CN114150054B - Reagents for detecting or assessing ionizing radiation damage or exposure and tRNA-derived fragments thereof - Google Patents

Abstract

Reagents for detecting or assessing ionizing radiation damage or exposure and tRNA derived fragments thereof are disclosed. Specifically disclosed are biomarkers tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019 for detecting or assessing ionizing radiation damage or exposure. Through RT-qPCR technical verification and ROC curve analysis, the biomarker gene expression level is obviously related to radiation exposure, has higher specificity and sensitivity when judging whether receiving ionizing radiation, and can be used as a basis for supporting an individual to suffer from ionizing radiation damage or exposure. The method for evaluating the damage or exposure risk of the subject to the ionizing radiation by using the biomarker has the characteristics of high sensitivity, good specificity, no wound, quick detection and good stability, and has wide clinical application prospect.

Description

Reagents for detecting or assessing ionizing radiation damage or exposure and tRNA-derived fragments thereof

Technical Field

The invention relates to the field of reagents for in vitro diagnosis in medical examination and inspection instruments and services in the biomedical engineering industry, in particular to a reagent for detecting or evaluating ionizing radiation damage or exposure and a tRNA derivative fragment used by the reagent.

Background

Transfer RNAs (transfer RNAs, trnas) are important tool molecules involved in the protein translation process that specifically recognize codons in messenger RNA (mrna) molecules and carry amino acid groups for incorporation into newly synthesized polypeptide chains. Recent studies have shown that tRNA can also serve as one of the major sources of non-coding small RNAs (sncRNAs). tRNA can produce many kinds of tRNA fragment molecules through a precise biological shearing process, and these molecules are mainly divided into two major categories: namely tRFs (tRNA derived fragments) and tiRNAs (tRNA moieties, tRNA half molecules) which are widely present in tissue cells of various organisms and have specific molecular size, nucleotide composition, biogenesis processes and important biological functions. Serum is a sample that is easy to collect and detect, and is an ideal carrier for finding biomarkers. Researches show that the sncRNA molecules in blood mostly exist in a form of being wrapped by phospholipid bilayer structure vesicles, and have good stability in the processes of extraction and storage. Among these blood sncRNA molecules, tRNA fragment molecules are more abundant and easier to detect. The currently widely used technologies such as real-time fluorescent quantitative PCR (RT-qPCR), digital PCR and the like can quickly and accurately detect the level change of tRNA fragments in serum samples.

Ionizing radiation is widely present in nature, space and artificial nuclear facilities, and artificial ionizing radiation has been spread in various fields of production applications, such as agricultural mutation breeding, sterilization and preservation of food and drugs, medical X-ray fluoroscopy, tumor radiotherapy, and the like, as well as various accelerators, electron microscopes, high-pressure electron tubes, and the like. The ionizing radiation has strong penetrability, and can directly act on the structure and macromolecules of cells to cause structural damage and functional damage of DNA and organelles; on the other hand, it can act on water molecules in cells and mesenchyme to generate a large amount of free radicals with strong oxidizing property to indirectly cause damage of cells. The biological effect of ionizing radiation on human bodies is related to irradiation dose, and ionizing radiation exceeding the safe dose limit value can cause a series of injuries to the bodies, including gene mutation, cell death, skin necrosis, retina and lens lesion, digestive system injury, hematopoietic and immune system injury, organ failure and other acute radiation symptoms, and can also obviously increase the risk of long-term effects such as cancer, genetic diseases and the like. With the rapid development of nuclear energy, nuclear weapons, radiation medicine and space exploration, the detection and evaluation of ionizing radiation damage or exposure become important requirements, and the research and development of products for detecting and evaluating ionizing radiation damage or exposure have important social significance and wide application value.

