CN114134176A - Construction of whitefly gene silencing system induced by geminivirus DNA1 molecule - Google Patents

Abstract

The invention relates to a construction of a whitefly gene silencing system induced by a geminivirus DNA1 molecule, which comprises the following steps: (1) 2mDNA1 silent expression vector construction, comprising the step of obtaining a whitefly gene target segment, wherein the target segmentbioBThe PCR purified product and the 2mDNA1 vector are respectively subjected to double enzyme digestion and then are connected to obtain a connecting product of the two; preparing a recombinant silent expression vector to obtain agrobacterium containing the silent expression vector; (2) constructing a 2mDNA 1-mediated whitefly gene silencing system, wherein the construction comprises the step of obtaining a VIGS plant carrying a 2mDNA1 silencing vector; feeding whiteflies; obtaining whiteflies with silent expression vectors; (3) 2mDNA1 mediated horizontal transmission of whitefly gene silencing system, the method horizontally transmits the VIGS effect of the carrier 2mDNA1 through the bemisia tabaci, and achieves the control of whitefly insects by planting VIGS tomato seedlings in small batchesThe field application of (1).

Description

Construction of whitefly gene silencing system induced by geminivirus DNA1 molecule

Technical Field

The invention relates to agricultural insect and pest control, in particular to construction of a whitefly gene silencing system induced by a geminivirus DNA1 molecule.

Background

Whitefly, belonging to the family hemiptera whitefly, the main species are bemisia tabaci, bemisia citri and greenhouse whitefly. Widely distributed in the world, the mode of harming crops is as follows: the plant sap-sucking type plant sap-sucking device is clustered on the leaf back, pierces tissues of plants through needle-shaped piercing-sucking mouthparts to suck leaf sap, and secretes a large amount of honeydew to induce sooty mould, influence photosynthesis of the plants and influence growth of the plants; secondly, the spread virus, which can be spread by whitefly, reaches hundreds of kinds, thus reducing the yield of plant diseases. At present, the control of whitefly insects is still mainly chemical control, so that the problems of drug resistance, environmental pollution and the like are very outstanding, and the insects harm the plant parts as the back surfaces of leaves, so that the control difficulty of contact insecticide is increased.

With the continuous improvement of technical research means, the effect of molecular biology technology in pest control is gradually improved, and the pest control capability and level are improved, and meanwhile, the defects of the traditional pest control method can be overcome. Virus-induced gene silencing (VIGS) is a simple and effective method of interfering with gene expression. VIGS has also been successfully applied to insect gene silencing, for example, TRV vectors have been used to silence the cytochrome of the Lepidoptera herbivora Helicoverpa armigeraP450Genes, and genes derived from Bemisia tabaci (Bemisia tabaci) Is/are as followscypB、hsp70. The VIGS vector is used for insect gene function research to control pests in many cases, but the research on the transmission of the VIGS effect is not available at present.

The 2mDNA1 silencing vector is a DNA1 component of the geminivirus TBCSV and is a vector modified from a geminivirus satellite molecule transmitted by the bemisia tabaci, can be systemically infected with tomatoes, is specifically expressed at the phloem, can generate effective gene silencing in plants, has unique advantages when being applied to plant-mediated bemisia tabaci gene silencing, however, whether the 2mDNA1 silencing vector can be applied to silence the bemisia tabaci gene at present, and whether the bemisia tabaci can transmit VIGS effect, so that the prevention and control effect on the bemisia tabaci is not clear.

Disclosure of Invention

In order to make up for the defects of the prior art, the invention aims to provide a construction method of a geminivirus DNA1 molecule-induced whitefly gene silencing system, which is characterized in that VIGS vector 2mDNA1 is horizontally transmitted through whitefly to achieve VIGS effect, the trouble that related strains need to be cultured in a large scale and the transgenic breeding time and money cost are avoided when a large number of VIGS tomatoes are obtained by an agrobacterium injection method, and a field application method for preventing and controlling whitefly insects by planting treated VIGS tomato seedlings in a small scale is provided.

The purpose of the scheme is realized by the following technical scheme, the construction of a whitefly gene silencing system induced by a geminivirus DNA1 molecule is characterized by comprising the following steps: the method comprises the following steps:

(1) 2mDNA1 silencing expression vector construction

Obtaining a whitefly gene target fragment BtbioBPurified product of PCR of (1)

② the target fragmentbioBThe PCR-purified product of (1) and the 2mDNA1 vector were subjected to double digestion to obtain a target gene containing BamHI and XbaI cohesive endsbioBFragment, 2mDNA1 vector fragment;

③ the target gene containing BamHI and XbaI two cohesive endsbioBThe fragment was ligated with the 2mDNA1 vector fragment to obtain 2mDNA1-bioBA ligation product;

