularly leukemia.

A primer which can be used for amplifying the long-chain non-coding RNA or the cDNA sequence thereof, wherein the upstream primer sequence comprises a sequence shown as SEQ ID No.2, and the downstream primer comprises a sequence shown as SEQ ID No. 3; preferably, the nucleotide sequence of the upstream primer is shown as SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3.

SEQ ID No.2：5′-gaagcatcagatgaagagggaagg-3′

SEQ ID No.3：5′-ttcttttttctttttttttctttttttttttgccatggtctagtc-3′

A reagent or a kit for detecting the long non-coding RNA, the expression abundance thereof, or the cDNA thereof, contains the primer.

A recombinant vector is a recombinant expression vector containing the cDNA sequence of the non-coding long-chain RNA, and can overexpress or knock down the long-chain non-coding RNA or the cDNA thereof.

A transfection vector which contains the recombinant vector and is a virus or a recombinant bacterium; preferably, the virus is a lentivirus.

The recombinant vector is constructed by the following method: the cDNA sequence of the non-coding long-chain RNA is connected to an expression vector.

The recombinant expression vector is an overexpression recombinant vector or a knock-down recombinant vector.

When the overexpression recombinant vector is constructed, preferably, the overexpression vector is pLVX-IRES-Neo, and the construction method comprises the following steps: and connecting the cDNA sequence of the non-coding long-chain RNA to a T vector, and after sequencing verification, carrying out enzyme cutting site PCR reaction to transfer the cDNA full-length sequence of the non-coding long-chain RNA from the T vector to an over-expression vector pLVX-IRES-Neo. Preferably, EcoRI and AgeI are used as restriction enzyme sites; the primer for constructing the recombinant over-expression vector has the following sequence:

MYB-96KS-EcoRI-F:5′-ggaattcgaagcatcagatgaagagggaagg-3′

MYB-96KS-XbaI-R:5′-gactagtttcttttttctttttttttctttttttttttgccatggtctagtc-3′

when the knock-down recombinant vector is constructed, preferably, the knock-down vector is pLKO.1-TRC cloning plasmid; the construction method comprises the following steps: and connecting the cDNA sequence of the non-coding long-chain RNA to a T vector, and after sequencing verification, carrying out enzyme cutting site PCR reaction to transfer the cDNA full-length sequence of the non-coding long-chain RNA from the T vector to a knock-down vector pLKO.1-TRC cloning plasmid.

The sequence of shRNA used to construct the recombinant knockdown vector is shown below:

MYB-96KS-shRNA-F：5′-ccggctagacaagttaggctttaaactcgagtttaaagcctaacttgtcta gtttttg-3′

MYB-96KS-shRNA-R：5′-aattcaaaaactagacaagttaggctttaaactcgagtttaaagcctaactt gtctag-3′

the slow virus is used for transfecting a K562 cell overexpression recombinant vector or a knock-down recombinant vector, proteins in the K562 cell are extracted, Western blot is used for detecting the expression quantity of MYB proteins, and the result shows that the overexpression of the non-coding long-chain RNA located in a 96K region at the upstream of MYB can promote the expression of MYB genes, and the knock-down reduces the expression quantity of MYB.

Furthermore, K562 cells were transfected with lentiviruses to overexpress recombinant vectors or knock-down recombinant vectors, and proliferation of K562 cells was detected using CCK-8 reagent. The non-coding long-chain RNA located in the upstream 96K region of MYB is overexpressed to promote the proliferation of a leukemia cell line K562, and the proliferation is inhibited by knocking down.

Therefore, the long-chain non-coding RNA or cDNA thereof for regulating the protooncogene MYB can be used for preparing or screening antitumor drugs, particularly drugs for treating leukemia; can also be used for preparing diagnostic reagents for detecting tumors, in particular to diagnostic reagents for leukemia. The anti-tumor drug or the drug for treating leukemia plays a role by regulating the expression of lncrnameb-96 KS and inhibiting protooncogene MYB, and plays a role by inhibiting the proliferation, migration and invasion of leukemia cells.

The primer for amplifying the long-chain non-coding RNA or the cDNA sequence thereof, the reagent or the kit for detecting the long-chain non-coding RNA or the cDNA thereof can be used for preparing or screening a medicament for treating tumors, or preparing a diagnostic reagent for detecting the tumors. The tumor is leukemia.

The recombinant vector or the transfection vector containing the cDNA sequence of the non-coding long-chain RNA can also be used for preparing or screening medicaments for treating tumors or preparing diagnostic reagents for detecting tumors. The tumor is leukemia.