The detection of ionizing radiation in the environment generally uses a physical dosimeter, but due to the randomness of an irradiation field and the radiation sensitivity difference among different individuals, the effective absorbed dose and the radiation damage effect of different individuals are difficult to be comprehensively and accurately reflected by the detection of the physical dosimeter only. The biomarker is a biochemical index which can be detected, can reflect the condition that different individuals are damaged by radiation in a personalized way, and can make up for the defects of the physical dosimeter. Reliable biomarkers are crucial for rapid and accurate assessment of ionizing radiation absorbed dose and for effective countermeasures. Currently, the main biomarkers for detecting ionizing radiation exposure include chromosome aberration of lymphocytes, micronuclei of cells, chromosome analysis of premature agglutination and the like, but the markers based on cell determination have defects and are not ideal in timeliness, convenience, stability and sensitivity.

Based on the background, the serum tRNA fragment molecule responding to ionizing radiation has the advantages and potential of serving as a convenient, reliable and minimally invasive new radiation biomarker, can be used as one of the bases for judging the damage or exposure of an individual to the ionizing radiation, plays an important role in evaluating the effect caused by the exposure of the ionizing radiation, and has important significance for the health of human beings.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a tRNA derivative fragment biomarker and/or application of a reagent for detecting the biomarker in preparation of a product for detecting or evaluating ionizing radiation damage or exposure. The technical problem to be solved is not limited to the technical subject as described, and other technical subject not mentioned herein may be clearly understood by those skilled in the art through the following description.

In order to solve the technical problems, the invention firstly provides a biomarker for detecting or evaluating ionizing radiation damage or exposure, the biomarker is selected from one or more of tRNA-derived fragments (tNF), namely tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019, the nucleotide sequence of the tRF-Gln-CTG-018 is SEQ ID No.1, the nucleotide sequence of the tRF-Lys-CTT-008 is SEQ ID No.2, and the nucleotide sequence of the tRF-Lys-TTT-019 is SEQ ID No. 3.

Specifically, the biomarker may be any one of the following:

(1)tRF-Gln-CTG-018；

(2)tRF-Lys-CTT-008；

(3)tRF-Lys-TTT-019；

(4) tRF-Gln-CTG-018 and tRF-Lys-CTT-008;

(5) tRF-Gln-CTG-018 and tRF-Lys-TTT-019;

(6) tRF-Lys-CTT-008 and tRF-Lys-TTT-019;

(7) tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019.

To perform more accurate detection or assessment of ionizing radiation damage or exposure in a subject, in one embodiment of the invention, the biomarker is a combination of tRNA derived fragments: tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019.

Further, in the above biomarkers, the biomarkers tRF-Gln-CTG-018 and/or tRF-Lys-CTT-008 and/or tRF-Lys-TTT-019 are down-regulated in the serum of a subject who is damaged or exposed by ionizing radiation.

The invention also provides the use of a tRNA derived fragment as a biomarker for detecting or assessing ionizing radiation damage or exposure, or for the manufacture of a product for detecting or assessing ionizing radiation damage or exposure;

the tRNA derivative fragment is selected from one or more of three tRNA derivative fragments of tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019, the nucleotide sequence of the tRF-Gln-CTG-018 is SEQ ID No.1(GGUUCCAUGGUGUAAUGGUUAGCACUCU), the nucleotide sequence of the tRF-Lys-CTT-008 is SEQ ID No.2(GCCCGGCUAGCUCAGUC), and the nucleotide sequence of the tRF-Lys-TTT-019 is SEQ ID No.3 (AGCCCGGAUAGCUCAGUCGC).

The invention also provides the use of a reagent for detecting the biomarker for the manufacture of a product for detecting or assessing damage or exposure to ionising radiation.

The product can be, but is not limited to, a kit, a chip, a strip, or a high throughput sequencing platform.

The reagent may be a reagent for detecting the expression level of the biomarker.

In the above application, the reagent comprises a primer for specifically amplifying the biomarker or the gene thereof, and/or a probe for specifically recognizing the biomarker or the gene thereof, and/or a binding agent for specifically binding the biomarker or the gene thereof.

The binding agent may be a peptide, a peptidomimetic, a protein, or an antibody.