(iv) the 2mDNA1-bioBThe ligation product is hot shocked to transform a clone strain Escherichia coli DH5 alpha; after heat shock treatment, 2mDNA1 specific detection is carried out to obtain 2mDNA1-bioBRecombinant silent expression vector with concentration regulated to 30-40 ng/microliter;

(ii) the 2mDNA1-bioBThe recombinant silent expression vector is transformed into an EHA105 agrobacterium-infected competent cell by electric shock; obtaining 2mDNA1-bioBAgrobacterium with silent expression vector

(2) Construction of 2mDNA 1-mediated whitefly gene silencing system

(ii) the 2 mDNA-containing 1-bioBAfter the agrobacterium of the silent expression vector is inoculated to a healthy plant according to an agrobacterium infection method, a VIGS plant carrying a 2mDNA1 silent vector is obtained through specific detection of 2mDNA 1;

feeding whiteflies on the VIGS plants carrying 2mDNA1 silencing vectors; obtaining a DNA having 2mDNA1-bioBSilencing expression vectorsWhitefly in vivo, said gene silenced whitefly biotin-synthesizing genebioBExpression is inhibited and the gene-silenced whitefly biotin content is reduced.

(3) 2mDNA 1-mediated horizontal transmission of whitefly gene silencing system

The peptide has 2mDNA1-bioBAnd inoculating the whitefly with the silent expression vector to a healthy plant, so that the healthy plant obtains a 2mDNA1 silent vector, and a VIGS plant carrying a 2mDNA1 silent vector is obtained, and the VIGS plant carrying a 2mDNA1 silent vector is used for preventing and controlling the whitefly.

Furthermore, the construction of the geminivirus DNA1 molecule-induced whitefly gene silencing system is suitable for bemisia tabaci and greenhouse whitefly.

Further, the whitefly gene target fragment BtbioBHas the sequence shown in SEQ ID NO: 1;

the whitefly gene target fragment BtbioBThe acquisition method comprises the following steps:

amplifying target gene fragment primers of enzyme cutting sites of BamHI and XbaI by using whitefly cDNA as a template and introducing the BamHI and XbaI;

the target gene fragment primers of the BamHI and XbaI endonuclease cleavage sites are p-bioB-F and p-bioB-R, said p-bioB-F has SEQ ID NO: 2, said p-bioB-R has the sequence of SEQ ID NO: 3; the length of the target gene fragment is 100-1000 bp, and the target gene fragment is obtained by purifying the target gene fragment by using a purification kit of Promega corporation after sequencing verificationbioBThe PCR of (1) was performed to purify the product.

Further, the target fragmentbioBThe PCR purified product and the 2mDNA1 carrier are both cut by enzyme by Quickcut restriction enzyme reagent kit of Takara company; the reaction conditions are as follows: 1hour at 30 ℃; 1hour at 37 ℃; the enzyme was inactivated at 70 ℃ for 10 min.

Further, the ones containing BamHI and XbaI cohesive endsbioBThe target gene fragment and the 2mDNA1 vector fragment are connected by adopting a T4 DNA Ligase kit to connect the target genebioBFragment (b): the volume ratio of the 2mDNA1 vector fragment is 6.5 μ L: 1.5 mul, mixed evenly and kept overnight at 4 DEG CLigation to obtain 2mDNA1-bioBAnd (3) connecting the products.

Further, the primers for specific detection of the 2mDNA1 are DNA1F and DNA1R, wherein the DNA1F has a nucleotide sequence shown in SEQ ID NO: 4, and the DNA1R has the nucleotide sequence shown in SEQ ID NO: 5.

Further, in the step (2) 2mDNA1 mediated whitefly gene silencing system construction, the whitefly is bemisia tabaci, and the VIGS plant is a VIGS tomato plant; the method for feeding the whitefly on the VIGS plant carrying the 2mDNA1 silencing vector comprises the following steps: taking the tobacco whitefly of which the emergence is 1d, feeding the tobacco whitefly on the VIGS tomato plant for 3-5 d to obtain 2mDNA1-bioBWhitefly of silent expression vector.

Further, in the step (3) 2mDNA1 mediated horizontal transmission of whitefly gene silencing system, the whitefly is Bemisia tabaci, the healthy plant is tomato, and the plant has 2mDNA1-bioBThe method for inoculating the bemisia tabaci with the silent expression vector to the healthy plants comprises the following steps: fixing the inoculation container containing Bemisia tabaci on the lower leaves of healthy tomato plants, wherein 30-40 heads of each plant are 2mDNA1-bioBAnd (5) silencing bemisia tabaci of the expression vector, and eating for 14 d.

The invention has the beneficial effects that:

(1) the method uses the biotin synthetic gene of the whitefly eating VIGS plantbioBExpression is inhibited and then biotin-synthesizing gene is obtainedbioBThe whitefly with the expression inhibited is taken to eat the healthy plant, so that the plant becomes a VIGS plant, and the healthy whitefly also becomes a biotin synthetic gene after being taken by other healthy whitefliesbioBThe expression of the inhibited whiteflies is repeated in this way, and the gene silencing effect is formed, so that the effect of horizontal transmission of the whiteflies among plants is achieved, and the field control effect is achieved.