The invention discloses a non-coding long-chain RNA with a regulation and control function on a protooncogene MYB, and can also regulate and control the proliferation of a leukemia cell line K562. The RACE technology is utilized to clone the full-length sequence of the non-coding long-chain RNA, and the overexpression of the non-coding long-chain RNA can promote the transcription and protein synthesis of MYB genes in a leukemia cell line K562 and the growth of leukemia cells by constructing an overexpression and knock-down vector; and after the expression of the derivative is inhibited, the expression of MYB is correspondingly reduced, and the proliferation, migration and invasion of leukemia cells are obviously inhibited. Thus showing that the effect of inhibiting leukemia is achieved by reducing the expression level of the non-coding long-chain RNA. Therefore, the long-chain non-coding RNA or the cDNA sequence thereof can be used as a molecular marker or a target spot to be applied to the development of detection and diagnosis reagents and treatment drugs of tumors, particularly leukemia, and has clinical value and application prospect.

Drawings

FIG. 1 is a clone of lncRNAMYB-96KS RACE from example 1;

FIG. 2 is a schematic diagram showing the position of lncRNAMYB-96KS on human chromosome 6 in example 1;

FIG. 3 is a graph showing the expression levels of lncRNAMYB-96KS in leukemia cell lines and other tumor cells in example 2;

FIG. 4 is a Western-blot analysis of the effect of lncRNA MYB-96KS overexpression/knockdown on MYB gene expression in example 4;

FIG. 5 is a graph of the effect of lncRNAMYB-96KS overexpression/knockdown on proliferation of leukemia cell lines in example 5.

Detailed Description

EXAMPLE 1 cloning of full-Length non-coding RNA sequence by RACE

(1) Total RNA extraction

Extracting total RNA of K562 cells by Trizol method, adding RNase-free H₂And O, completely dissolving the RNA by water bath at 55 ℃ for 10min, and freezing and storing at-80 ℃.

(2) RACE first Strand cDNA Synthesis

Using a supply of Takara

RACE 5 '/3' Kit was synthesized.

The synthesized 3 '-RACE-Ready cDNA and 5' -RACE-Ready cDNA products were diluted with one volume of distilled water and stored at-20 ℃.

(3) RACE-PCR reaction

RACE-PCR first round reaction, PCR amplification is carried out by using universal primer UPM and 5 '-end or3' -end Gene Specific Primer (GSP).

The PCR primer sequence of the long non-coding RNA (lncRNAMYB-96 KS for short) comprises the following steps:

5′RACE-MYB-96KS-GSP：5′-gtgcctttaaggcaccctgcatacatgat-3′；

3′RACE-MYB-96KS-GSP：5′-gtattgcagacttgggaactcacctcatg-3′；

reaction system: 15.5 μ LPCR-Grade H₂O, 25.0. mu.L of 2 XSeqAmp Buffer, 1.0. mu.L of SeqAmp DNA Polymerase, 2.5. mu.L of 5 '-or 3' -RACE-Ready cDNA, 5.0. mu.L of 10 XU PM, 1.0. mu.L of 5'GSP or3' GSP (10. mu.M) in a total volume of 50. mu.L, thoroughly mixed and then centrifuged briefly.

RACE-PCR first round reaction program: 30s at 94 ℃, 2min at 72 ℃ and 5 cycles; 30s at 94 ℃, 30s at 72 ℃, 2min at 72 ℃ and 5 cycles; 30 cycles of 94 ℃ for 30s, 65 ℃ for 30s, 72 ℃ for 2 min.

In the second round of reaction, 50 times of diluted PCR products in the first round are used as templates, and Universal Primer short (UPM short) is used as a Universal Primer for amplification.

The nucleotide sequences of the primers used were as follows:

5′RACE-MYB-96KS-NGSP：5′-gcctgttttccccattacatgaggtgagt-3′；

3′RACE-MYB-96KS-NGSP：5′-cgcctcagtctctcaaagtaatccttcag-3′。

reaction system: 15.5 μ L PCR-Grade H₂O, 25.0. mu.L of 2X SeqAmp Buffer, 1.0. mu.L of SeqAmp DNA Polymerase, 5.0. mu.L of one-round PCR product, 1.0. mu.L of UPM short, 1.0. mu.L of 5'or3' NGSP, in a total volume of 50. mu.L, thoroughly mixed and then centrifuged briefly.

Reaction procedure: 30s at 94 ℃, 30s at 60 ℃, 2min at 72 ℃ and 40 cycles.