In the above application, the primer is selected from at least one pair of primers as follows:

A1) primer F1 and primer R1; the primer F1 is a single-stranded DNA molecule shown in SEQ ID No. 4;

A2) primer F2 and primer R1; the primer F2 is a single-stranded DNA molecule shown in SEQ ID No. 5;

A3) primer F3 and primer R1; the primer F3 is a single-stranded DNA molecule shown in SEQ ID No. 6;

the primer R1 is a single-stranded DNA molecule shown in SEQ ID No. 7.

The primer F1, the primer F2 and the primer F3 are forward primers; primer R1 is a reverse universal primer.

The primer F1 and the primer R1 are used for specifically amplifying the gene of the biomarker tRF-Gln-CTG-018;

the primer F2 and the primer R1 are used for specifically amplifying the gene of the biomarker tRF-Lys-CTT-008;

the primer F3 and the primer R1 were used to specifically amplify the gene of the biomarker tRF-Lys-TTT-019.

The invention also provides products for detecting or assessing ionizing radiation damage or exposure, which products comprise reagents for detecting the biomarkers.

The product is used for detecting the content of the biomarker or the expression level of the biomarker gene.

Further, the product comprises a reagent for detecting the expression level of the biomarker.

Further, the reagents include primers that specifically amplify the biomarkers, and/or probes that specifically recognize the biomarkers.

Further, the product may be a kit, a chip, a strip or a high throughput sequencing platform, but is not limited thereto.

Further, the kit may be a qPCR kit, a digital PCR kit, but is not limited thereto.

Further, the kit also comprises Taq DNA polymerase, dNTP, PCR buffer solution and Mg required by PCR amplification ²⁺ One or more of (a).

Further, the kit further comprises a readability carrier. The readable carrier can be instructions (e.g., instructions in printed form) on detecting and assessing whether and to what extent the subject has been damaged or exposed to ionizing radiation or a computer-readable medium (e.g., floppy disk, CD, etc.) on which information has been recorded.

The present invention also provides a method of detecting or assessing ionizing radiation damage or exposure in a subject, the method comprising the steps of:

B1) extracting total RNA from a serum sample of a subject;

B2) reverse transcribing the total RNA into cDNA;

B3) specifically amplifying the genes of the biomarkers from the cDNA, and detecting the change of the expression amount of the biomarkers;

B4) the change in the expression level of the biomarker can be used as a basis for judging whether the subject is damaged or exposed by ionizing radiation and the exposure degree.

The PCR may be qPCR or digital PCR.

In the above method, the detecting of the change in the expression level of the biomarker in B3) may be detecting a relative change in the expression level of the biomarker gene by real-time fluorescent quantitative pcr (qpcr) using the primer that specifically amplifies the biomarker.

In the above method, the detecting of the change in the expression level of the biomarker in B3) may be detecting a relative change in the expression level of the biomarker gene by real-time fluorescent quantitative PCR using the primer.

The primer may be a primer F1(SEQ ID No.4), a primer F2(SEQ ID No.5), a primer F3(SEQ ID No.6) and/or a primer R1(SEQ ID No. 7).

In one embodiment of the invention, the biomarker is a combination of tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019 (tRNA fragment combination), and the level of tRNA fragment molecules in the serum of a subject is compared with that of a normal healthy individual, and when the relative expressions of all three molecules, tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019, are decreased and the amounts of the changes are more than 1.5 times, the subject is determined to be at risk of being damaged or exposed by ionizing radiation, and the serum tRNA fragment combination can be used as a basis for determining that the individual is damaged or exposed by ionizing radiation.

The invention also provides the use of the biomarker in the manufacture of a product for detecting or assessing damage or exposure to ionising radiation.

The primer and/or the application of the primer in preparing a product for detecting or evaluating the damage or exposure of the ionizing radiation are also within the protection scope of the invention.

The above uses and methods may be for disease diagnosis purposes, disease prognosis purposes and/or disease treatment purposes, or they may be for non-disease diagnosis purposes, non-disease prognosis purposes and non-disease treatment purposes; their direct purpose may be to obtain information on the outcome of a disease diagnosis, prognosis of a disease and/or intermediate outcome of a disease treatment, and their direct purpose may be non-disease diagnosis, non-disease prognosis and/or non-disease treatment.