(2) The advantages of the added biotin for reducing and preventing whiteflies are as follows: the bemisia tabaci eats the phloem juice of the VIGS plant, biotin cannot be normally synthesized in the bemisia tabaci, so that the biotin in the bemisia tabaci is reduced, the death rate is extremely high, the egg laying amount is remarkably reduced, the population quantity is remarkably inhibited, and the field control effect is achieved.

Drawings

FIG. 1 shows eclosion of tobacco powder for 1dBiotin synthetic gene after 3d feeding of VIGS tomato carrying 2mDNA1 silencing vector by lousebioBThe expression situation is shown in the figure, 2mDNA1 is the bemisia tabaci which takes the tomato carrying 2mDNA1 empty vector, 2mDNA1-bioBCarrying 2mDNA1 for feedingbioBWhitefly of tomato;

FIG. 2 shows the change of biotin content after eclosion of 1d Bemisia tabaci fed on 3d of VIGS tomato carrying 2mDNA1 silencing vector, wherein 2mDNA1 is Bemisia tabaci fed on tomato carrying 2mDNA1 empty vector, and 2mDNA1-bioBCarrying 2mDNA1 for feedingbioBWhitefly of tomato;

FIG. 3: carrying 2mDNA1-bioBThe carrier Bemisia tabaci enables the healthy tomatoes to infect the carrier, and the detection of the 2mDNA1 primer proves that the healthy tomatoes have 2mDNA1-bioBAnd (3) a carrier. CK is untreated tomato, CK + is 2mDNA1 plasmid PCR, and 1-8 are tomatoes obtained by a mode of horizontally spreading a vector by bemisia tabaci;

FIG. 4 shows eclosion of Bemisia tabaci at 1d feeding by infection with 2mDNA1-bioBTomato-later gene expression of the vector.

Detailed Description

Construction method of Bemisia tabaci gene silencing system induced by geminivirus DNA1 molecule

1.2 mDNA1 silencing expression vector construction

1.1 acquisition of Bemisia tabaci Gene target fragment

The gene target fragment BtbioBHas the sequence shown in SEQ ID NO: 1, and the nucleotide sequence shown in the figure:

atggctttga gatggtcgct ggaggaggct ttgcgagtgt tcaaattacc gatggcagac

ttgatgtatc aggcccagtc tacccaccgg gccaacttca accctaacga aatgcaaatc

agcacgcttc tgagcatcaa gacgggcgct tgcccagaaa actgctcgta ctgtccccag

tcagcctact acaaaacgga gatcaagaag gagcctctga tggatttagc ggaggttgtt

gccgccgcga aggcagccaa agagggtgga agtacccgtt tctgcatggg tgctgcttgg

cgtggaccca ctgacaggaa tctcccgttg gtctgtgata tggtcaaaga ggtgaagaag

ttgggtctag agacttgcgt tacattagga cttctgaagg accgccacgc ggtacaacta

aaagaggccg gactggactt ctacaaccac aacatcgaca cgtcgccgga gtactacaag

aagatcatct cgacgaggac tttcgaggat cgaatccgga ccctggagca cgtgcgcaac

gccgggatca aggtctgctg cggcgggatc ctcgggatgg gcgagaacac cgaggaccgg

atcaagatgc tcctggtgtt ggcgaacctg gaggagcctc ctgaatcagt cccgatcaat

cagctgattc cgatccctgg gactccactc gccgatgcgg atcccgtcga gggcaccgac

ttcgtgcgga ccatcgctct cacccgggtc atgatgccca aggcctacat ccgtctctcc

gccggccggg agaacatgtc cgaggagatg cagacgctct gttttttggc gggagtcaac

tctatcttct acggcgagaa gctcctcacg gccaagaact tccagccgag caaggacgat

cagttactca gtaagctcgg cttcaagaag atggagatcg atgagacgcc ggccagcagt

cagtgtaagg aggcggccat tgggtga

the method for acquiring the bemisia tabaci gene target fragment comprises the following steps:

amplifying target gene fragment primers of enzyme cutting sites of BamHI and XbaI by using bemisia tabaci cDNA as a template;

the target gene fragment primers of the digestion sites of the BamHI and XbaI endonuclease are as follows:

p-bioB-F（SEQ ID NO：2）:CGGGATCCTCGGGATGGGCG；

p-bioB-R（SEQ ID NO：3）:GCTCTAGATCACCCAATGGCCGCCTC）；

the length of the target gene fragment is 100-1000 bp, and the target gene fragment is obtained by purifying the target gene fragment by using a purification kit of Promega corporation after sequencing verificationbioBThe PCR purified product of (1);

reference may be made to: ren FR, Sun X, Wang TY, Yao YL, Huang YZ, Zhang X, et al, Biotin rendering by means of a transformed genes from bacteria related animal fibers, ISME J. 2020; 14(10): 2542-53.