The PCR products were detected by electrophoresis on a 1% agarose gel, and the results are shown in FIG. 1.

(4) Gel recovery and purification of the fragment of interest

The desired fragment was recovered using QIAquick Gel Extraction Kit from QIAGEN.

The gel containing the desired fragment was carefully cut with a razor blade and recovered in an EP tube. The concentration and purity of the recovered target fragment were measured by Nanodrop 2000, and the recovered target fragment was stored at-20 ℃.

(5) Ligation of the fragment of interest to the vector

T-vector ligation was performed using the pEASY-Blunt Zero Cloning Kit from all-type gold.

Cloning reaction system:

reaction conditions are as follows: 15min at 25 ℃.

(6) Transformation of

Trans1-T1 competent cells were thawed on ice, and the ligation product of step (5) was added to 50. mu.L of competent cells and ice-cooled for 30 min.

The cells were heat-shocked in a water bath at 42 ℃ for 30 seconds, immediately placed on ice for 2min, added with 250. mu.L of LB liquid medium, and cultured at 37 ℃ for 1h at 200 rpm.

Centrifuging at 1500g for 1min, discarding part of supernatant, and uniformly spreading on LB solid culture medium containing antibiotics.

Culturing in a constant temperature incubator at 37 ℃ overnight for 12-14 h.

(7) Identification

Taking out the culture medium, selecting the monoclonal for PCR verification, selecting positive bacteria for amplification culture and sequencing.

Reaction system: bacterial suspension 1. mu.L, 2 XTaq plus Master Mix 10. mu.L, M13F 0.5. mu.L, M13R 0.5.5. mu.L, ddH₂O8. mu.L, total volume 20. mu.L.

Reaction procedure: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 2 min; 10min at 72 ℃.

(8) Full Length cloning of IncRNA

After the 5 'end and 3' end fragment information of the lncRNA are obtained by the RACE method of the previous step, primers are designed at both ends, and the upstream and downstream sequences of the specific primers are as follows:

SEQ ID No.2(lncRNA MYB-96KS-F)：5′-gaagcatcagatgaagagggaagg-3′

SEQ ID No.3(lncRNA MYB-96KS-R)：5’-ttcttttttctttttttttctttttttttttgccatggtct agtc-3’

and carrying out PCR amplification on the spliced lncRNA full-length cDNA sequence by using the primers, and carrying out sequencing verification. The PCR reaction program is: pre-denaturation at 95 ℃ for 30 s. 5s denaturation at 95 ℃, 30s amplification at 60 ℃ for 35 cycles. The cloned whole-length cDNA sequence of the long-chain non-coding RNA of the regulatory protooncogene MYB has the total length of 2142 nucleotides, is positioned in the upstream 96k region of the human chromosome 6 and the sense chain of the MYB gene, and is represented by MYB-96 KS.

And as a result of sequencing, the nucleotide sequence is shown as SEQ ID No. 1.

The position of lncRNA MYB-96KS on human chromosome 6 is shown in FIG. 2.