The terms "tRNA fragment molecule", "tRNA fragment" and "tRNA-derived fragment" have the same meaning and are used interchangeably herein.

Herein, the subject may be a human or a mouse.

Although the examples provided herein utilize the method of qPCR to detect biomarkers in serum samples, the invention is not limited to this particular method. Those skilled in the art may use any other suitable method (e.g., digital PCR, etc.) for detecting biomarkers in a serum sample without departing from the scope of the present invention, which is intended to be included herein.

Compared with the prior art, the invention has the following advantages:

1. the serum tRNA fragment molecules exist in a form of being wrapped by vesicles, and the abundance is high. Compared with protein and lipid biomarkers, the method is more stable in the extraction and storage processes, and the detection result is more reliable and accurate.

2. The serum tRNA fragment molecular combination can be detected by adopting a conventional RT-qPCR technology or a digital PCR technology, has high detection precision, and can greatly improve the specificity and sensitivity of a marker in radiation damage or exposure judgment compared with the conventional lymphocyte chromosome aberration detection.

3. The serum tRNA fragment molecule combination is detected by adopting a conventional RT-qPCR technology or a digital PCR technology, the detection time is 4 to 6 hours, the conventional lymphocyte chromosome aberration detection needs 2 to 3 days, and the method is more convenient and faster and can greatly shorten the time for evaluating ionizing radiation damage or exposure risk.

The invention provides for the first time the use of serum tRNA derived fragments as biomarkers for detecting or assessing whether a subject is at risk of being damaged or exposed to ionizing radiation, said biomarkers being one of the criteria for assessing whether a subject is damaged or exposed to ionizing radiation. The invention provides a serum tRNA fragment molecular combination which is tRF-Gln-CTG-018, tRF-Lys-CTT-008 or tRF-Lys-TTT-019. Through RT-qPCR technical verification and ROC curve analysis, the levels of serum tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019 are obviously related to radiation exposure, and the serum tRF-Gln-CTG-008 and tRF-Lys-TTT-019 have higher specificity and sensitivity when judging whether receiving ionizing radiation or not, and can be used as a basis for supporting an individual to suffer from ionizing radiation damage or exposure. The invention also provides a method for detecting or evaluating the ionizing radiation damage or exposure of a subject by using the biomarker, and the method has the characteristics of high sensitivity, good specificity, no wound, quick detection and good stability, and has wide clinical application prospect.

Drawings

FIG. 1 shows the screening of tRNA derivative fragment molecules in example 1.

FIG. 2 is a graph showing the relative expression changes of mouse serum tRF-Gln-CTG-018 after carbon ion irradiation and X-ray irradiation by RT-qPCR technology. (The, # denotes P <0.05, # denotes P <0.01, and Students't test was used to analyze significance).

FIG. 3 is a graph showing the relative expression changes of mouse serum tRF-Lys-CTT-008 after carbon ion irradiation and X-ray irradiation by using RT-qPCR technology. (The, # denotes P <0.05, # denotes P <0.01, and Students't test was used to analyze significance).

FIG. 4 is a graph showing the relative expression change of mouse serum tRF-Lys-TTT-019 after carbon ion irradiation and X-ray irradiation by RT-qPCR technique. (The, # denotes P <0.05, # denotes P <0.01, and Students't test was used to analyze significance).

FIG. 5 is a graph of the specificity and sensitivity of serum tRF-Gln-CTG-018 when differentiating between non-irradiated and irradiated groups using a ROC curve.

FIG. 6 is a graph showing the specificity and sensitivity of analysis of serum tRF-Lys-CTT-008 by ROC curve in distinguishing between the non-irradiated and irradiated groups.