1.2 double digestion of PCR purified product of target fragment and 2mDNA1 vector

By using TaQuickCut kit from kara; the reaction conditions of the target fragment PCR purified product and the 2mDNA1 vector are as follows: respectively at 30 ℃ and 1 hour; 1hour at 37 ℃; inactivating the enzyme at 70 deg.C for 10 min; obtaining a target gene containing BamHI and XbaI cohesive endsbioBFragment and 2mDNA1 vector fragment.

1.3 target genesbioBThe fragment was ligated with the 2mDNA1 vector fragment

The DNA containing BamHI and XbaI cohesive ends was digested with T4 DNA Ligase (enzyme from Promega Co.)bioBTarget Gene fragment, and 2mDNA1 vector fragment the target gene was ligated with the T4 DNA Ligase vector according to the protocolbioBFragment (b): the volume ratio of the 2mDNA1 vector fragment is 6.5 μ L: 1.5 mu L, mixing uniformly, connecting overnight at 4 ℃ to obtain 2mDNA1-bioBAnd (3) connecting the products.

1.4 2mDNA1-bioBLigation product heat shock transformation of clone strain Escherichia coli DH5 alpha

The specific operation steps are as follows:

(1) one tube of E.coli DH 5. alpha. competent cells (purchased from Takara Co.) stored in a refrigerator at-80 ℃ was thawed on ice;

(2) in clean bench, a sterile 2mL centrifuge tube was added with 10. mu.L of 2mDNA1-bioBConnecting the product, 50 mu L of competent cells, gently mixing the mixture and ice-bath for 10-30 min;

(3) quickly cooling on ice for 5 min after hot shock at 42 ℃ for 60-90 s;

(4) adding 940. mu.L LB liquid medium (without antibiotics), and shake-culturing at 37 deg.C and 200 rpm in a shaker for 1 h;

(5) centrifuging at 8,000 rpm for 1 min, leaving 200 μ L precipitate, re-suspending the bacterial solution, respectively taking appropriate amount, uniformly coating on LB-Kana plate (X-Gal (20 μ L) and IPTG (10 μ L), and culturing at 37 deg.C in an inverted manner overnight;

(6) and picking white single colonies by using a sterile small-size gun head, culturing the white single colonies in an LB-Kana liquid culture medium at 37 ℃ for 8-10 h by using a shaking table at 230 rpm, and performing related detection.

The references cited are: huang, C.J., Xie, Y.,& Zhou, X.P. (2010). Efficient virus‐induced gene silencing in plants using a modified geminivirus DNA1 component. Plant Biotechnol J, 7(3), 254-265；

the establishment and the application of a gene silencing system induced by the Huangchangjun (2009) geminivirus DNA1 molecule.

Carrying out 2mDNA1 specific detection on the transformed escherichia coli liquid PCR:

primer DNA1F (SEQ ID NO: 4): GTATGAGCCTTTAATGGCC;

primer DNA1R (SEQ ID NO: 5): GAGACTCTTCCTCTTGCC;

the correct strain was verified to contain 2mDNA1-bioBThe recombinant plasmid is cultured and replicated in a large amount in Escherichia coli DH5 alpha, and the recombinant plasmid of the thallus is extracted by a plasmid miniextraction kit of Tiangen corporation, namely 2mDNA1-bioBRecombinant silent expression vector, the concentration of recombinant plasmid is adjusted to 30-40 ng/uL; and then used for the next shock conversion.

1.5 2mDNA1-bioBRecombinant silent expression vector electric shock transformation agrobacterium tumefaciens EHA105

The method comprises the following steps:

(1) adding 10 μ L of the recombinant plasmid in the previous step into 200 μ L of Agrobacterium tumefaciens competent cells, sucking with a sterile gun head for several times, mixing gently, transferring into an electric shock cup cleaned and precooled in advance, covering with a cover, and placing on ice for 10 min;

(2) preparing a shock device (BIO-RAD), adjusting the voltage to 2400V, adjusting the electric pulse to 25 muF, adjusting the resistance to 400 omega, wiping the surface of the shock cup with a piece of mirror paper, particularly, putting the shock cup into a clamping groove of an electric rotating instrument, pressing a shock button until the end of electric shock is prompted, and generating a smooth curve of successful electric shock;

(3) taking out the electric shock cup, placing the electric shock cup into a super-clean workbench, standing for 2 min at room temperature, adding 800 mu L of YEP liquid culture medium without antibiotics, repeatedly pumping for several times to ensure that bacteria are uniformly distributed and are conveniently transferred into a sterile 2mL centrifuge tube, standing for 1h in an incubator at 28 ℃, and performing shaking culture at the rotating speed of 200 rpm for 3-4 h after the competent agrobacterium is restored to be active;