SEQ ID No.1：

gaagcatcagatgaagagggaaggcagagcagtgagaagtctttgaatgagacctttgagcttgtattgcagacttgggaa ctcacctcatgtaatggggaaaacaggctgattatttagttcttttttattaaaaaaactctataattataataaaaccctttttaattt atttacctaatatccccttgcctgaaatgtcttttttttttttgtttttgttttttgagacagggtctggctctgttgcccaggctggag cttggctcactgcaacctccacctcccggcctcaaattatcctcccacctcagtctcctgagtagctgggactacaggcatga ggcaccacacccaggtaatttttgtatttttggtagaaacaaggtttcaccatgttggccagctggtctcaaactcctggcctca agcaatcctcccgcctcagtctctcaaagtaatccttcagtctaatcaccaaaagtaatagcttgtttctgctgtgaaggaaatc tacaataataattatattgagtgttttcatacatttgattagtataaccaaataatttcaataagtataaagatttaaaatgaacatttc cttaatgttgtttaacctgcattataggttttatttacaactcaacccttatccataaataatagtctcaaatatttactaaaagtcaat atattttgtgtatgatatcacagccataaaaacaatcaaattagaagtagcatttacagtattagtcacagataggaaaccataa tttagtgaagaataacaaaaataaataaatatagattgacagatacatagttagattctgaaatttaactttggctttacccaacct tgttgagaatgaaatcatgtatgcagggtgccttaaaggcacttttttcctaaaaattgtatatattggaaataattcaccaagaa aatcctaagaaagaaaaagagtttatgtgattgactttgggttatcaaagcaaagactatccagggtaaataacaggcagag gatagtgattacagctcatttattaaaatagcaacattggtacatatctgagtcaagcctggaactccccctccctctcaactag acaagttaggctttaaaattactgtaaaaattaagtcaaattgcctgtgaaggtaagctcttagaagaattttttaggtagatgat ctacataacaagacatgcaccaaccaaatctgcagtcaaatattgggggaaaaaagcaacaacagtaggtttgtgtttattgc gatgtctggaatattttaaaaattaagctcctggcctcagcctagggatttctaatcaattccaggaaatgtactgtatctttcctt gaggccagcaggaaagccccttggcaagggtgtctggaatggccacttgacatccccagcacacctcttgccaaagttac ccatggctgctgacagagagactgatgtgctgccacagattgactttagggatgaacagatcaagatcaactaatctgggc agatgcattaaagtgtttctgtgtatttaagcataccatagaaagacaaattcaacagctttcactttgctttcatacaacgttgtt ctcttacgtgttttctatttttgtttatatactaatttcctctagattgactgggttctaaatttattatgaatttggtaaagcctctgaac tttgtgtttctatattacacaccttgtgtctgtgactactgttgtggttatacactcgggattttgaagtctcaacgataatcaccata agtcatttttagcagctctgtttaaaagattccatcagtagaaattcagcacgggtaactttcacttaaacattccagaccctcag aatcctttacatttaagtgatgtgttaaaaacaatggcacctctttttacttaatttcagtcacatttggaagaagataagaaagttt attctgaactccatcactcactattactgagtttgcttcattgttgaaactagggaaaattagtccgaggtttcaaaaaagcagct aaacaattttttttccaaattcttatccaccatgactagaccatggcaaaaaaaaaaagaaaaaaaaagaaaaaagaa

(8) Plasmid extraction

T-Plasmid was extracted using EZNA Endo-free Plasmid DNA Mini kit from OMEGA.

Example 2 detection of expression levels of lncRNA MYB-96KS in leukemia cell lines

(1) Cell culture

Human erythroleukemia K562 cells, human acute myelogenous leukemia U937 cells, human promyelocytic acute leukemia HL60 cells, Hela cells, and 293T cells were all purchased from ATCC (American Type Culture Collection). K562, U937, HL60 cells were cultured in RPMI 1640basic (Gibco, # C11875500BT) medium supplemented with 10% final concentration of fetal bovine serum (Gibco, #10099-141C) and 1% final concentration of streptomycin and penicillin (HyClone, # SV 30010). Hela and 293T cells were cultured in DMEM (Gibco, # C11965500BT) medium plus 10% fetal bovine serum and 1% streptomycin and penicillin. The inoculated cells were incubated at 37 ℃ in CO₂Culturing in a cell culture box with the volume fraction of 5%.

(2) Total RNA extraction

Culturing cells in a 10cm cell culture dish, taking K562, U937 and HL60 cells as suspension cells, taking cells in logarithmic phase after overgrowth, centrifuging at 800rpm for 5min, discarding supernatant, adding 1mL trizol reagent, and lysing for 5 min. Hela and 293T cells were adherent cells, and after they were confluent, the medium was decanted, 1mL of trizol reagent was added, and lysis was performed for 5 min. The lysate was transferred to RNase-free EP tube and the solution was clear and pellet free and mixed by inversion.

Adding chloroform with a total volume of 1/5, mixing the solutions, and standing at room temperature for 3 min;

pre-cooling the mixture in a centrifuge at 4 ℃ and 12,000rpm, and centrifuging for 15 min;

transferring the upper water phase into another 1.5mL LEP tube, adding 0.5mL isopropanol, and incubating for 10 min;

centrifuge at 12,000rpm for 10min at 4 ℃. Discarding the supernatant;

1mL of 75% ethanol (in DEPC water) was added and the sample was vortexed. Centrifuge at 7500g for 5min at 4 ℃.

Washing was repeated 2 times;

ethanol is removed, RNA (white substance) is collected, and the RNA in the EP tube is dried in the air for 10 min;

adding to RNase-free H₂The RNA was dissolved completely in O50. mu.L water bath at 55 ℃ for 10min and frozen to-80 ℃.

(3) Reverse transcription reaction

Using a reverse transcription kit PrimeScript from Takara^TMThe RT reagent Kit was subjected to reverse transcription reaction with gDNA Eraser (# RR 047A).