FIG. 7 is a graph showing the analysis of the specificity and sensitivity of serum tRF-Lys-TTT-019 in distinguishing the non-irradiated group from the irradiated group using a ROC curve.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 detection of tRNA derived fragments and determination of ionizing radiation injury or Exposure

In this example, 30 model laboratory animals Kunming mice (7-8 weeks old, 30. + -.2 g in body weight, available from university of Lanzhou medical school) were divided into 5 groups of 6 mice each. The mice of different groups were irradiated whole body with 80MeV carbon ion beam generated by Lanzhou heavy ion accelerator at a dose rate of 0.5Gy/min and at doses of 0, 0.05, 0.1, 0.5 and 1Gy, respectively, wherein the 0Gy group was the control group. 24 hours after the irradiation experiment, a mouse serum sample was collected and stored at-80 ℃. Serum samples were submitted to Shanghai Kangcheng/Spectroscopy biology, Inc. for small RNA fragment sequencing, the target fragment length of sequencing was 14-40 nucleotides (nt), and the Illumina NextSeq 500 system was used for sequencing. Comparing the sequence of the small RNA fragment obtained by sequencing with a Genomic tRNA Database, and obtaining the molecular information of the tRNA fragment, including the molecular name and the type of the tRNA fragment. The expression quantity of the tRNA fragment in the irradiation groups with different doses is respectively compared with that of a control group, so that the relative expression change multiple of the tRNA fragment molecule after irradiation can be obtained. Of these, 17 molecules whose expression was elevated and varied by more than a factor of 1.5 relative to the expression in all four dose groups (0.05, 0.1, 0.5 and 1 Gy); there were 9 molecules with reduced expression and more than 1.5 fold change in relative expression in all four dose groups. In order to make the molecule more easily detectable, we selected the most abundant 10 molecules (the most fragments obtained by sequencing) from the 26 molecules mentioned above to perform the validation experiment. The verification experiment adopts a real-time quantitative PCR method and is completed by Shanghai Kangcheng/digital Spectroscopy biology Limited company. The validation results showed that 9 out of 10 selected tRNA fragment molecules tended to show a down-regulation of expression levels (fig. 1). These 9 tRNA fragment molecules were then screened using three conditions: (1) the molecule was downregulated in expression in all four of the irradiated groups; (2) the expression level of the irradiated group is significantly different from that of the control group by the analysis of variance (P < 0.05); (3) the abundance (number of fragments sequenced) of this molecule exceeded the average of the 10 candidate molecules described above.

Three tRNA derivative fragments, namely tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019, meeting the three conditions are screened out. And constructing a method for detecting the expression level of the biomarker and judging the damage or exposure of ionizing radiation by taking tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019 as the biomarker. The biomarker is used for detecting or evaluating ionizing radiation damage or exposure, the nucleotide sequence of the tRF-Gln-CTG-018 is SEQ ID No.1(GGUUCCAUGGUGUAAUGGUUAGCACUCU), the nucleotide sequence of the tRF-Lys-CTT-008 is SEQ ID No.2(GCCCGGCUAGCUCAGUC), and the nucleotide sequence of the tRF-Lys-TTT-019 is SEQ ID No.3 (AGCCCGGAUAGCUCAGUCGC).

On the basis of the determined tRNA derivative fragment biomarker, a method for detecting the expression level of the biomarker and judging the damage or exposure of ionizing radiation is constructed, and the specific implementation steps are as follows:

the serum samples to be tested included 6 irradiated samples and 6 normal healthy controls, the source being mice.

1. Extraction of total RNA from serum sample to be tested

Because of the low abundance of RNA in Serum samples, purification using the MIRNeasy Serum/Plasma Kit from QIAGENE is recommended. Before extraction, exogenous nematode cel-miR-39 is added as an internal reference for normalization processing of data after PCR reaction. The specific operation process is as follows:

(1) serum samples were thawed, 5 sample volumes of QIAzol lysine Reagent were added, vortexed and mixed. For example, 200ul of serum was added to 1mL of QIAzol lysine Reagent.

(2) Standing at room temperature for 5min, adding 3.5ul cel-miR-39(1.6 × 10) ⁸ copies/ul)。

(3) Equal volume of chloroform was added to the starting sample, the lid was closed and shaken vigorously for 15 s.

(4) And (5) incubating for 2-3 min at room temperature. Centrifuge at 12000r/min for 15min at 4 ℃.

(5) The supernatant was removed to a new EP tube and any mesophase aspiration was avoided. Adding 100% alcohol with the volume of 1.5 times of the total volume, and blowing, beating and uniformly mixing.