(4) the culture solution can be stood for half a day at room temperature and then is subjected to subsequent operation;

(5) centrifuging at 8000 rpm for 3 min, discarding 800 μ L of supernatant culture medium, leaving 200 μ L of thallus, fully resuspending, mixing, screening blue white spots according to the humidity of YEP solid culture medium (each 15 mL of culture medium contains X-GaL (20 μ L), IPTG (10 μ L, kanamycin sulfate Kana final concentration 100 μ g/mL, rifampicin Rif final concentration 50 μ g/mL), taking appropriate amount of bacteria liquid, coating uniformly on YEP-Kana-Rif plate (the surface of the coated plate is dried as much as possible, so that monoclonal can grow out, if no monoclonal can reduce antibiotic concentration properly, coating again for culture), and culturing at 28 deg.C in an incubator in a dark place for 48-72 days;

(6) recombinant agrobacterium related detection reference 1.4

This procedure yielded 2mDNA1-bioBThe agrobacterium EHA105 strain of silent expression vector and 2mDNA1 empty vector successfully constructs 2mDNA1-bioBSilencing an expression vector.

2.2 construction of the Michelia tabaci Gene silencing System mediated by mDNA1

2.1 Agrobacterium infection method for obtaining VIGS tomato

Obtaining VIGS tomato (tomato variety L402) by an agrobacterium infection method, which comprises the following steps:

(1) 2mDNA 1-containing protein in 1.5bioBAgrobacterium EHA105 strain silencing expression vector and 2mDNA1 empty vector in a volume ratio of 1: 100 were inoculated in 10 mL YEP liquid medium containing Kana (100. mu.g/mL) and Rif (50. mu.g/mL), respectively, and incubated at 28 ℃ for about 12-16 h to logarithmic growth phase on a shaker at 230 rpm;

(2) centrifuging at 8000 rpm for 5-10 min, and discarding all supernatant;

(3) resuspending the bacterial solution with acetosyringone solution until the OD600 is 1.0-1.5;

(4) the bacterial liquid is placed in an incubator at 28 ℃ and is kept still for about 3 hours, 2mDNA1- bioB Bacterial liquid 1 related to tobacco curly shoot virus TbCSV: 1, uniformly mixing, wherein the volume of 2mDNA1 and TbCSV related bacteria liquid is 1: 1, uniformly mixing the raw materials, and inoculating 3-4 true-leaf tomatoes;

(5) during inoculation, a sterile 1 mL disposable injector is used for injecting phloem from the stem base of a tomato (3-4 true leaves) to be tested, meanwhile, bacterial liquid is smeared at a wound under the condition that the back of the lower tender leaf is divided by a needle head with the bacterial liquid, and each plant is inoculated by 0.2-0.5 mL;

(6) after 14 days of inoculation, extracting DNA from newly grown leaves on the upper part, performing common PCR detection by using specific primers (DNA 1F and DNA 1R) of 2mDNA1, and using the plants (the tomatoes can be called VIGS tomatoes) with detected vectors for subsequent experiments;

2mDNA1 carrying silent vectors were obtained after detectionbioBTomato plants that silence the expression vector and tomato plants of 2mDNA 1;

reference documents: xiyan, et al, (2002) TAS-ELISA and PCR Rapid detection of Bemisia geminivirus [ J ]. report on plant Pathology, 2: 87-91) ];

identification of Lizheng and Yunnan tomato geminivirus and research on pathogenic molecular mechanism of tobacco curly shoot virus [ D ]. Zhejiang university, 2005.

2.2 Bemisia tabaci was reared on VIGS tomato carrying a 2mDNA1 silencing vector

2.1 carrying 2mDNA1-bioBThe method for feeding bemisia tabaci respectively by the VIGS tomato plant (treatment group) with the silent expression vector and the VIGS tomato plant (control group) with 2mDNA1 comprises the following steps: taking tobacco whitefly with eclosion of 1d, if the VIGS tomato is taken for 3d, one part is used for detecting the gene expression of the tobacco whitefly and the other part is used for detecting the content change of biotin in the tobacco whitefly, and the specific steps are as follows:

gene expression: beta actin is used as an internal reference by qRT-PCR and 2 is used^-ΔCtThe data were analyzed. Whiteflies within eclosion 1d were collected and fed on VIGS tomatoes for several days (Control group 2mDNA1-Control, treatment group 2mDNA1-bioB) 5 females were subjected to RNA extraction in each biological replicate, reverse-transcribed to the same concentration with All-in-one cDNA Synthesis SuperMix (Bimake, USA) respectively for control treatment, and detected by qRT-PCRbioBThe gene expression condition, the primers are:

qRT-bioB-F（SEQ ID NO：6）： GTCGCCGGAGTACTACAAGA；

qRT-bioB-R（SEQ ID NO：7）：CGCAGCAGACCTTGATCC；

βactin -F（SEQ ID NO：8） ：TGGAGATGGTGTTTCCCACAC；

βactin -R （SEQ ID NO：9）CCAGCCAAGTCCAAACGAAG）；

feeding carrying 2mDNA1-bioBBemisia tabaci (treatment group) of VIGS tomato with silent vector compared to Bemisia tabaci (control group) of tomato fed with 2mDNA1 vectorbioBExpression was suppressed as shown in FIG. 1, and the treated group was compared with the control groupbioBThe gene expression is obviously reduced and is reduced by 62 percent (P)<0.001), bemisia tabaci gene silencing.