A. Removing genome DNA reaction: preparing a reaction mixed solution on ice according to the following table, placing a PCR tube filled with the reaction solution in a PCR instrument, and storing a reaction product at 4 ℃ for 2min at 42 ℃;

B. reverse transcription reaction: the components in the following table are added into a PCR tube according to corresponding usage amount to prepare reaction liquid, experimental operation is carried out on ice, the reaction system is well mixed, and the mixture is centrifuged for a short time, so that the solution on the tube wall is collected at the tube bottom.

cDNA Synthesis reaction conditions: storing at 37 deg.C, 15min, 85 deg.C, 5s, 4 deg.C.

(4) RT-qPCR reaction

Real-time fluorescent quantitative PCR was performed on the Bio-Rad CFX96 platform using iTaq Universal SYBR Green supermix reagent. The reaction system is as follows:

the lncRNA specific primer sequence is:

SEQ ID No.2(lncRNA MYB-96KS-F)：5′-gaagcatcagatgaagagggaagg-3′

SEQ ID No.3(lncRNA MYB-96KS-R)：5′-ttcttttttctttttttttctttttttttttgccatggt ctagtc-3′

the PCR reaction program is: pre-denaturation at 95 ℃ for 30 s. 5s denaturation at 95 ℃, 30s amplification at 60 ℃ for 35 cycles. By using 2^-ΔΔCtThe method calculates the relative expression of the target fragment, 3 biological replicates per sample. The results showed that this long non-coding RNA (denoted MYB-96KS) was specifically expressed in leukemia-associated cells such as K562, U937 and HL-60, as shown in FIG. 3.

Example 3 lncRNA MYB-96KS overexpression and knockdown vector construction

Overexpression and knock-down vectors were constructed using the lncRNA MYB-96KS full-length sequence obtained in example 1. The T vector plasmid of example 1 was diluted to 1 ng/. mu.L, and subclone PCR was performed using this as a template.

1. Construction of pLVX-MYB-96KS overexpression vector

(1) The pLVX-IRES-Neo plasmid was used to construct a pLVX-MYB-96KS overexpression vector. Two restriction enzyme sites were first selected based on the sequences of pLVX-IRES-Neo plasmid and MYB-96KS, EcoRI and XbaI, respectively. Then designing a subcloning primer of an enzyme cutting site, wherein the sequence is as follows:

MYB-96KS-EcoRI-F:

5′-ggaattcgaagcatcagatgaagagggaagg-3′

MYB-96KS-XbaI-R:

5′-gactagtttcttttttctttttttttctttttttttttgccatggtctagtc-3′

(2) adding enzyme cleavage site PCR

Reaction system:

reaction conditions are as follows: denaturation at 98 deg.C for 10s, denaturation at 55 deg.C for 5s, and denaturation at 72 deg.C for 1min, and circulation for 30 times.

After the reaction is finished, identifying the PCR product by 1% agarose gel electrophoresis and recovering.

(3) Double enzyme digestion of target fragment and pLVX-IRES-Neo plasmid

Double cleavage System (50. mu.L):

the reaction conditions are 37 ℃ and 4h, 65 ℃ and 20 min. And (4) after the double enzyme digestion is finished, cutting the gel of the double enzyme digestion product and recovering.

(4) Connection of

Ligation system (20 μ L):

the reaction conditions are 16 ℃, 20h, 65 ℃ and 10 min.

After the completion of ligation, transformation, identification and plasmid extraction were carried out according to the method described in example 1, to obtain pLVX-MYB-96KS plasmid.

2. Construction of sh-MYB-96KS knockdown plasmid

(1) The pLKO.1-TRC cloning plasmid was used to construct the sh-MYB-96KS knockdown vector. EcoRI and AgeI are used as restriction enzyme sites respectively.

(2) The sequence of the specific shRNA is designed and used for constructing a vector as follows:

MYB-96KS-shRNA-F：5′-ccggctagacaagttaggctttaaactcgagtttaaagcctaacttgtctagtt tttg-3′

MYB-96KS-shRNA-R：5′-aattcaaaaactagacaagttaggctttaaactcgagtttaaagcctaacttgt ctag-3′

(3) annealing of primers

The annealing system (50 μ L) was configured as follows:

the temperature was allowed to slowly cool to room temperature at 95 ℃ for 5min, followed by 70 ℃ for 10 min.

(4) pLKO.1-TRC cloning vector double digestion

A double enzyme digestion reaction system:

the enzyme digestion conditions are set as follows: 37 ℃ for 4 h; at 65 deg.C for 20 min. And (4) after the double enzyme digestion is finished, cutting the gel of the double enzyme digestion product and recovering.