(6) At most 700uL of sample is aspirated, added to RNeasy MinElute spin column (for aggregating nucleic acids in solution, kit provided), centrifuged at room temperature at > 8000r/min for 1min, and the effluent is discarded.

(7) The remaining samples were repeated the previous step.

(8) 700uL of BufferRWT was added to RNeasy MinElute spin column. Centrifuging at room temperature at a speed of more than 8000r/min for 30s, and discarding the effluent.

(9) 500uL Buffer RPE was pipetted into the RNeasy MinElute spin column. Centrifuging at room temperature at a speed of more than 8000r/min for 30s, and discarding the effluent.

(10) 500uL of 80% ethanol was added to RNeasy MinElute spin column. At room temperature, 8000r/min or more, and centrifuging for 1.5 min.

(11) RNeasy MinElute spin column was placed in a new collection tube, centrifuged at full speed for 5min, and then the lid was opened and air dried for 5 min.

(12) RNeasy MinElute spin column was placed in a new 1.5mL RNase-free EP tube. 20ul RNase-free water was added directly to the center of spin column membrane. The lid was gently closed and the RNA was eluted by centrifugation at full speed for 2 min.

(13) The purity and concentration of the purified RNA were determined using a Nanodrop2000 ultraviolet spectrophotometer and stored at-80 ℃.

2. Reverse transcription of extracted total RNA into cDNA

Reverse transcription of extracted total RNA into cDNA miRNA first strand cDNA synthesis (tailing) kit (purchased from shanghai bio-engineering ltd) was used. According to the kit specification, adding a reaction system into a centrifugal tube in an ice bath and uniformly mixing, wherein the reaction system is shown in table 1:

TABLE 1 reverse transcription System sample addition Meter

Reagent composition	Amount of addition
		2×miRNA P-RT Solution mix	10μL
miRNA P-RT Enzyme mix	2μL
		Total RNA	2μg/100ng
RNase-free water	Make up to 20uL

After the reaction system is mixed evenly, the centrifugal tube is put into a nucleic acid amplification instrument, the reverse transcription program is set to react for 60min at 37 ℃, and then the inactivation is carried out for 5min at 85 ℃. After the reaction is finished, the cDNA product is obtained and is stored at 4 ℃ or stored for a long time at-20 ℃.

3. Real-time fluorescent quantitative PCR detection

Respectively amplifying a tRF-Gln-CTG-018 gene, a tRF-Lys-CTT-008 gene and a tRF-Lys-TTT-019 gene in a cDNA product by a real-time fluorescent quantitative PCR technology:

first, forward amplification primers for tRNA fragments tRF-Gln-CTG-018 gene, tRF-Lys-CTT-008 gene and tRF-Lys-TTT-019 gene need to be designed and synthesized, respectively. Wherein:

the forward amplification primer of the tRF-Gln-CTG-018 gene is a primer F1:

5’-GGTTCCATGGTGTAATGGTTAGCACTCT-3’(SEQ ID No.4)，

the forward amplification primer of the tRF-Lys-CTT-008 gene is a primer F2:

5’-CTAGCTCAGTCGGTAGAGCATGAG-3’(SEQ ID No.5)，

the forward amplification primer of the tRF-Lys-TTT-019 gene is a primer F3:

5’-AGCCCGGATAGCTCAGTCG-3’(SEQ ID No.6)。

the designed primer sequence is provided for Shanghai biological engineering Co., Ltd for synthesis.