The content of biotin: respectively fetch 2mDNA1-bioBExpression vector silencing VIGS tomato plants (treatment group) and 2mDNA1 VIGS tomato plants (control group) 3d Bemisia tabaci), namely the gene silencing Bemisia tabaci, and the biotin content in the gene silencing Bemisia tabaci is detected by a microbiological method (Ren et al, 2020), and the method silences Bemisia tabacibioBAfter the gene is expressed, the biotin content in the bemisia tabaci bodies of the treatment groups is obviously reduced by 54 percent (P) compared with that of the control group<0.001), see fig. 2.

Reference documents: (Luan JB, Sun XP, Fei Z, Douglas AE. 2018. Matral information of a single acidic animal cell displayed by the bacteria in the white fluorescence Bemis. Current Biology, 28, 459-;

Ren, F.R., Bai, B., Hong, J.S., et al. (2020). A microbiological assay for biotin determination in insects. Insect Sci, 28(2), 415-418。

2.32 mDNA 1-mediated horizontal transmission of whitefly gene silencing system

Carrying 2mDNA1 and 2mDNA1 with foodbioBThe whitefly, which silences the expression vector, inoculated with healthy tomato, carrying 2mDNA1-bioBThe whitefly of the silent expression vector causes healthy tomatoes to obtain 2mDNA1 related silent vectors, thereby playing a role in controlling whitefly. The method comprises the following specific steps:

feeding bemisia tabaci by adopting the VIGS tomato plant carrying the silent carrier obtained in the step 2.1, wherein the specific method comprises the following steps: feeding tobacco whitefly with eclosion 1d on VIGS tomato for 3-5 d to obtain tobacco whitefly carrying 2mDNA1 (control) and 2mDNA1-bioBThe DNA extracted from single-head bemisia tabaci by using the silent expression vector (gene silencing treatment group) is subjected to common PCR detection by using 2mDNA1 specific primers (DNA 1F and DNA 1R), and all bemisia tabaci are carried after the detection of eating VIGS tomato2mDNA1 related silencing vectors. A large number of Bemisia tabaci carrying silencing vectors (both control and treatment) were obtained in this way.

Taking 40 heads to carry 2mDNA1-bioBThe bemisia tabaci of the silent expression vector is fixed on the lower leaves of healthy tomato seedlings with 3-5 main leaves by using a leaf clamping cage, each tomato is clamped with one leaf clamping cage, the bemisia tabaci continuously takes the healthy tomatoes for 14 days, the tomatoes approximately grow to 6-8 main leaves, DNA of young and young leaves at the upper parts of the tomatoes is extracted by referring to a method 2.1, the conditions of the tomato carrying vectors are detected by common PCR, and the tomatoes carrying the vectors can be used for feeding the subsequent bemisia tabaci. The results are shown in FIG. 3, and the 2mDNA1 and 2mDNA 1-carrying protein obtained by horizontal transmission of Bemisia tabaci are obtained in the stepbioBThe tomato with the silent expression vector can be used for feeding bemisia tabaci.

2.4 Bemisia tabaci feed tomato Gene expression obtained by horizontal spread of 2mDNA1-bioB silencing expression vector

The tomatoes obtained in 2.3 were fed with bemisia tabaci which was feathered for 1d, and bemisia tabaci gene expression was performed with reference to 2.2. The gene expression results are shown in FIG. 4, and Bemisia tabaci was fed for 3d (Control 2mDNA1-Control, treatment group 2mDNA 1-bioB), and treatment groupbioBThe gene expression is obviously reduced by 90 percent (P)< 0.001）。

2mDNA1 is a promising vector for gene silencing in insects, particularly insects that feed on the phloem of plants. The vector has strong specificity on target pests, reduces the insecurity to other organisms in an ecosystem, and the research proves that the gene silencing vector modified by the virus transmitted by insects can be horizontally transmitted among different plant individuals through the insects for the first time, so that the gene silencing effect of the pests is expanded, and the vector is more beneficial to being applied to fields.

If the VIGS effect can be transmitted, tomatoes (hosts of silent expression vectors) which can be used for controlling the bemisia tabaci can be continuously obtained through the bemisia tabaci carrying the silent vectors, the defect that the VIGS technology can be obtained only through an agrobacterium infection method in application is overcome, the application range and the effect of the VIGS technology are enlarged, and the application in laboratories and fields is facilitated.