(5) Connection of

Ligation system (20 μ L):

the reaction conditions are 16 ℃, 20h, 65 ℃ and 10 min.

After the completion of ligation, transformation, identification and plasmid extraction were carried out according to the method described in example 1, to obtain sh-MYB-96KS plasmid.

Example 4 Effect of lncRNA MYB-96KS overexpression/knockdown on MYB expression

(1) Lentiviral packaging

293T cells are planted in a 10cm cell culture dish, and plasmids are transfected when the confluence degree of the cells reaches 70-80% after 2-3 generations of cell culture.

Transfection was performed using a total of 18.9. mu.g of viral packaging plasmid (pCMV-dR8.91), envelope protein plasmid (pCMV-VSVG) and pLVX-MYB-96KS or sh-MYB-96KS, at the ratio of pCMV-dR8.91: pCMV-VSVG: pLVX-MYB-96KS/sh-MYB-96KS ═ 10: 1: 10.

the plasmid is added into 720 mul serum-free and double-antibody-free DMEM medium, 40 mul Transfection Reagent Turbofect Transfection Reagent is added, vortex mixing is carried out, centrifugation is carried out for a short time, and incubation at room temperature is carried out for 15-20 min.

The incubated mixture was gently added dropwise to 293T cells. Gently mixing, and standing at 37 deg.C and 5% CO₂Culturing for 12h in an incubator under the condition. After which 8mL fresh medium was replaced.

After transfection for 48h and 72h, cell culture fluid is collected respectively, cell debris is removed by centrifugation for 10min at 1500g, and the obtained virus supernatant is stored temporarily at-80 ℃ or 4 ℃.

(2) Lentiviral infection of K562 cells

K562 cells were seeded in 6cm cell culture dishes, infected with virus supernatant when the confluency of cells reached 70-80%, and Polybrene was added to a final concentration of 8. mu.g/mL to enhance the infection efficiency of the virus. Mixing at 37 deg.C with 5% CO₂Culturing in incubator for 12h, continuously sensing for multiple times, removing virus supernatant, adding fresh culture solution, and culturing for 36 h.

(3) Protein extraction

The K562 cells were centrifuged at 800rpm for 5min and the supernatant was discarded. 2ml of DPBS was added to wash the cells 2 times and the DPBS was discarded, 200. mu.L of cell lysate (RIPA: 50 xPI: 100Mm PMSF: 97:2:1) was added, the cells were lysed on ice for 20-30min and sonicated for 5s, followed by another 5s at 10s intervals and repeated 4 times. After completion of sonication, 12000g at 4 ℃ was centrifuged for 10min, 2. mu.L of the supernatant was collected for concentration measurement, and the remaining supernatant was transferred to a new 1.5mL centrifuge tube.

(4) Protein concentration determination (protein concentration determination by Bradford method)

BSA protein standards (5mg/mL) were diluted to 200. mu.g/mL using 1 XPBS and a concentration gradient of standard protein was prepared as follows.

The protein sample obtained in step (3) was diluted 40-fold with 1 × PBS. 20. mu.L each of the protein solution and the sample diluent at each concentration in the tubes No.1 to No. 8 in the above table were added to a 96-well plate, and each sample was repeated 3 times. 200. mu.L of Bradford reagent was added to each well and shaken rapidly to homogenize the mixture. Standing at room temperature for 5 min. And (3) taking the No.1 tube as a blank control, measuring the A595 light absorption value of each hole on an enzyme labeling instrument, and calculating the dilution concentration according to a standard curve.

(5) Western blot experiment

Preparation of SDS-PAGE gels: preparing 8% separation gel, adding sterilized ddH into 15mL tube₂And O, sequentially adding 30% of acrylamide, 1.5M Tris-HCl (pH 8.8) and 10% SDS, uniformly mixing, adding 10% of ammonium persulfate and TEMED, and lightly shaking. Adding the separation gel to a glass plate, adding ddH₂And O, filling the liquid level to make the glue smooth. Standing at room temperature for about 30min, solidifying, pouring off water, and sucking off excessive water with absorbent paper. Then 5% concentrated gel is prepared, and sterilized ddH is added in sequence₂O, 30% acrylamide, 0.5M Tris-HCl (pH 6.8) and 10% SDS, and after mixing, 10% ammonium persulfate and TEMED are added. After the concentrated glue is added, the hole comb is vertically and slowly inserted into the interlayer, and is pulled out after the gel is solidified.