The reverse Primer was a Universal reverse Primer R1(Universal adapter PCR Primer) (SEQ ID No.7)

And respectively detecting relative expression changes of the tRF-Gln-CTG-018 gene, the tRF-Lys-CTT-008 gene and the tRF-Lys-TTT-019 gene by using a real-time fluorescent quantitative PCR technology. The Detection adopts an All-in-oneTM miRNA qRT-PCR Detection Kit (purchased from Guangzhou multifunctional Biotechnology Co., Ltd.), and the specific operation process is as follows:

according to the kit instruction, adding the reaction system into an ice-bath centrifuge tube and mixing uniformly, wherein the reaction system is shown in table 2:

TABLE 2 real-time fluorescent quantitative PCR reaction system sample-adding meter

Reagent composition	Amount of addition
		2×All-in-OneTM qPCR Mix	10μL
Synthetic tRNA fragment forward amplification primers	2μL
		Universal Adaptor PCR Primer	2μL
cDNA obtained by reverse transcription	2μL
		RNase-free water	Make up to 20uL

The system is blown, beaten and mixed evenly, then added into a PCR plate, put into a real-time fluorescence quantitative PCR instrument, and set the reaction program as shown in Table 3:

TABLE 3 real-time fluorescent quantitative PCR reaction procedure

Reading Ct values of the serum tRNA fragment molecules and the internal reference molecules, and utilizing 2 ^-△△Ct The method is used for analysis, and the formula is as follows:

relative change multiple (Fold change) of 2- ^△△Ct Δ Ct ═ Δ Ct (irradiation group)) -. DELTA.Ct (non-irradiated group)

Wherein, the delta Ct is Ct (tRNA fragment) -Ct (internal reference), the Ct (tRNA fragment is the Ct value of the tRNA fragment molecule of the invention, and the Ct (internal reference) is the Ct value of the exogenous nematode cel-miR-39 (internal reference) added in the step 1.

The method obtains the relative change multiple of the expression quantity of the 3 tRNA fragment molecules in the serum sample to be detected compared with the 3 tRNA fragment molecules in the serum sample of a normal healthy individual.

4. Determination of ionizing radiation damage or exposure

Comparing the levels of tRNA fragment molecules in the serum of a to-be-detected object and a normal healthy individual, and judging that the to-be-detected object is at risk of being damaged or exposed by ionizing radiation when the relative expressions of the three molecules, namely tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019, are all reduced and the variation is more than 1.5 times, or the serum tRNA fragment combination can be used as a basis for judging that the individual is damaged or exposed by ionizing radiation.

Example 2 validation of tRNA derived fragments as markers of ionizing radiation

1. Preparation of a sample to be tested:

a model laboratory animal Kunming mouse (7-8 weeks old, 30 + -2 g in body weight, available from Lanzhou university medical college) was irradiated systemically with X-rays generated by an X-RAD 225 type X-ray apparatus as representative of low-LET (energy transmission line density) ionizing radiation and a carbon ion beam generated by a Lanzhou heavy ion accelerator cooling storage ring (HIRFL-CSR) biological irradiation terminal as representative of high-LET ionizing radiation. The irradiation dose was 0Gy, 0.1Gy, 0.5Gy and 1Gy, and 4 to 6 mice were used per dose group.

At 24 hours post-irradiation, whole blood from different irradiated doses of mice was drawn into rnase-free EP tubes, avoiding vigorous shaking throughout the process and not allowing impurities to fall into the tubes to prevent hemolysis. Placing whole blood at room temperature for 1h, centrifuging at 4000 rpm for 10 minutes, sucking supernatant clarified serum, placing into a new RNA-free enzyme tube, centrifuging at 4000 rpm for 10 minutes, sucking supernatant, separating to obtain serum sample required by detection, and storing at-80 deg.C.

2. Detection of the tRNA fragment combination molecules

Relative expression assays for the three tRNA fragment molecules, tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019 in serum samples were performed according to the procedure in example 1.

3. Analysis of detection results

Through RT-qPCR relative quantitative detection of serum tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019 of a mouse subjected to ionizing radiation, the relative expression change of three molecules in serum is remarkably reduced and the change multiple is more than 1.5 times (shown in figures 2-4) after the mouse is irradiated by carbon ions or X rays of 0.1Gy, 0.5Gy and 1Gy, and the three serum tRNA fragment molecules are proved to have stronger sensitivity to low LET and high LET ionizing radiation and can be used as ionizing radiation markers.