In addition, the method is suitable for other whitefly insects, such as trialeurodes vaporariorum, and the plants with 2mDNA1 mediated horizontal transmission of the whitefly gene silencing system comprise important commercial crops of solanaceae, leguminosae, cruciferae, cucurbitaceae and the like and various weeds of amaranthaceae, euphorbiaceae, compositae, malvaceae, malvaccariae and the like, but are not limited to the crops.

Sequence listing

<110> Shenyang agriculture university

<120> construction of whitefly gene silencing system induced by geminivirus DNA1 molecule

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 987

<212> DNA

<213> Bemisia tabaci (Bemis tabaci)

<400> 1

atggctttga gatggtcgct ggaggaggct ttgcgagtgt tcaaattacc gatggcagac 60

ttgatgtatc aggcccagtc tacccaccgg gccaacttca accctaacga aatgcaaatc 120

agcacgcttc tgagcatcaa gacgggcgct tgcccagaaa actgctcgta ctgtccccag 180

tcagcctact acaaaacgga gatcaagaag gagcctctga tggatttagc ggaggttgtt 240

gccgccgcga aggcagccaa agagggtgga agtacccgtt tctgcatggg tgctgcttgg 300

cgtggaccca ctgacaggaa tctcccgttg gtctgtgata tggtcaaaga ggtgaagaag 360

ttgggtctag agacttgcgt tacattagga cttctgaagg accgccacgc ggtacaacta 420

aaagaggccg gactggactt ctacaaccac aacatcgaca cgtcgccgga gtactacaag 480

aagatcatct cgacgaggac tttcgaggat cgaatccgga ccctggagca cgtgcgcaac 540

gccgggatca aggtctgctg cggcgggatc ctcgggatgg gcgagaacac cgaggaccgg 600

atcaagatgc tcctggtgtt ggcgaacctg gaggagcctc ctgaatcagt cccgatcaat 660

cagctgattc cgatccctgg gactccactc gccgatgcgg atcccgtcga gggcaccgac 720

ttcgtgcgga ccatcgctct cacccgggtc atgatgccca aggcctacat ccgtctctcc 780

gccggccggg agaacatgtc cgaggagatg cagacgctct gttttttggc gggagtcaac 840

tctatcttct acggcgagaa gctcctcacg gccaagaact tccagccgag caaggacgat 900

cagttactca gtaagctcgg cttcaagaag atggagatcg atgagacgcc ggccagcagt 960

cagtgtaagg aggcggccat tgggtga 987

<210> 2

<211> 20

<212> DNA

<213> primer (artificial synthesis primer)

<400> 2

cgggatcctc gggatgggcg 20

<210> 3

<211> 26

<212> DNA

<213> primer (artificial synthesis primer)

<400> 3

gctctagatc acccaatggc cgcctc 26

<210> 4

<211> 19

<212> DNA

<213> primer (artificial synthesis primer)

<400> 4

gtatgagcct ttaatggcc 19

<210> 5

<211> 18

<212> DNA

<213> primer (artificial synthesis primer)

<400> 5

gagactcttc ctcttgcc 18

<210> 6

<211> 20

<212> DNA

<213> primer (artificial synthesis primer)

<400> 6

gtcgccggag tactacaaga 20

<210> 7

<211> 18

<212> DNA

<213> primer (artificial synthesis primer)

<400> 7

cgcagcagac cttgatcc 18

<210> 8

<211> 21

<212> DNA

<213> primer (artificial synthesis primer)

<400> 8

tggagatggt gtttcccaca c 21

<210> 9

<211> 20

<212> DNA

<213> primer (artificial synthesis primer)

<400> 9

ccagccaagt ccaaacgaag 20

Claims (8)

1. The construction of the geminivirus DNA1 molecule-induced whitefly gene silencing system is characterized in that: the method comprises the following steps:

(1) 2mDNA1 silencing expression vector construction

Obtaining a whitefly gene target fragment BtbioBPurified product of PCR of (1)

② the target fragmentbioBThe PCR-purified product of (1) and the 2mDNA1 vector were subjected to double digestion to obtain a target gene containing BamHI and XbaI cohesive endsbioBFragment, 2mDNA1 vector fragment;

③ the target gene containing BamHI and XbaI two cohesive endsbioBThe fragment was ligated with the 2mDNA1 vector fragment to obtain 2mDNA1-bioBA ligation product;

(iv) the 2mDNA1-bioBThe ligation product is hot shocked to transform a clone strain Escherichia coli DH5 alpha; after heat shock treatment, 2mDNA1 specific detection is carried out to obtain 2mDNA1-bioBRecombinant silent expression vector with concentration regulated to 30-40 ng/microliter;