SDS-PAGE electrophoresis: the electrophoresis apparatus was placed in the electrophoresis tank, and the space between the two glass plates was filled with the electrophoresis buffer, and the electrophoresis buffer was poured to a prescribed height in the electrophoresis tank. Before loading, the protein samples were applied to a sealing membrane, boiled in boiling water for 5min, centrifuged at 12000g for 1min, and 30. mu.g protein was applied to each lane. Electrophoresis conditions: the first stage is 80V and 30 min; second stage 150V, 40 min.

Film transfer: NC film of suitable size, put into ddH₂And (4) activating in O. Fully soaking filter paper and sponge by using a pre-cooled transfer membrane liquid at 4 ℃, placing a black surface of a transfer membrane clamp at the lowest part, and sequentially placing the sponge and three pieces of overlapped filter paper. And after removing the concentrated glue, slightly placing the lower layer glue on the filter paper, continuously covering the NC membrane, overlapping three layers of filter paper and the spongy cushion, driving out bubbles in the filter paper, and closing the clamp. And (3) placing the film rotating clamp into a film rotating groove, placing the whole film rotating device in ice, and rotating the film for 1h at 100V. After the membrane transfer is finished, the membrane is dyed for 5min by 1 XLichun red dyeing liquid.

And (3) sealing: the NC membrane was blocked with 5% skim milk on a shaker for 2 h.

Immune reaction: antibodies, MYB primary (1:2000), beta-actin antibodies (1:4000) were diluted with 5% skim milk and incubated with NC membranes on a shaker at 4 ℃ overnight. The filters were rinsed 3 times for 10min each time in TBST. The secondary antibody with horseradish peroxidase is diluted with 5% skimmed milk (1:2000), and the secondary antibody is added to an NC membrane and incubated at room temperature for 1-2 h. After incubation, TBST was washed 3 times for 10min each.

Chemical development: preparing a developing solution in a brown tube according to a ratio of Peroside solution to Luminol/enhancer 1:1, uniformly dripping the developing solution on the front surface of an NC membrane, incubating for 5min, and carrying out exposure and photographing for detection.

The results are shown in FIG. 4.

Example 5 Effect of lncRNA MYB-96KS overexpression/knockdown on proliferation and migration of the leukemia cell line K562

(1) Cell culture and transfection

K562 cells were transfected with pLVX-MYB-96KS and sh-MYB-96KS plasmids, respectively. The culture and transfection of K562 cells were carried out according to the method of example 4.

(2) CCK-8 experiment

After counting transfected K562 cells, 100 μ L of cell suspension (2000 cells) was added per well in a 96-well plate. CCK-810. mu.L was added to each well after 0, 24, 48, 72, 96h of transfection, respectively, and wells without cells were used as blanks. Incubation was continued for 2 h. The absorbance at 450nm was measured by a microplate reader.

The results are shown in FIG. 5, wherein the left panel of FIG. 5 is the result of transfection of an overexpression plasmid (pLVX-MYB-96KS) and a blank pLVX plasmid (vector); FIG. 5 right panel shows the results of transfection of knockdown plasmid (using sh-MYB-96KS) and blank sh plasmid (sh NC).

Sequence listing

<110> Shanghai ocean university

<120> long-chain non-coding RNA for regulating protooncogene MYB and application thereof

<130> W-21-1-02452

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2142

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gaagcatcag atgaagaggg aaggcagagc agtgagaagt ctttgaatga gacctttgag 60