In order to further ensure the accuracy of the tRNA fragment molecules in ionizing radiation detection, three tRNA fragment molecules are combined for judgment, namely when the relative expressions of the tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019 are all reduced and the variation is more than 1.5 times, the object to be detected is judged to be at risk of being damaged or exposed by ionizing radiation, and the serum tRNA fragment combination can be used as a basis for judging that an individual is damaged or exposed by ionizing radiation.

4. Effect of tRNA derived fragment biomarkers in ionizing radiation detection or evaluation

The specificity and sensitivity of the serum tRNA fragment molecule of the invention for determining ionizing radiation damage or exposure is analyzed by using ROC curve (receiver operating characteristic curve), wherein the AUC (area under the curve) value represents the evaluation effect of the marker, the AUC value is between 0 and 1, and the larger the AUC value, the better the specificity and sensitivity of the marker in determining ionizing radiation exposure is. ROC curve analysis showed that serum tRF-Gln-CTG-018 when differentiating between non-irradiated and irradiated subjects had an AUC value of 0.889 for carbon ion irradiation and 0.825 for X-ray irradiation (fig. 5); serum tRF-Lys-CTT-008, when differentiating between non-irradiated and irradiated subjects, reached 1 AUC for carbon ion radiation and 0.917 for X-ray radiation (FIG. 6); serum tRF-Lys-TTT-019 gave AUC values of 0.964 for carbon ion irradiation and 0.982 for X-ray irradiation when differentiating between unirradiated and irradiated subjects (FIG. 7). Generally, the AUC value in the ROC curve analysis reaches 0.80 or more, which indicates that the marker has better evaluation effect. When the serum tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019 disclosed by the invention are subjected to ionizing radiation exposure judgment of different LETs, the AUC values are obviously greater than 0.80, and the three serum tRNA fragment molecules have better evaluation effects as ionizing radiation markers.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

SEQUENCE LISTING

<110> recent physical research institute of Chinese academy of sciences

<120> reagents for detecting or assessing ionizing radiation damage or exposure and tRNA-derived fragments thereof

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 28

<212> RNA

<213> Artificial sequence (Artificial sequence)

<400> 1

gguuccaugg uguaaugguu agcacucu 28

<210> 2

<211> 17

<212> RNA

<213> Artificial sequence (Artificial sequence)

<400> 2

gcccggcuag cucaguc 17

<210> 3

<211> 20

<212> RNA

<213> Artificial sequence (Artificial sequence)

<400> 3

agcccggaua gcucagucgc 20

<210> 4

<211> 28

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

ggttccatgg tgtaatggtt agcactct 28

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

ctagctcagt cggtagagca tgag 24

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

agcccggata gctcagtcg 19

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

cagtgcgtgt cgtggagt 18

Claims (3)

1. Use of a reagent for detecting a biomarker for the manufacture of a product for detecting or assessing damage or exposure to ionising radiation;

the biomarker is any one of the following:

(1)tRF-Gln-CTG-018；

(2) tRF-Gln-CTG-018 and tRF-Lys-CTT-008;

(3) tRF-Gln-CTG-018 and tRF-Lys-TTT-019;

(4) tRF-Gln-CTG-018, tRF-Lys-CTT-008 and tRF-Lys-TTT-019;

the nucleotide sequence of the tRF-Gln-CTG-018 is SEQ ID No.1, the nucleotide sequence of the tRF-Lys-CTT-008 is SEQ ID No.2, and the nucleotide sequence of the tRF-Lys-TTT-019 is SEQ ID No. 3.

2. The use according to claim 1, wherein the reagents comprise primers that specifically amplify the biomarkers, and/or probes that specifically recognize the biomarkers, and/or binding agents that specifically bind the biomarkers.

3. The use of claim 2, wherein the primers comprise the following primers:

A1) primer F1 and primer R1; the primer F1 is a single-stranded DNA molecule shown in SEQ ID No. 4;

A2) primer F2 and primer R1; the primer F2 is a single-stranded DNA molecule shown in SEQ ID No. 5;

A3) primer F3 and primer R1; the primer F3 is a single-stranded DNA molecule shown in SEQ ID No. 6;

the primer R1 is a single-stranded DNA molecule shown in SEQ ID No. 7.

Images