(ii) the 2mDNA1-bioBThe recombinant silent expression vector is transformed into an EHA105 agrobacterium-infected competent cell by electric shock; obtaining 2mDNA1-bioBAgrobacterium silencing the expression vector;

(2) construction of 2mDNA 1-mediated whitefly gene silencing system

(ii) the 2 mDNA-containing 1-bioBAfter agrobacterium of the silent expression vector is inoculated to a healthy plant, a VIGS plant carrying a 2mDNA1 silent vector is obtained through specific detection of 2mDNA 1;

feeding whiteflies on the VIGS plants carrying 2mDNA1 silencing vectors; obtaining a DNA having 2mDNA1-bioBWhitefly silencing expression vector with 2mDNA1-bioBWhitefly biotin synthetic gene of silent expression vectorbioBThe expression is inhibited, and the biotin content is reduced;

(3) 2mDNA 1-mediated horizontal transmission of whitefly gene silencing system

The peptide has 2mDNA1-bioBAnd inoculating the whitefly with the silent expression vector to a healthy plant, so that the healthy plant obtains a 2mDNA1 silent vector, and a VIGS plant carrying a 2mDNA1 silent vector is obtained, and the VIGS plant carrying a 2mDNA1 silent vector is used for preventing and controlling the whitefly.

2. The construction of the geminivirus DNA1 molecule-induced whitefly gene silencing system of claim 1, wherein: the construction of the whitefly gene silencing system induced by the geminivirus DNA1 molecule is suitable for bemisia tabaci and greenhouse whitefly.

3. The construction of the geminivirus DNA1 molecule-induced whitefly gene silencing system of claim 1, wherein: the whitefly gene target fragment BtbioBHas the sequence shown in SEQ ID NO: 1;

the whitefly gene target fragment BtbioBThe acquisition method comprises the following steps:

amplifying target gene fragment primers of enzyme cutting sites of BamHI and XbaI by using whitefly cDNA as a template and introducing the BamHI and XbaI;

the target gene fragment primers of the BamHI and XbaI endonuclease cleavage sites are p-bioB-F and p-bioB-R, said p-bioB-F has SEQ ID NO: 2, said p-bioB-R has the sequence of SEQ ID NO: 3; the length of the target gene fragment is 100-1000 bp, and the target gene fragment is obtained by purifying the target gene fragment by using a purification kit of Promega corporation after sequencing verificationbioBThe PCR of (1) was performed to purify the product.

4. The construction of the geminivirus DNA1 molecule-induced whitefly gene silencing system of claim 1, wherein: the target fragmentbioBThe PCR purified product and the 2mDNA1 carrier are both cut by enzyme by Quickcut restriction enzyme reagent kit of Takara company; the reaction conditions are as follows: 1hour at 30 ℃; 1hour at 37 ℃; the enzyme was inactivated at 70 ℃ for 10 min.

5. The construction of the geminivirus DNA1 molecule-induced whitefly gene silencing system of claim 1, wherein: containing BamHI and XbaI cohesive endsbioBThe target gene fragment and the 2mDNA1 carrier fragment are connected by adopting a T4 DNA Ligase kit, and the target genebioBThe volume ratio of the fragment to the 2mDNA1 vector fragment is 6.5: 1.5, mixing, connecting overnight at 4 ℃ to obtain 2mDNA1-bioBAnd (3) connecting the products.

6. The construction of the geminivirus DNA1 molecule-induced whitefly gene silencing system of claim 1, wherein: the primers for specific detection of the 2mDNA1 are DNA1F and DNA1R, wherein the DNA1F has a nucleotide sequence shown in SEQ ID NO: 4, and the DNA1R has the nucleotide sequence shown in SEQ ID NO: 5.

7. The construction of the geminivirus DNA1 molecule-induced whitefly gene silencing system of claim 2, wherein: in the step (2) 2mDNA1 mediated whitefly gene silencing system construction, the whitefly is bemisia tabaci, and the VIGS plant is a VIGS tomato plant; the method for feeding the whitefly on the VIGS plant carrying the 2mDNA1 silencing vector comprises the following steps: taking the tobacco whitefly of which the emergence is 1d, feeding the tobacco whitefly on the VIGS tomato plant for 3-5 d to obtain 2mDNA1-bioBWhitefly of silent expression vector.

8. The construction of the geminivirus DNA1 molecule-induced whitefly gene silencing system of claim 2, wherein: in the step (3) of horizontal transmission of the whitefly gene silencing system mediated by 2mDNA1, the whitefly is bemisia tabaci, the healthy plant is tomato, and the gene silencing system with 2mDNA1-bioBThe method for inoculating the bemisia tabaci with the silent expression vector to the healthy plants comprises the following steps: fixing the inoculation container containing Bemisia tabaci on the lower leaves of healthy tomato plants, wherein 30-40 heads of each plant are 2mDNA1-bioBAnd (5) silencing bemisia tabaci of the expression vector, and eating for 14 d.

Images