cttgtattgc agacttggga actcacctca tgtaatgggg aaaacaggct gattatttag 120

ttctttttta ttaaaaaaac tctataatta taataaaacc ctttttaatt tatttaccta 180

atatcccctt gcctgaaatg tctttttttt ttttgttttt gttttttgag acagggtctg 240

gctctgttgc ccaggctgga gcttggctca ctgcaacctc cacctcccgg cctcaaatta 300

tcctcccacc tcagtctcct gagtagctgg gactacaggc atgaggcacc acacccaggt 360

aatttttgta tttttggtag aaacaaggtt tcaccatgtt ggccagctgg tctcaaactc 420

ctggcctcaa gcaatcctcc cgcctcagtc tctcaaagta atccttcagt ctaatcacca 480

aaagtaatag cttgtttctg ctgtgaagga aatctacaat aataattata ttgagtgttt 540

tcatacattt gattagtata accaaataat ttcaataagt ataaagattt aaaatgaaca 600

tttccttaat gttgtttaac ctgcattata ggttttattt acaactcaac ccttatccat 660

aaataatagt ctcaaatatt tactaaaagt caatatattt tgtgtatgat atcacagcca 720

taaaaacaat caaattagaa gtagcattta cagtattagt cacagatagg aaaccataat 780

ttagtgaaga ataacaaaaa taaataaata tagattgaca gatacatagt tagattctga 840

aatttaactt tggctttacc caaccttgtt gagaatgaaa tcatgtatgc agggtgcctt 900

aaaggcactt ttttcctaaa aattgtatat attggaaata attcaccaag aaaatcctaa 960

gaaagaaaaa gagtttatgt gattgacttt gggttatcaa agcaaagact atccagggta 1020

aataacaggc agaggatagt gattacagct catttattaa aatagcaaca ttggtacata 1080

tctgagtcaa gcctggaact ccccctccct ctcaactaga caagttaggc tttaaaatta 1140

ctgtaaaaat taagtcaaat tgcctgtgaa ggtaagctct tagaagaatt ttttaggtag 1200

atgatctaca taacaagaca tgcaccaacc aaatctgcag tcaaatattg ggggaaaaaa 1260

gcaacaacag taggtttgtg tttattgcga tgtctggaat attttaaaaa ttaagctcct 1320

ggcctcagcc tagggatttc taatcaattc caggaaatgt actgtatctt tccttgaggc 1380

cagcaggaaa gccccttggc aagggtgtct ggaatggcca cttgacatcc ccagcacacc 1440

tcttgccaaa gttacccatg gctgctgaca gagagactga tgtgctgcca cagattgact 1500

ttagggatga acagatcaag atcaactaat ctgggcagat gcattaaagt gtttctgtgt 1560

atttaagcat accatagaaa gacaaattca acagctttca ctttgctttc atacaacgtt 1620

gttctcttac gtgttttcta tttttgttta tatactaatt tcctctagat tgactgggtt 1680

ctaaatttat tatgaatttg gtaaagcctc tgaactttgt gtttctatat tacacacctt 1740

gtgtctgtga ctactgttgt ggttatacac tcgggatttt gaagtctcaa cgataatcac 1800

cataagtcat ttttagcagc tctgtttaaa agattccatc agtagaaatt cagcacgggt 1860

aactttcact taaacattcc agaccctcag aatcctttac atttaagtga tgtgttaaaa 1920

acaatggcac ctctttttac ttaatttcag tcacatttgg aagaagataa gaaagtttat 1980

tctgaactcc atcactcact attactgagt ttgcttcatt gttgaaacta gggaaaatta 2040

gtccgaggtt tcaaaaaagc agctaaacaa ttttttttcc aaattcttat ccaccatgac 2100

tagaccatgg caaaaaaaaa aagaaaaaaa aagaaaaaag aa 2142

<210> 2

<211> 24

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaagcatcag atgaagaggg aagg 24

<210> 3

<211> 45

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttcttttttc tttttttttc tttttttttt tgccatggtc tagtc 45

Claims

1. A long-chain non-coding RNA for regulating and controlling protooncogene MYB or cDNA thereof is characterized in that the cDNA sequence of the long-chain non-coding RNA comprises a nucleotide sequence shown in SEQ ID No. 1.

2. The long non-coding RNA or cDNA thereof according to claim 1, wherein the cDNA sequence is shown in SEQ ID No. 1.

3. The amplification primer for the cDNA of the long non-coding RNA of claim 1 or 2, wherein the nucleotide sequences of the upstream primer and the downstream primer comprise SEQ ID No.2 and SEQ ID No.3, respectively.

4. The amplification primer of claim 3, wherein the nucleotide sequences of the upstream primer and the downstream primer are shown as SEQ ID No.2 and SEQ ID No.3, respectively.

5. A reagent or a kit for detecting the long non-coding RNA or the expression abundance thereof, or the cDNA thereof regulating the protooncogene MYB of claim 1 or 2, which comprises the amplification primer of claim 3 or 4.

6. A recombinant vector comprising the cDNA sequence of the long non-coding RNA of claim 1 or 2.

7. A transfection vector comprising the recombinant vector according to claim 6.

8. The use of the long non-coding RNA or cDNA thereof regulating the protooncogene MYB of claim 1 or 2 in the preparation or screening of a medicament for treating tumors, or in the preparation of a diagnostic reagent for detecting tumors.

9. The use of the amplification primer of claim 3 or 4, the kit of claim 5, the recombinant vector of claim 6 or the transfection vector of claim 7 for preparing or screening a medicament for treating tumors, or for preparing a diagnostic reagent for detecting tumors.

10. The use according to claim 8 or 9, wherein the neoplasm is leukemia.